ID: 949358894

View in Genome Browser
Species Human (GRCh38)
Location 3:3210880-3210902
Sequence GCACCCATTATATTTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949358894_949358899 25 Left 949358894 3:3210880-3210902 CCTTCTCTAAATATAATGGGTGC No data
Right 949358899 3:3210928-3210950 GCTGCTAAAATATTGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949358894 Original CRISPR GCACCCATTATATTTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr