ID: 949398095

View in Genome Browser
Species Human (GRCh38)
Location 3:3636488-3636510
Sequence GACCTCACAGGATTGTTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949398092_949398095 2 Left 949398092 3:3636463-3636485 CCTATCCTAACTGGAACAGAGTG No data
Right 949398095 3:3636488-3636510 GACCTCACAGGATTGTTACGAGG No data
949398091_949398095 7 Left 949398091 3:3636458-3636480 CCTAACCTATCCTAACTGGAACA No data
Right 949398095 3:3636488-3636510 GACCTCACAGGATTGTTACGAGG No data
949398093_949398095 -3 Left 949398093 3:3636468-3636490 CCTAACTGGAACAGAGTGTTGAC No data
Right 949398095 3:3636488-3636510 GACCTCACAGGATTGTTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949398095 Original CRISPR GACCTCACAGGATTGTTACG AGG Intergenic