ID: 949409927

View in Genome Browser
Species Human (GRCh38)
Location 3:3752738-3752760
Sequence ATTAGCAATGCTAATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949409927_949409932 29 Left 949409927 3:3752738-3752760 CCTCCAGGATTAGCATTGCTAAT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 949409932 3:3752790-3752812 TTGGGTCTCCCACATCATTCTGG 0: 1
1: 0
2: 4
3: 16
4: 209
949409927_949409931 11 Left 949409927 3:3752738-3752760 CCTCCAGGATTAGCATTGCTAAT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 949409931 3:3752772-3752794 TGCTCTCAAAACATCTTTTTGGG 0: 1
1: 0
2: 3
3: 29
4: 399
949409927_949409930 10 Left 949409927 3:3752738-3752760 CCTCCAGGATTAGCATTGCTAAT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 949409930 3:3752771-3752793 TTGCTCTCAAAACATCTTTTTGG 0: 1
1: 0
2: 0
3: 25
4: 324
949409927_949409933 30 Left 949409927 3:3752738-3752760 CCTCCAGGATTAGCATTGCTAAT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 949409933 3:3752791-3752813 TGGGTCTCCCACATCATTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949409927 Original CRISPR ATTAGCAATGCTAATCCTGG AGG (reversed) Intronic
907297938 1:53467475-53467497 ATGAGCAATGGAAATCCTTGTGG + Exonic
907560318 1:55381816-55381838 ATGAGCCATGCTCATGCTGGGGG + Intergenic
908650967 1:66332524-66332546 ATTAGCAATGGAAACGCTGGAGG + Exonic
911640415 1:100282625-100282647 ATTAGGAATGCTCAACCTGTAGG - Intronic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
913668886 1:121076046-121076068 ATAAGCATTGCTGAGCCTGGTGG - Intergenic
914020630 1:143863479-143863501 ATAAGCATTGCTGAGCCTGGTGG - Intergenic
915692055 1:157699577-157699599 ATCAGCAATGCTAATGCTCTGGG - Intronic
916664229 1:166950955-166950977 AAATGCAATGCTAATCCAGGAGG - Intronic
920695339 1:208177773-208177795 GTTAGCAATGCAAATTCTTGGGG + Intronic
1065488878 10:26261989-26262011 ATTAGAAATTATAATCCTGAAGG - Intronic
1072075328 10:91966264-91966286 ATTAGCAATCCTGATCATGTAGG + Intronic
1073655561 10:105411582-105411604 GCTAGGAATGCAAATCCTGGAGG - Intergenic
1077545300 11:3166592-3166614 AATGGCAATGCTAGCCCTGGGGG - Intronic
1078583543 11:12559130-12559152 ATTAGCAAAGGTTATCTTGGAGG - Intergenic
1080086937 11:28294298-28294320 ATGTGCAATGCTAATCCAAGTGG + Intronic
1081630469 11:44686139-44686161 ATCAGTATTGCTCATCCTGGTGG - Intergenic
1084686548 11:70699269-70699291 ATTAGAAATGTTAATCATGTGGG - Intronic
1085076909 11:73599272-73599294 ATTAGCAATGATTATCTTGGGGG + Intergenic
1085286201 11:75363378-75363400 TTTAGACATGCTAATTCTGGAGG + Intergenic
1088556957 11:111071527-111071549 AGTAAAAATGCTAATCTTGGAGG - Intergenic
1089074560 11:115727902-115727924 ATTAGCAATGTTCACGCTGGTGG - Intergenic
1090790399 11:130088446-130088468 ATTAGCAATGCGAATCATCTAGG + Intronic
1091127976 11:133118951-133118973 ATTAGCAATGTTAGTCCCGAAGG + Intronic
1091940087 12:4471651-4471673 ATTAGAAACGCTAACTCTGGTGG - Intergenic
