ID: 949373715

View in Genome Browser
Species Human (GRCh38)
Location 3:3363830-3363852
Sequence GACCCTGTCCTGCTTATCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949373715_949373719 18 Left 949373715 3:3363830-3363852 CCCGAGATAAGCAGGACAGGGTC No data
Right 949373719 3:3363871-3363893 TGCAATAGGCAACAGTGAGCTGG No data
949373715_949373718 4 Left 949373715 3:3363830-3363852 CCCGAGATAAGCAGGACAGGGTC No data
Right 949373718 3:3363857-3363879 TACATTGTTGTTCTTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949373715 Original CRISPR GACCCTGTCCTGCTTATCTC GGG (reversed) Intergenic
No off target data available for this crispr