ID: 949414619

View in Genome Browser
Species Human (GRCh38)
Location 3:3800760-3800782
Sequence CCAGAAGGAGTGGCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 319}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949414609_949414619 23 Left 949414609 3:3800714-3800736 CCTTGAGCTCCACGCGGGGACAG 0: 5
1: 0
2: 2
3: 7
4: 96
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319
949414612_949414619 -7 Left 949414612 3:3800744-3800766 CCCGTGAGCCTTGAGCCCAGAAG 0: 1
1: 1
2: 3
3: 24
4: 177
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319
949414613_949414619 -8 Left 949414613 3:3800745-3800767 CCGTGAGCCTTGAGCCCAGAAGG 0: 1
1: 0
2: 2
3: 33
4: 303
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319
949414605_949414619 30 Left 949414605 3:3800707-3800729 CCGTGAGCCTTGAGCTCCACGCG 0: 5
1: 0
2: 0
3: 5
4: 101
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319
949414611_949414619 -1 Left 949414611 3:3800738-3800760 CCTCAGCCCGTGAGCCTTGAGCC 0: 1
1: 5
2: 1
3: 14
4: 182
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319
949414610_949414619 14 Left 949414610 3:3800723-3800745 CCACGCGGGGACAGACCTCAGCC 0: 6
1: 0
2: 0
3: 8
4: 109
Right 949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG 0: 1
1: 0
2: 2
3: 38
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949414619 Original CRISPR CCAGAAGGAGTGGCAGCCTC AGG Intronic
900098393 1:949846-949868 CCAGAAGGTATGGAAGCCCCAGG - Intronic
900150858 1:1178883-1178905 CTGGAAGGAGGGGCAGCGTCAGG - Intronic
901195765 1:7439041-7439063 CCACAAAGAGGGGCAGCTTCTGG + Intronic
901238020 1:7677992-7678014 CCAGCAGGCGTGCCAGCCACAGG - Intronic
902333538 1:15742530-15742552 CCGGAAGGAGCCCCAGCCTCCGG - Exonic
902481491 1:16714363-16714385 CCCGGAGGAGGGACAGCCTCTGG + Intergenic
902796698 1:18805043-18805065 CCAGAAGGGGTGGCAGGCCCTGG - Intergenic
902802716 1:18840282-18840304 CCAGCAGCAGTGTCAGCATCAGG + Exonic
902818386 1:18928868-18928890 CCAGAAGTGGTGACAGCCTCAGG + Intronic
904779668 1:32936072-32936094 AGAGAAGGAGTGGCAGTCCCAGG - Intergenic
904907992 1:33912428-33912450 CCAGTGGAAGTGCCAGCCTCAGG - Intronic
905025682 1:34847780-34847802 CCAGAAGCAGTGGCTCCCACAGG + Intronic
906236398 1:44213799-44213821 CCAGAAGGGGATGCAGCCTCTGG + Exonic
906691240 1:47794198-47794220 CCAGAGGGAGAGGCTGGCTCTGG - Intronic
907497248 1:54853287-54853309 CCTGCAGCTGTGGCAGCCTCTGG - Intronic
907860987 1:58352830-58352852 ACAGAAGGAGAGGGAGTCTCTGG - Intronic
909403051 1:75256044-75256066 ACAGAAAGAGAGGCAGCCTTGGG + Intronic
912936956 1:114012094-114012116 CCAGGAGGAGGGACAGCCTTGGG - Intergenic
912946359 1:114087906-114087928 GCAAAATGAGTGGCAGCTTCAGG - Intergenic
913211255 1:116584608-116584630 CCAGAGGGAGTGGAAGCTTGGGG + Intronic
