ID: 949390946

View in Genome Browser
Species Human (GRCh38)
Location 3:3561598-3561620
Sequence GCCTATAACCTAAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949390946_949390947 2 Left 949390946 3:3561598-3561620 CCTTGCTCATTTAGGTTATAGGC No data
Right 949390947 3:3561623-3561645 AATTCATTTCCTTTCAATGTAGG No data
949390946_949390948 7 Left 949390946 3:3561598-3561620 CCTTGCTCATTTAGGTTATAGGC No data
Right 949390948 3:3561628-3561650 ATTTCCTTTCAATGTAGGACTGG No data
949390946_949390949 8 Left 949390946 3:3561598-3561620 CCTTGCTCATTTAGGTTATAGGC No data
Right 949390949 3:3561629-3561651 TTTCCTTTCAATGTAGGACTGGG No data
949390946_949390950 9 Left 949390946 3:3561598-3561620 CCTTGCTCATTTAGGTTATAGGC No data
Right 949390950 3:3561630-3561652 TTCCTTTCAATGTAGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949390946 Original CRISPR GCCTATAACCTAAATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr