ID: 949377259

View in Genome Browser
Species Human (GRCh38)
Location 3:3404693-3404715
Sequence GAGTGCCCAAAGTATAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949377252_949377259 12 Left 949377252 3:3404658-3404680 CCACCAAAGGCACCGTGAGACAG No data
Right 949377259 3:3404693-3404715 GAGTGCCCAAAGTATAAGAGGGG No data
949377255_949377259 0 Left 949377255 3:3404670-3404692 CCGTGAGACAGCCGAAAGATGGT No data
Right 949377259 3:3404693-3404715 GAGTGCCCAAAGTATAAGAGGGG No data
949377253_949377259 9 Left 949377253 3:3404661-3404683 CCAAAGGCACCGTGAGACAGCCG No data
Right 949377259 3:3404693-3404715 GAGTGCCCAAAGTATAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949377259 Original CRISPR GAGTGCCCAAAGTATAAGAG GGG Intergenic
No off target data available for this crispr