ID: 949409537

View in Genome Browser
Species Human (GRCh38)
Location 3:3748899-3748921
Sequence AATTATGCACAGAGGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 5, 3: 10, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949409537 Original CRISPR AATTATGCACAGAGGGCTAT GGG Intronic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
905184936 1:36189410-36189432 AATTAAGCACACAGTGCTTTGGG + Intergenic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
910347993 1:86263011-86263033 AATTATTTACAAAGTGCTATGGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
919245972 1:194984588-194984610 AAGTATGCCCAGAGTGTTATGGG + Intergenic
920581088 1:207108691-207108713 AATTAGGCCCAGAGGTCTGTGGG + Intronic
921971105 1:221150135-221150157 AAGTATAGATAGAGGGCTATGGG + Intergenic
922040226 1:221889153-221889175 ATTTAGCCACATAGGGCTATTGG - Intergenic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1067720925 10:48727221-48727243 AATTAGGGACAGAGGGCTGAGGG + Intronic
1069978815 10:72237860-72237882 ATTTATGCACAGAAGGCTAGTGG - Intergenic
1070448277 10:76530283-76530305 ATTTATGCACTGAGGAATATAGG + Intronic
1072700156 10:97634719-97634741 TATTATGCAGAGAAGGCTACAGG + Intronic
1075001834 10:118804454-118804476 AATTAGGCACAAAGGGCATTAGG + Intergenic
1076240883 10:128906363-128906385 AATTGTGCCTAGAGGGCTGTTGG - Intergenic
1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG + Intergenic
1080916139 11:36662198-36662220 AATAATGCACAGAGGTGTAATGG + Intergenic
1081800679 11:45856978-45857000 ACTCATGGACAGAGGGCTGTGGG + Intronic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1085730570 11:78995041-78995063 AGTTATGCCAAGAGTGCTATCGG + Intronic
1085769848 11:79315021-79315043 AGTTATGCACAGAGGGTGGTAGG + Intronic
1086920311 11:92579347-92579369 AATTATGACCAGAGGATTATAGG + Intronic
1087702398 11:101450205-101450227 CATTAGGCAAAGAAGGCTATGGG - Intergenic
1089305212 11:117522153-117522175 AATTAGGCACAGAATGCTCTAGG - Intronic
1090093098 11:123716836-123716858 CAACATGCACAGAGGGCTGTGGG - Intergenic
1090169747 11:124590409-124590431 AAATCTGCACAGAGGTCTACCGG + Intergenic
1091288462 11:134422694-134422716 AATTCTGCACATAGGGCCAGGGG - Intergenic
1092974832 12:13734723-13734745 AGGTATGAACAAAGGGCTATGGG + Intronic
1093389401 12:18600405-18600427 AACTATGCTCAGAGGAATATTGG + Intronic
1099364580 12:81752586-81752608 AGTTATTCACACAGGGTTATGGG + Intronic
1101321252 12:103674980-103675002 AATCATCCACAGAGGACTGTCGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108257274 13:48622857-48622879 AATTATGCACAGACTCATATGGG + Intergenic
1108725385 13:53175202-53175224 AATTCTGGACACAGGACTATGGG - Intergenic
1111764909 13:92516200-92516222 AATTATGCACTGAGTACTGTGGG + Intronic
1112362559 13:98730643-98730665 AACGATGCACTGAGGGCTGTGGG - Intronic
1113981016 13:114275907-114275929 TAATATGCTCAGAGGGCTAGCGG - Intergenic
1117869155 14:60180768-60180790 AAATATGCACAAAGAGCTAAAGG - Intergenic
1120398660 14:84000794-84000816 AATTAAGGAGAGAGGGCTATTGG - Intergenic
1122093264 14:99353636-99353658 ATTTATACACAGAGGGCTTAAGG + Intergenic
1124991055 15:34674197-34674219 AAATATGCACAGGTGGCTGTGGG - Intergenic
1133725346 16:8532294-8532316 AAGTTTACACAGAGGGCTAGAGG - Intergenic