915097036 1:153470413-153470435 CCAGCAGCAGGGGCAGCCGCTGG + Intergenic
915348253 1:155208934-155208956 CCTGAAGGCGCGGCAGGCTCTGG - Exonic
916379148 1:164189127-164189149 CCAAAAGGGGTGGCATCCTAGGG - Intergenic
917930830 1:179821465-179821487 CCAGAATGTGTGGCAGGTTCTGG - Intergenic
919174504 1:194002111-194002133 ACAGAAGGGGTGGGAGGCTCAGG - Intergenic
920448838 1:206041639-206041661 CCTGAAGGAGTGACAGTCTAGGG + Intronic
922088812 1:222376269-222376291 CCAGAATGTTTGGCAGCCCCTGG + Intergenic
922814740 1:228440427-228440449 TCTGAAGTAGAGGCAGCCTCGGG + Intergenic
923329584 1:232910324-232910346 CCAGAGGGAGTGGGAGCGACTGG - Intergenic
924173866 1:241369507-241369529 CATGAGGGAGAGGCAGCCTCAGG - Intergenic
1062922302 10:1289524-1289546 CCAGCAGCCGTGGCAGACTCGGG - Intronic
1063934158 10:11059715-11059737 CCAGAGGGAAGCGCAGCCTCAGG + Intronic
1064254533 10:13732727-13732749 CAAGAGGGAGTGGCATCCCCTGG + Intronic
1066675569 10:37883651-37883673 CCAGGAGGAGTGGCAGCATCTGG + Intergenic
1066690001 10:38016927-38016949 CCAGGAGGAGTGGCAGCACCTGG + Exonic
1066699767 10:38114793-38114815 TCAAGAGGAGTGGCAGCATCTGG + Exonic
1067002710 10:42632361-42632383 CCAGGAGGAGTGGCAGCACCTGG - Exonic
1067121498 10:43475759-43475781 CCAGGAGGAGTGGCAGCATCTGG + Exonic
1067123580 10:43496054-43496076 CCAGGAGGAGTGGTAGCATCTGG + Intergenic
1067727126 10:48778810-48778832 AGAGAAGGAGTTTCAGCCTCTGG + Exonic
1068691577 10:59920915-59920937 CCATAAGGAGAAGCAGCCTGTGG + Intergenic
1068730831 10:60356421-60356443 CCAGAAGGTGTGGCATCTACTGG + Intronic
1069451666 10:68522843-68522865 CCAGAAGTGGTGGCACCCACCGG + Intronic
1070162875 10:73876299-73876321 CAAGACTGAGTGGCAGCCTCTGG - Intergenic
1070683326 10:78464519-78464541 CCAGAAGGAGGGGCAGTGTATGG + Intergenic
1073440812 10:103551671-103551693 CTAGAGGGAGAGGCAGCCCCGGG - Intronic
1076739746 10:132477395-132477417 CAGGAAGGAGGAGCAGCCTCTGG - Intergenic
1076807269 10:132865283-132865305 CCAGCAGGGATGGCAGCCCCAGG - Intronic
1076996138 11:298399-298421 ACAGAAGGAGGGCCAGGCTCCGG + Exonic
1077264165 11:1640823-1640845 CCCACAGGAGTGGGAGCCTCAGG + Intergenic
1077269248 11:1667367-1667389 CCAGATGGAGGGGCAGACACCGG - Intergenic
1077271297 11:1683338-1683360 CCAGATGGAGGGGCAGACACCGG + Intergenic
1077406869 11:2386653-2386675 CAAGAAGGAGTGCCAGGCACTGG - Intronic
1077556363 11:3227947-3227969 CCAGCCGGAGGGGCAGCCTGCGG + Exonic
1078480930 11:11674699-11674721 GCAGGAGGGGAGGCAGCCTCTGG - Intergenic
1078547983 11:12260049-12260071 CCCAGAGGAGTGGCAGCCCCAGG - Intronic
1078954081 11:16170202-16170224 ACAGAATGAGTAGCAGCCTCTGG - Intronic
1080426787 11:32162523-32162545 CCAGATGGAATGGCAGCCTAAGG - Intergenic
1082561946 11:54628517-54628539 GCAGTGGCAGTGGCAGCCTCAGG + Intergenic
1085412004 11:76296933-76296955 GCAGAGGGAGTGGCAGACACAGG + Intergenic