1094160556 12:27385395-27385417 ATTAGCAATGCTGCTGCTGCTGG - Intronic
1096159073 12:49361484-49361506 ATTAGCAAGGCTAGGCATGGTGG - Intergenic
1098810113 12:75077195-75077217 ACTGGCAATGCTAGTCCTCGTGG - Intronic
1101801861 12:108029341-108029363 CTTTGAAATGCTAATCGTGGGGG + Intergenic
1104440150 12:128787648-128787670 ATTAGCACTGCCGGTCCTGGAGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107206459 13:37795969-37795991 ATTAGCAATGAAAATGCTGATGG + Intronic
1114599305 14:23941582-23941604 ATTAGGCATGCTATGCCTGGTGG + Intergenic
1116753236 14:48913043-48913065 ATTAGCAAAGTTAATCCAAGGGG + Intergenic
1121524114 14:94606669-94606691 GTTAGAAATGCTAATTCTTGGGG - Intronic
1125338351 15:38650642-38650664 AGTAGCAAGCCTAATTCTGGGGG - Intergenic
1134040751 16:11066423-11066445 ATCAGCAGGGCTGATCCTGGAGG + Intronic
1155059245 18:22213924-22213946 ATTAACAATGCTGAGCGTGGTGG + Intergenic
1155341204 18:24816271-24816293 AATAGCAATGATAAACATGGGGG - Intergenic
1157212243 18:45753594-45753616 ATCAGCAATGCAGATCCTGAAGG + Intergenic
1158016590 18:52791136-52791158 ATTAGAAAAGCAACTCCTGGGGG - Intronic
927822735 2:26282856-26282878 ATCTGCAATGTTAATCATGGCGG + Exonic
931942982 2:67273335-67273357 ATTTGCAATGTAATTCCTGGTGG - Intergenic
940117416 2:150224341-150224363 TTTAGTAATTCTAATGCTGGAGG + Intergenic
941649349 2:168077004-168077026 CTTAGCAACGCTGATCATGGTGG + Intronic
942943996 2:181653594-181653616 ATTGTGAATGCTAAGCCTGGAGG + Intronic
946442853 2:219711451-219711473 AATACAAATGCAAATCCTGGTGG - Intergenic
947406364 2:229781593-229781615 ATTTGTAACCCTAATCCTGGGGG + Intronic
1169797732 20:9482690-9482712 ATAAGCAGTGCTAAACCTTGTGG + Intergenic
1177172969 21:17674318-17674340 ATTATCAATCCTATTCCTGTAGG - Intergenic
1177630457 21:23720658-23720680 ATTAAAACTGCAAATCCTGGCGG - Intergenic
949409927 3:3752738-3752760 ATTAGCAATGCTAATCCTGGAGG - Intronic
949747961 3:7316675-7316697 AACAGCAATGCCAATTCTGGAGG + Intronic
950238046 3:11340900-11340922 ATTAACAATGCATATCCTGAAGG + Intronic
951809235 3:26681198-26681220 ATTAACAATGCGAATCCTTTGGG + Intronic
952858483 3:37792886-37792908 GTAAGGAATGCTTATCCTGGAGG + Intronic
957558305 3:81788144-81788166 ATTAGCTCAGCAAATCCTGGAGG - Intergenic
961741137 3:129033817-129033839 ATAAGCAATGCAGATGCTGGGGG + Intronic
962031526 3:131606018-131606040 ATGAGCCATGCTACTCATGGTGG + Intronic
964443600 3:156737803-156737825 ATTTGAATTGCTCATCCTGGGGG + Intergenic
970100759 4:12518964-12518986 ATTAGCTATGATAATTCTAGAGG - Intergenic
970291870 4:14581833-14581855 AGTGGCCATGCCAATCCTGGGGG + Intergenic
972618983 4:40728652-40728674 ATAAGCAATGCTAATTATAGAGG - Intergenic
974311673 4:60219306-60219328 ATTATCAATGCTAAAGCTGAAGG + Intergenic
976090841 4:81455888-81455910 ATTAGCAAAGATAATTCTTGGGG - Intronic
976193332 4:82509936-82509958 ATTACCCATGCTAATCCTTGAGG + Intronic
979438614 4:120724317-120724339 ATTAGTAAAGAAAATCCTGGCGG + Intronic