1141853054 16:86660609-86660631 ACTTAGGCACAGAGGTTTATGGG - Intergenic
1149339835 17:55673936-55673958 AATTATGCACCCTGGGATATTGG - Intergenic
1149351763 17:55795997-55796019 AATTCTGCACAGAGGCGTCTAGG + Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1157517169 18:48318988-48319010 AGAGATGGACAGAGGGCTATGGG + Intronic
1157814585 18:50721578-50721600 GATTGTGCAGAGAGGTCTATGGG + Intronic
1157911924 18:51624492-51624514 ATTTATGCCCCGAGGGCTTTAGG - Intergenic
1158743167 18:60166732-60166754 AAGTATAGACAGAGGGCTACTGG - Intergenic
1164417219 19:28057353-28057375 CATTATGCACTGAGGCCTGTGGG + Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
927098645 2:19768890-19768912 CATTATGCACAAAAGGCCATTGG - Intergenic
928632217 2:33205648-33205670 CATTCTGAACAGGGGGCTATGGG - Intronic
929626759 2:43416710-43416732 AATTATGAAAAGAGGGCAGTAGG + Intronic
929734449 2:44532041-44532063 CATTCTGTACAGAGGTCTATAGG - Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932813717 2:74844899-74844921 AGTTATACACAAGGGGCTATGGG - Intronic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
942766811 2:179467123-179467145 AATTATGCACCTGGGGATATGGG - Intronic
945334549 2:208577093-208577115 ATTTATGCAAAGAATGCTATCGG - Intronic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
1169002495 20:2178062-2178084 AATGACACACAGAGGGCTGTGGG - Intergenic
1171154264 20:22858056-22858078 GATTATGCCCAGGGTGCTATGGG - Intergenic
1173556531 20:43969993-43970015 AATTATCCACAGAGAGCAGTGGG - Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1182733040 22:32510676-32510698 ATTCAAGCACAGAGAGCTATAGG - Intergenic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
949346363 3:3080509-3080531 AGTGAAGCACAGAGAGCTATAGG - Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
950549801 3:13659241-13659263 AATTATTCCAAGAGGGCTGTGGG - Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
954311790 3:49774854-49774876 AATTATGACCAGAGGCCTACAGG - Intronic
954466782 3:50659916-50659938 AATTATGCTCACAGGATTATTGG + Intergenic
955256036 3:57332442-57332464 ATTTTTGCACAGGGGGCAATAGG + Intronic
955264806 3:57431959-57431981 AATTATGAAAAGACAGCTATAGG - Intronic
956000169 3:64721439-64721461 TATTATGTACAAAGGACTATAGG - Intergenic
956077276 3:65518983-65519005 AAATATGCACAGAGGACTAAAGG + Intronic
960313816 3:116151238-116151260 AATGATGCACAGAGTGCCCTGGG + Intronic
961520361 3:127464218-127464240 AATTATCCACAGAGGGCATCAGG - Intergenic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962514443 3:136137162-136137184 AATTATGTAAAGAAGGCTAAAGG + Intronic
965081911 3:164044083-164044105 AATTATTCACAAAGGGTTGTGGG + Intergenic
967087715 3:186109338-186109360 ATTTATGCACCGGGGGCCATTGG + Intronic
969971147 4:11049611-11049633 AATTAATCTCAAAGGGCTATGGG - Intergenic
974251194 4:59386441-59386463 TAATAGGCACACAGGGCTATTGG - Intergenic
976322236 4:83729024-83729046 AATTATACACAAAGGTATATAGG + Intergenic
977058190 4:92219739-92219761 AACTATGCACAGAGTTCTAATGG - Intergenic
979597544 4:122550923-122550945 AAGTTTTCACAGAGGGCAATAGG + Intergenic
982421700 4:155207116-155207138 AATTATGCCCACAGGAGTATAGG - Intergenic
986061967 5:4200356-4200378 AATTATGCACGGATGGCATTAGG - Intergenic