1087348903 11:97006271-97006293 CCACAAGGGGTGGCAGCAACAGG + Intergenic
1087470372 11:98566755-98566777 CCGGGAGGAGTGGCAGCTCCTGG - Intergenic
1088406098 11:109480577-109480599 CCAGTAGTAGTGGTAGCCACAGG + Intergenic
1088853482 11:113724947-113724969 CTAGAGGGCATGGCAGCCTCAGG - Intergenic
1089114224 11:116081195-116081217 CCAGAAGGAAGGGCAGCTGCTGG - Intergenic
1089652038 11:119920753-119920775 CCAGCAGCAGTGGCACCATCCGG + Intergenic
1089691001 11:120186647-120186669 GCAGAAGGGGTGTCAGCCACTGG + Intergenic
1090359661 11:126163553-126163575 GCAGAGGGAGGGGCAGCCTGAGG + Intergenic
1091580856 12:1788124-1788146 CCAACAGAAGTAGCAGCCTCTGG + Exonic
1091991765 12:4961248-4961270 CCAAAAGGAGCTGTAGCCTCGGG - Intergenic
1093497173 12:19771623-19771645 CCAGAATGAGAGGCAGTCACTGG + Intergenic
1096153603 12:49329923-49329945 CCAGAAGGAGTGGCCACCGGTGG - Exonic
1096594793 12:52688029-52688051 TCAGAAGGTGTGGCAGCTGCTGG - Intergenic
1101757643 12:107633650-107633672 CCACAAGCAGTAGCATCCTCTGG - Intronic
1102673139 12:114637139-114637161 CCAGAAGAAAAGGCAGACTCAGG + Intergenic
1102900521 12:116633059-116633081 ACAGAAGGAACTGCAGCCTCTGG - Intergenic
1103206887 12:119136801-119136823 CCAGAGGGAATGACAGCTTCAGG - Intronic
1104168978 12:126261389-126261411 CCAGAAGTAGAAGCAGCCTGAGG + Intergenic
1104390457 12:128387337-128387359 CCAGGAGGTGTGGATGCCTCTGG + Intronic
1104978058 12:132560907-132560929 CCAAATGGGGTGGCAGCCCCAGG - Intronic
1104995134 12:132649464-132649486 CAAGAAGAAGTGGCAGCTGCAGG - Exonic
1105050692 12:133047993-133048015 CCAAAAGGAGTGGCAGCTACTGG + Exonic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1106206233 13:27598047-27598069 TCAGCAGGAGTTGCAGCCTCAGG + Intronic
1106656528 13:31752701-31752723 GCAGAAGTAGGGGCAGGCTCTGG + Intronic
1106931524 13:34670798-34670820 ACAGAAGAAGTAGCAGTCTCTGG - Intergenic
1108701856 13:52950483-52950505 ACAGTAGGACTGGCAGCCCCTGG - Intergenic
1113543093 13:111123891-111123913 CCAGCAGGCCTGGCAGCCGCAGG - Intronic
1117549217 14:56817388-56817410 GCGGAAGGAGTGGCAGCCCTTGG + Intergenic
1119211595 14:72836161-72836183 TCAGAAGGGGTTGGAGCCTCTGG + Intronic
1119700917 14:76754058-76754080 CCACAAGATGTGGCAGACTCAGG - Intergenic
1120757076 14:88254420-88254442 CCAGAAGAAATGGCAGCCATGGG + Intronic
1121011171 14:90521104-90521126 CCAGGAGGTGGGGCTGCCTCAGG - Intergenic
1121447413 14:93987858-93987880 CCAGAAGCAGTGTCAGCTCCTGG + Intergenic
1121457169 14:94045842-94045864 ACGGAAGGGGTGGCGGCCTCAGG - Exonic
1121525609 14:94617029-94617051 CCAGAAAGATGGGCTGCCTCTGG - Intronic
1122228169 14:100291696-100291718 CCAGCAGGAGTGGCAGCAGCTGG + Exonic
1122672375 14:103382656-103382678 CCAGAAAGGGTTTCAGCCTCAGG - Intergenic
1123857378 15:24427073-24427095 CCAGCCTGCGTGGCAGCCTCCGG - Intergenic
