ID: 949386508

View in Genome Browser
Species Human (GRCh38)
Location 3:3508428-3508450
Sequence AAAAATATACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949386505_949386508 6 Left 949386505 3:3508399-3508421 CCTACACTTGGGCTTAAGAAGGA No data
Right 949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949386508 Original CRISPR AAAAATATACAGAATGAGGA AGG Intergenic
No off target data available for this crispr