ID: 949377130

View in Genome Browser
Species Human (GRCh38)
Location 3:3403154-3403176
Sequence CAAAATAACCCCAAATAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949377129_949377130 13 Left 949377129 3:3403118-3403140 CCAAAATATATAAATAAAACTCA No data
Right 949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949377130 Original CRISPR CAAAATAACCCCAAATAACC TGG Intergenic
No off target data available for this crispr