ID: 949401632

View in Genome Browser
Species Human (GRCh38)
Location 3:3670607-3670629
Sequence AGTCATTTCCAGAAGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949401631_949401632 -10 Left 949401631 3:3670594-3670616 CCTTAAGACACACAGTCATTTCC No data
Right 949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG No data
949401630_949401632 -9 Left 949401630 3:3670593-3670615 CCCTTAAGACACACAGTCATTTC No data
Right 949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG No data
949401629_949401632 7 Left 949401629 3:3670577-3670599 CCACTTGAATACATGTCCCTTAA No data
Right 949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949401632 Original CRISPR AGTCATTTCCAGAAGATGCC AGG Intergenic
No off target data available for this crispr