1124682043 15:31740210-31740232 CCAGAAGCTGTTCCAGCCTCTGG - Intronic
1125984478 15:44036835-44036857 CCAAAAGAAGTGGCAGAGTCAGG - Intronic
1127028987 15:54840709-54840731 CACAAAGGAGTGGCAGTCTCTGG + Intergenic
1127244094 15:57152074-57152096 CTAGAGGGAGTGGAAGCCTCTGG + Intronic
1128332373 15:66763921-66763943 CAGGAAGGAGTGGCAGCCCTTGG - Intronic
1128767342 15:70259251-70259273 CCAGCAGGAGTGCCAGCTGCTGG + Intergenic
1129461577 15:75702555-75702577 CCAGTGGGAGGGGCTGCCTCTGG + Intronic
1130935257 15:88464748-88464770 CCAGGCAGAGTGGCAGCCTGGGG - Exonic
1131300398 15:91194743-91194765 CCACAAGGAGTAACAGCATCAGG - Intronic
1132758536 16:1497560-1497582 CGTGAAGGAATGGCAGCCTCTGG - Intronic
1133076794 16:3286061-3286083 CCAGGAGGAGTGGGGGCATCAGG + Exonic
1133145494 16:3782747-3782769 CCAGACGCAGCTGCAGCCTCAGG - Exonic
1133643969 16:7745523-7745545 CCAGAAACAGTAGCAGCCACAGG - Intergenic
1133961557 16:10497929-10497951 CCAGGAGGAGAGTCAGGCTCAGG - Intergenic
1134202500 16:12210575-12210597 CCAGAGGGAGAGGGAGCTTCAGG - Intronic
1135750517 16:25055145-25055167 CCAGAGGGAGAGGCAGGCTCAGG - Intergenic
1135759568 16:25126291-25126313 CCAGAGGGAGAAGCAGGCTCAGG - Intronic
1139952855 16:70680387-70680409 CCCGAAGGAGCGGGAGCCCCAGG + Intronic
1141473288 16:84253893-84253915 CCAGGAGGGGTGGGAGCCTGAGG + Intergenic
1141938765 16:87260315-87260337 CAAAAAGGAGGGGCAGCATCAGG - Intronic
1142150883 16:88512082-88512104 CCAGAAGGGGCGGCCGCCACGGG + Intronic
1142236998 16:88927121-88927143 CCAGACGGAGCAGCAGCCCCGGG + Intronic
1143369266 17:6428341-6428363 GCAGAAGGAGCCTCAGCCTCTGG - Exonic
1143799577 17:9367487-9367509 CCAGAATCAGAGGCAGACTCTGG - Intronic
1145014742 17:19388815-19388837 CCACAAGGAGTGGCAAGCACAGG + Intergenic
1145402399 17:22552381-22552403 CCAAAAGAAGTTGCAGCTTCAGG + Intergenic
1148632168 17:49119650-49119672 GCAGAAGCAGAGCCAGCCTCTGG + Intergenic
1148889763 17:50799239-50799261 CCAGGAGGACTGGCAACCACCGG - Intergenic
1149981981 17:61318070-61318092 CTAGCAGGAGAGGCGGCCTCTGG - Intronic
1150608515 17:66714418-66714440 CCAGCAGGAGGGGCTGCCTGAGG - Intronic
1151324978 17:73374071-73374093 CCAGAAGGAGGGAGAACCTCTGG - Intronic
1151836535 17:76585981-76586003 CCCGAGGGTGCGGCAGCCTCTGG - Exonic
1152100280 17:78297533-78297555 CCATCAGGAGTGGCAGGCTGAGG - Intergenic
1152529289 17:80907628-80907650 CCAGAAGGGGGGGCAGGCACGGG - Intronic
1152624149 17:81380569-81380591 CTGGAAGGAATGGCAGACTCTGG - Intergenic
1152677418 17:81648614-81648636 CCAGAAGGGGTGGCGGCCCCAGG - Exonic
1152798026 17:82317453-82317475 CCAGAAGCAGGGGCAGCAGCAGG + Exonic
1155354141 18:24935316-24935338 CCTGAAGGTCTGGCAGCTTCAGG - Intergenic
1155382927 18:25244456-25244478 ACAGGAGGAGTGGCAGACTGGGG - Intronic
1155900714 18:31386497-31386519 CCAAAAGAAGTGGCAGCCAGGGG + Intronic