986558798 5:9039648-9039670 AAATATGCTCAGAGGGGAATGGG + Exonic
986785868 5:11113334-11113356 AATTATGCACAACCGGCTGTGGG - Intronic
991171477 5:63631019-63631041 AATTATGCATAGAACACTATAGG + Intergenic
991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG + Intergenic
991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG + Intergenic
995229704 5:109745407-109745429 ATATATGCACAAAGGGTTATGGG - Intronic
997710814 5:136002555-136002577 AATCATGCATACAGGACTATTGG - Intergenic
1000815317 5:165914435-165914457 AATTATGCTGAGAAGGCTGTAGG - Intergenic
1002115271 5:176957106-176957128 AATAAAGCAGAGAGGCCTATAGG + Intronic
1003501229 6:6704554-6704576 ATTTATGCCCAGAGGCCTCTGGG - Intergenic
1006506792 6:34494315-34494337 ATTTAAGCACAGAGAGCTCTGGG - Intronic
1008831832 6:55774005-55774027 AGTTATGCACAGAGAGTTATGGG - Intronic
1011088919 6:83572765-83572787 AATTCTGCACAGAAGGGAATAGG + Intronic
1011260262 6:85462886-85462908 AATTGTCCAGAGAGGGCTACTGG - Intronic
1014680939 6:124429461-124429483 AAGTATGCACAAAGTGCCATGGG - Intronic
1014829609 6:126086910-126086932 AGGTATGCACAGGGAGCTATGGG - Intergenic
1020746477 7:12085501-12085523 AATCATGCAAAGAGTGCTATGGG - Intergenic
1025020169 7:55474460-55474482 AATGAGGCACTGAGGGCTGTCGG + Intronic
1025844184 7:65180870-65180892 CAGTATACACAGAGTGCTATGGG - Intergenic
1025894510 7:65687181-65687203 CAGTATACACAGAGTGCTATGGG - Intergenic
1026898681 7:74025386-74025408 AATTGCCCACAGAGGGCTACCGG - Intergenic
1033103047 7:138493143-138493165 AACTATGCACAAAGAGCTAAAGG - Intronic
1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG + Intergenic
1039615142 8:38949662-38949684 AATTATACACAGAGCCCTTTTGG - Intronic
1041631783 8:60096799-60096821 AATTTAGCAGAGATGGCTATTGG - Intergenic
1043810850 8:84738121-84738143 AATGAAGCACACAGGGCTATGGG + Intronic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1047545987 8:125817435-125817457 AATTGTGAACAGAGGATTATAGG + Intergenic
1048327400 8:133450182-133450204 AAATACGCACTGAGGGCCATGGG - Intergenic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1055813062 9:80174121-80174143 AATGATGCACGTAGAGCTATGGG + Intergenic
1057498577 9:95579014-95579036 ATATATGAGCAGAGGGCTATGGG + Intergenic
1059297185 9:113281838-113281860 CAGTAAGCACAGAGGGCTAGAGG - Intronic
1060611687 9:124971743-124971765 AAGCATGCGCAGAGGCCTATGGG - Exonic
1186068821 X:5795477-5795499 AACTATGCAGAGAGGGAAATAGG - Intergenic
1186787399 X:12966531-12966553 AATTATGCCTAAAGGACTATGGG + Intergenic
1186803390 X:13115719-13115741 AATTATTCCCAGAGGCCTACGGG + Intergenic
1187007132 X:15243509-15243531 AAATATGCACAAATGGCTAGTGG - Intronic
1187998357 X:24953788-24953810 AATTATGTACGGAGGTCTAGAGG + Intronic
1188391683 X:29628643-29628665 AAGTATGGACACAGTGCTATGGG - Intronic
1189357565 X:40322948-40322970 AATTACCCACAGATGGCTGTGGG + Intergenic
1190760011 X:53431279-53431301 TATTAGGCACAGAGGGCGACTGG + Exonic
1191969350 X:66796260-66796282 AATTATGGACAAAGGAATATAGG + Intergenic
1192072741 X:67958386-67958408 AATTATGCAAAGAGGGCCAAAGG - Intergenic
1192540065 X:71960902-71960924 ATTTATGCAAAAAGGGATATTGG + Intergenic
1197283014 X:124559961-124559983 AATTATGGACAGAGAACAATGGG + Intronic
1200810917 Y:7483884-7483906 AATTAGCCACAGATGGCTAGAGG - Intergenic