979866521 4:125761955-125761977 AATAGAAATGCTAATTCTAGAGG - Intergenic
981838360 4:149081396-149081418 ATGAGCATTCTTAATCCTGGAGG + Intergenic
983834391 4:172370476-172370498 ATTAGCCAGGCTAATTTTGGTGG + Intronic
987360318 5:17100445-17100467 GTCAGCAGTGCTACTCCTGGTGG + Intronic
988339280 5:29949204-29949226 GTTAGAACTGCTATTCCTGGTGG - Intergenic
989429328 5:41334240-41334262 ATTAGCAATGATAATACTTTGGG + Intronic
993668699 5:90733131-90733153 ATTAGAAATGAAAATCCTTGTGG + Intronic
995382692 5:111552245-111552267 ATTAGCCTTGCTAACCCTTGTGG - Intergenic
996662338 5:126019330-126019352 GTTAGAAATGCAAATCCTTGTGG + Intergenic
996870312 5:128184008-128184030 ATTAGGAATGCTAAACCAGCAGG - Intronic
997841931 5:137249126-137249148 ATCAGCAATGCTATTCTTTGTGG + Intronic
1004474395 6:15957678-15957700 TTTAACAACCCTAATCCTGGAGG - Intergenic
1013648488 6:112169391-112169413 AATAGCAAGGCTAATCCACGTGG + Intronic
1014008392 6:116447954-116447976 AATAGAAATGCTAACTCTGGGGG + Intergenic
1014157118 6:118124157-118124179 AGTGGCAAAGCTAATACTGGAGG - Intronic
1014242319 6:119031757-119031779 CTTAGCAATGTTAAGCCTGTTGG - Intronic
1016052453 6:139544220-139544242 ATTAGCAAAGGTAAACCTTGGGG - Intergenic
1019877399 7:3826280-3826302 ATCAGCAGTGCTAATCATGAAGG + Intronic
1028158151 7:87455941-87455963 AGTAGAAATTATAATCCTGGGGG - Intronic
1030875673 7:114810399-114810421 ATTATCCTTGATAATCCTGGTGG + Intergenic
1032796499 7:135281363-135281385 ATGAGTAATGATAATCCTGTTGG + Intergenic
1033612437 7:142977276-142977298 ATTAACAATGGTAGTGCTGGAGG + Intergenic
1033834575 7:145293587-145293609 ACTAGCATTCCTAATCCTAGAGG + Intergenic
1035327559 7:158074798-158074820 ACGAGCAATGCTGATCCTGCTGG - Intronic
1036947385 8:13106990-13107012 ATACTCAATGGTAATCCTGGAGG - Intronic
1039837548 8:41268891-41268913 ATTTGCAATGCAAATGGTGGTGG + Intronic
1041552238 8:59116511-59116533 TGTACCAATGCTAATCATGGTGG + Intronic
1044008083 8:86961942-86961964 ATTTGCATTGCTAACCCTAGGGG + Intronic
1046363562 8:113194606-113194628 ATACAGAATGCTAATCCTGGGGG + Intronic
1048076797 8:131080154-131080176 ATTAGCCAAGCAAATACTGGGGG - Intergenic
1049950207 9:636337-636359 ATTAGCACTGCTGATCATGCAGG + Intronic
1050776133 9:9263041-9263063 AATAGAAATGCTAATCCTCAGGG + Intronic
1051117144 9:13708873-13708895 ACTAGCAATGCTTATCTTAGAGG - Intergenic
1055856756 9:80697364-80697386 ATTATCATTGGTAATGCTGGAGG - Intergenic
1057946753 9:99337143-99337165 ATCAGCAATGCTATACCTGCAGG + Intergenic
1059374591 9:113872414-113872436 TGTAGTAATGCTAGTCCTGGAGG + Intergenic
1186600390 X:11030450-11030472 ATTAGAAATCCTATTCCTGGTGG + Intergenic
1186845889 X:13530719-13530741 ATTAGCAATGCAAATCCTGCTGG + Intergenic
1191663403 X:63673284-63673306 ATTAGCAATCTTAAGCCTTGTGG - Intronic
1195761862 X:108255132-108255154 ATCAGCAAAACTAATACTGGGGG - Intronic
1200276545 X:154738249-154738271 ATGAGCAATGATGGTCCTGGAGG + Intronic