1156890790 18:42187284-42187306 CCACAGAGAGTGGCAGCCCCAGG - Intergenic
1157222854 18:45839760-45839782 ACAGCAGGAGTGGCAATCTCAGG - Intronic
1160452825 18:78977617-78977639 CCAGCTGGACTCGCAGCCTCTGG - Intergenic
1160510609 18:79451522-79451544 CTAGAAGTAGTGGCATCCGCAGG + Intronic
1160536979 18:79599896-79599918 CCAGAATGAGGGGCTCCCTCAGG + Intergenic
1161217303 19:3100894-3100916 CCAGCAGGAAGGGCAGCCACAGG - Intronic
1161395255 19:4042114-4042136 GCTGAAGGAGCCGCAGCCTCAGG - Intergenic
1161943015 19:7417731-7417753 GCAGAAGGAGCAGCAGCCACGGG + Intronic
1162577463 19:11507214-11507236 CCAGGATGAGGGGCGGCCTCTGG - Intronic
1162951634 19:14074669-14074691 CCAGAAGGAAGGCCGGCCTCAGG - Intronic
1163225760 19:15960012-15960034 CCAGGAGGAGTTACAGGCTCTGG + Intergenic
1164199216 19:23002983-23003005 CCCGAGAGAGTGGCAGCCGCTGG - Intronic
1165074658 19:33273991-33274013 GGAGGAGGAGAGGCAGCCTCAGG - Intergenic
1165126252 19:33600107-33600129 CCAGATGGAGTTTCATCCTCTGG - Intergenic
1165296619 19:34931905-34931927 CCAGCAGGAGTGGGAGAGTCTGG + Exonic
1165420873 19:35721270-35721292 CCCGAAGGAGTAGGGGCCTCCGG - Exonic
1165564449 19:36712424-36712446 TCAGGAGGAGTGGCAGCACCTGG + Exonic
1166939782 19:46355693-46355715 ACAAGAGGAGTGGCCGCCTCCGG + Intronic
1167070607 19:47220111-47220133 CCAGCTGGAGAGGCAGCCTACGG + Intergenic
1167265700 19:48482090-48482112 CCAGAAGCAGCAGCAGCCTCAGG + Intronic
1168467350 19:56613850-56613872 CCAGGAGGAGTGGCAGCAGCTGG + Intronic
1202715531 1_KI270714v1_random:40274-40296 CCCGGAGGAGGGACAGCCTCTGG + Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
925278137 2:2665082-2665104 CCAGTGTGAGTGGCTGCCTCTGG + Intergenic
926562171 2:14429966-14429988 ACAGGAGGAGAGTCAGCCTCTGG + Intergenic
926921543 2:17945516-17945538 CCAGATGCAGTGCCAGGCTCTGG + Intronic
928099857 2:28430630-28430652 CTGGAAGCAGTGGCAGCCTGTGG - Intergenic
928290646 2:30034378-30034400 CAAGAAGGAGGGTCAGCCTTAGG + Intergenic
929942459 2:46345030-46345052 ACAAAAGGAGAAGCAGCCTCTGG + Intronic
931201748 2:60104368-60104390 CCAGAAGGAGTGGAAGGATTTGG - Intergenic
931243998 2:60477829-60477851 CCAGAAGAACAGGCAGCCCCAGG + Intronic
931858007 2:66323991-66324013 GCAGAAGGAGTGGCTGCCACAGG + Intergenic
931911083 2:66901162-66901184 CCAGTAAGTGTGGCAGCCTGGGG + Intergenic
932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG + Intronic
933217107 2:79643398-79643420 CCAGCAGCAGCAGCAGCCTCTGG + Intronic
934792060 2:97069902-97069924 CCAGAAGGAGGGGCAGCCGAAGG + Intergenic
934814559 2:97313808-97313830 CCAGAAGGAGGGGCAGCCGAAGG - Intergenic
934823135 2:97394675-97394697 CCAGAAGGAGGGGCAGCTGAAGG + Intergenic
937218343 2:120326967-120326989 ACAGAGGGTGTGGCAGCCTCAGG - Intergenic
937280619 2:120715027-120715049 CCAGAAGCTGTGGCAGACACTGG + Intergenic
