ID: 949414304

View in Genome Browser
Species Human (GRCh38)
Location 3:3799546-3799568
Sequence GCCTAGGGATGCCGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949414304_949414311 -2 Left 949414304 3:3799546-3799568 CCCGGGCGGCGGCATCCCTAGGC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 949414311 3:3799567-3799589 GCGCCTGGGGCGCCTTCCTCCGG 0: 1
1: 0
2: 6
3: 15
4: 166
949414304_949414313 4 Left 949414304 3:3799546-3799568 CCCGGGCGGCGGCATCCCTAGGC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 949414313 3:3799573-3799595 GGGGCGCCTTCCTCCGGACCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949414304 Original CRISPR GCCTAGGGATGCCGCCGCCC GGG (reversed) Exonic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
919811890 1:201414049-201414071 ACCTAGTGATGCCACCACCCAGG + Intronic
921133041 1:212236137-212236159 GCCTAGGGAAGCTGCAGGCCTGG - Intergenic
922332737 1:224591692-224591714 GCCTAGGGATGCTGGCTTCCTGG - Intronic
1069607953 10:69752050-69752072 GCCAAGGGATGGTGCGGCCCAGG - Intergenic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1077032647 11:476510-476532 CCCCAGTGATGCCGCCACCCAGG - Intronic
1078480249 11:11669152-11669174 CCCTAGGGATGCCTCTGTCCAGG + Intergenic
1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG + Intergenic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1083753629 11:64777844-64777866 GCCCAGGGGCGCCTCCGCCCGGG + Intronic
1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG + Intergenic
1088606794 11:111540736-111540758 GCCTAGAGATGCTGCTGCCGCGG + Exonic
1102235735 12:111293484-111293506 ACCGAGGGAAGCCGCCTCCCAGG + Exonic
1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG + Intronic
1104947726 12:132424054-132424076 GCCTGGGGATCCCGCAGCCCAGG - Intergenic
1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG + Intronic
1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG + Intergenic
1114088857 14:19267207-19267229 TCCTAGTGGTGCCGGCGCCCAGG - Intergenic
1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG + Intronic
1122066171 14:99175671-99175693 GCATAGGGTTGCCGCGGCCCGGG + Exonic
1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG + Exonic
1123694341 15:22866395-22866417 GCCAGGGGATGCCGCAGCACAGG - Exonic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1127268019 15:57376639-57376661 CCCTGGGGGTCCCGCCGCCCTGG - Intronic
1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG + Intronic
1132515121 16:362674-362696 GCCTTGGGCTGCTGCAGCCCAGG + Intergenic
1135143167 16:19938955-19938977 GCCAAGTGATGCCGCTGACCAGG - Intergenic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1144741940 17:17588703-17588725 GCCTAGGGGTGCGGGCACCCAGG - Intronic
1153659990 18:7317771-7317793 GCCTAGGGATGCTGCTGCTGGGG - Intergenic
1155235431 18:23813898-23813920 GCCTAGAGATGCCGACTTCCAGG + Intronic
1157483652 18:48072405-48072427 GCCAATGGATGCAGCCACCCAGG - Intronic
1159232824 18:65630771-65630793 GCCTAGGGTTGCTGCCACACAGG + Intergenic
1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG + Intergenic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697594 19:492174-492196 GCCTGGGGCTGGCTCCGCCCAGG - Intronic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1162036551 19:7943295-7943317 TCCACGGGACGCCGCCGCCCCGG + Intronic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
925999781 2:9321430-9321452 GCCCAGGGAGGCCCCCACCCAGG + Intronic
931789376 2:65650334-65650356 GCCTAGTGATCCCGCCTCTCTGG - Intergenic
933667053 2:84971838-84971860 GCCTAGCGCTCCCGCCGCCCCGG + Intronic
935332162 2:101985264-101985286 GGCTAGGAATGCCGCCATCCGGG + Intergenic
937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG + Intergenic
938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG + Intergenic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
945995264 2:216431069-216431091 TCCTAGGCAGGCCCCCGCCCAGG + Intronic
949017840 2:241723491-241723513 GCAGAGGGATGCCGTCACCCAGG + Intronic
1170892540 20:20388373-20388395 CCCTGGAGATGCCCCCGCCCTGG - Intergenic
1173763763 20:45587606-45587628 GCCAAGGAATGCCGTAGCCCAGG - Intergenic
1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG + Intergenic
1180491851 22:15855129-15855151 TCCTAGGGGTGCCGGCGCCCAGG + Intergenic
1180636022 22:17263747-17263769 CACCAGGGATGCTGCCGCCCTGG - Intergenic
1181073911 22:20361841-20361863 GGCTAAGGAGGACGCCGCCCAGG + Intronic
1184127819 22:42500422-42500444 GCCTAGGGGTGGGGCCGCCTAGG + Intergenic
1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG + Intergenic
949093963 3:63686-63708 GTCTAGGGATGCCCCACCCCAGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG + Intergenic
951016949 3:17742275-17742297 GCCTGAGGGTGCCGCCGCCACGG - Intronic
959748235 3:109802887-109802909 GCATAGGGATGCCAACTCCCTGG + Intergenic
966874699 3:184315247-184315269 AGCTAGGCCTGCCGCCGCCCAGG - Intronic
971364548 4:25967302-25967324 GACTAGGGAGGCCCCCGCACTGG - Intergenic
972420022 4:38878291-38878313 GCCTCAGGATGCCAACGCCCTGG + Exonic
987817981 5:22928975-22928997 GCCTAGGCATGCCACAGCACTGG + Intergenic
991216935 5:64166091-64166113 GGCTAGGGTTGCCGCTGGCCTGG + Intronic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
1006294671 6:33164851-33164873 GCCTAGGGATGACGTCACGCAGG - Exonic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG + Intronic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1026004737 7:66591914-66591936 GCCGAGGGAAGCCGCCGCAGAGG + Intergenic
1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG + Intronic
1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG + Intronic
1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG + Intergenic
1037788812 8:21919331-21919353 GCCGAGGTCTGTCGCCGCCCCGG - Intergenic
1039758151 8:40545077-40545099 GCCTAGAGATGCCCCTGGCCTGG + Intronic
1040564906 8:48556398-48556420 CGCTAGGGAGGCCGGCGCCCGGG + Intergenic
1045017363 8:98010899-98010921 GCCTAGGCCTGCCTCAGCCCTGG - Intronic
1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG + Exonic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1057592062 9:96381342-96381364 GCCTTGGGAGGCCACCGCCAGGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060784129 9:126435755-126435777 GCCTCTGGGTGCCGCCGGCCTGG - Intronic
1060897342 9:127225875-127225897 GCCTAGGGGCGCCGGCGGCCCGG - Intronic
1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG + Intergenic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic
1192928598 X:75781840-75781862 GCCTGGGGATGCCACTGCGCAGG - Intergenic
1193308491 X:79977025-79977047 GCATATGGATCCCGCCACCCAGG - Intergenic
1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG + Intergenic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic