ID: 949377129

View in Genome Browser
Species Human (GRCh38)
Location 3:3403118-3403140
Sequence TGAGTTTTATTTATATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949377129_949377134 24 Left 949377129 3:3403118-3403140 CCAAAATATATAAATAAAACTCA No data
Right 949377134 3:3403165-3403187 CAAATAACCTGGCTTAAAAATGG No data
949377129_949377135 25 Left 949377129 3:3403118-3403140 CCAAAATATATAAATAAAACTCA No data
Right 949377135 3:3403166-3403188 AAATAACCTGGCTTAAAAATGGG No data
949377129_949377130 13 Left 949377129 3:3403118-3403140 CCAAAATATATAAATAAAACTCA No data
Right 949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949377129 Original CRISPR TGAGTTTTATTTATATATTT TGG (reversed) Intergenic
No off target data available for this crispr