938662927 2:133505810-133505832 GAAGTAGCAGTGGCAGCCTCAGG - Intronic
938693687 2:133815743-133815765 CCAGCAGCAGTGGCAGCAGCAGG - Intergenic
939057193 2:137380056-137380078 CCAGAAGCAATGGCAGCCCTGGG - Intronic
939153702 2:138501230-138501252 CCAGAAGGAGAGGCTGCCGAGGG - Intergenic
939955124 2:148521429-148521451 CCAGAAGGACTGGTGGCCTGAGG + Intergenic
940896966 2:159090109-159090131 CCAGTAGCAGTGGCTGCCTCTGG - Intronic
941020914 2:160407500-160407522 CCAGCAGCAGTGGCAACCCCGGG - Intronic
943720527 2:191199239-191199261 CTAGAAGGAGTGACTGCCTGAGG + Intergenic
945453318 2:210018439-210018461 CCAGAAGGGCTGGCATCCTCAGG - Intronic
945868472 2:215202470-215202492 CAAGCAGGAGTGGAAGCTTCAGG - Intergenic
945995529 2:216432808-216432830 CCGGAAGGAGTGGCCGCTCCTGG + Exonic
946173785 2:217910536-217910558 CCTGGGGCAGTGGCAGCCTCAGG - Intronic
947579091 2:231300915-231300937 CCAGCAGGGGTGGCATCCTCTGG + Intronic
948574088 2:238938622-238938644 CCAGCAGGTCTGTCAGCCTCTGG + Intergenic
1169445664 20:5669241-5669263 CAAGAAGCACTGCCAGCCTCTGG - Intergenic
1169499499 20:6145793-6145815 CCAGGGAGTGTGGCAGCCTCTGG + Intergenic
1170635306 20:18099224-18099246 GAAAAAGGTGTGGCAGCCTCAGG - Intergenic
1170855316 20:20047843-20047865 CTGGATGGAGTGGCAGCCTGAGG - Exonic
1171336365 20:24389210-24389232 CCAGAAGGAGTGGGAGTGGCTGG - Intergenic
1172113222 20:32559700-32559722 CCAGGAACAGTGGCAGCCACTGG - Intronic
1172995067 20:39064514-39064536 CCAGAAGGACTGGCAGACGCTGG - Intergenic
1173249739 20:41358164-41358186 CCAGAGGGGATGGCAGGCTCAGG - Intronic
1173499293 20:43540544-43540566 CCAGCAGGAGAGGCAGGCTTCGG + Intronic
1173565663 20:44036598-44036620 CCAGAAGGATTGCCAGTCTGTGG + Intronic
1173905876 20:46628353-46628375 GAAGAAGGAGTAGCAGCTTCGGG + Intronic
1174826843 20:53776232-53776254 CCAGAAGTGGTGGCAGGCTGAGG + Intergenic
1175250988 20:57610175-57610197 CCAGGAGGAGTCGCAGGGTCTGG - Exonic
1176089845 20:63313908-63313930 CCACGAGGTGGGGCAGCCTCAGG - Intronic
1176096536 20:63346972-63346994 CCAGCAGCAATGGCTGCCTCGGG - Intronic
1176190742 20:63808451-63808473 CCACAAGGAGTCTCAGCCCCGGG + Intronic
1178875960 21:36414073-36414095 CCAGTAGAAGTGGCAGACACAGG - Intronic
1179032146 21:37730044-37730066 CCTGAAGCAGTGGCTGCTTCAGG + Intronic
1179396983 21:41049509-41049531 AGAGAAAGAGAGGCAGCCTCAGG + Intergenic
1179887860 21:44322107-44322129 CCAGGAGGAGATGCAGCTTCAGG - Intronic
1180105828 21:45617469-45617491 GCAGAGGGAGTGGCTGCCCCAGG - Intergenic
1180243983 21:46534056-46534078 CCCAAAGGACTGGCACCCTCTGG + Exonic
1181150835 22:20882137-20882159 CCAGAAGGAGTGCAACCCTGAGG + Intronic
1181668625 22:24415070-24415092 CCAGAAGGAGAGTCAGCGCCTGG + Exonic
1181680656 22:24494282-24494304 CCTGAAGGGATGGCACCCTCTGG + Intronic
