ID: 949372124

View in Genome Browser
Species Human (GRCh38)
Location 3:3346984-3347006
Sequence CACTGAAGAGGTTTAATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949372124_949372128 17 Left 949372124 3:3346984-3347006 CCTGACATTAAACCTCTTCAGTG No data
Right 949372128 3:3347024-3347046 TTAAAATTATAAGATTGAGGTGG No data
949372124_949372129 21 Left 949372124 3:3346984-3347006 CCTGACATTAAACCTCTTCAGTG No data
Right 949372129 3:3347028-3347050 AATTATAAGATTGAGGTGGTTGG No data
949372124_949372127 14 Left 949372124 3:3346984-3347006 CCTGACATTAAACCTCTTCAGTG No data
Right 949372127 3:3347021-3347043 TGGTTAAAATTATAAGATTGAGG No data
949372124_949372126 -6 Left 949372124 3:3346984-3347006 CCTGACATTAAACCTCTTCAGTG No data
Right 949372126 3:3347001-3347023 TCAGTGTTTATTTGATAACTTGG No data
949372124_949372130 22 Left 949372124 3:3346984-3347006 CCTGACATTAAACCTCTTCAGTG No data
Right 949372130 3:3347029-3347051 ATTATAAGATTGAGGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949372124 Original CRISPR CACTGAAGAGGTTTAATGTC AGG (reversed) Intergenic