1182651620 22:31856084-31856106 CCAGACCCAGTGACAGCCTCAGG + Intronic
1183235570 22:36614407-36614429 CCAGAAGGAGCTGCCGGCTCAGG - Intronic
1183602844 22:38850113-38850135 CCAGAAGGAGTGGCCGGCCAAGG + Intergenic
1184008930 22:41732160-41732182 CCAGAAGAGGTGACAGGCTCTGG - Intronic
1184268819 22:43365860-43365882 CCAGCAGGAGGGGGAGCCCCTGG + Intergenic
1184373728 22:44098594-44098616 CCAGCAGGAGTGGGAGGCTGCGG + Intronic
1185082887 22:48719347-48719369 CCAGACGGACTTGGAGCCTCTGG - Intronic
949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG + Intronic
950633847 3:14301603-14301625 CCAGCAGCAGCGGCTGCCTCTGG - Intergenic
953636794 3:44671094-44671116 CCTGAAGGAGGAGCAGCCCCGGG + Intergenic
956523579 3:70132188-70132210 CAAAAAGGAGGGGCAGCATCAGG - Intergenic
960673714 3:120175371-120175393 CCAGAAGGACAGGCAGATTCTGG + Intronic
960988222 3:123294223-123294245 CCAGAAGGAATGGCGGACACTGG + Intronic
961330706 3:126136357-126136379 CAAGAAGGAGTGGCAAACACAGG + Intronic
964422495 3:156518916-156518938 CAAGAAGGAATGGCAGGTTCTGG - Intronic
964723104 3:159787449-159787471 CCAGATGCTGGGGCAGCCTCTGG - Intronic
966819788 3:183915353-183915375 ACTGAAGGAGGGGCAGACTCAGG + Intergenic
968095227 3:195925179-195925201 ACAGATGGAGTGACAGACTCTGG - Intergenic
969414685 4:7050651-7050673 CCTGCAGGGCTGGCAGCCTCGGG + Intronic
969694426 4:8726536-8726558 CCAGGAGAAGTGCCAGGCTCAGG + Intergenic
970487408 4:16538338-16538360 GCAGCAGGATTGGAAGCCTCTGG - Intronic
970833436 4:20370359-20370381 CCAGAGGCATTGGCCGCCTCAGG - Intronic
973645748 4:52949868-52949890 CCAGAAAGAAGTGCAGCCTCTGG + Intronic
974297464 4:60020545-60020567 CCACCAGAAGTGGCAGTCTCAGG - Intergenic
976554202 4:86432015-86432037 CCAAAAGGAGAGGCAGCATCAGG + Intronic
977458837 4:97299213-97299235 CCAGAAGGAATTGCATACTCTGG + Intronic
978935469 4:114369673-114369695 ACAGAGTGAGTGGCAGCCCCAGG - Intergenic
984522464 4:180818002-180818024 CCAAAAGGAGAAGCAGCATCAGG + Intergenic
985128012 4:186714373-186714395 ACAGGAGGAGAAGCAGCCTCAGG + Intronic
985859457 5:2459091-2459113 CCAGAAGGACTTGCAGCATTAGG - Intergenic
985893823 5:2737750-2737772 CTACAAGAACTGGCAGCCTCAGG - Intergenic
986113054 5:4739281-4739303 CCGGGAGGAGGGGCAGCCACAGG + Intergenic
986187897 5:5462277-5462299 GCAGAAGCAAAGGCAGCCTCAGG + Exonic
986810588 5:11354049-11354071 CCAGAAGGAGAGGCTGCATGGGG + Intronic
988411960 5:30897673-30897695 CAAGATGGAATGGCAGCCTATGG + Intergenic
988718928 5:33856462-33856484 CCAGAAAAAGTGGCAGCCAGTGG + Intronic
993144981 5:84082498-84082520 ACAGAAGGAGTGGCTGCCTTTGG + Intronic
993342214 5:86738678-86738700 CCAACAGCAGTGGCAGCTTCAGG + Intergenic
994191732 5:96876264-96876286 ACAGCAGAAGTGGCAGCCACTGG + Exonic
994355124 5:98786181-98786203 ACAGAAGGAGTGGCACAGTCAGG - Intronic
997412210 5:133699034-133699056 CCAGAAGGAGAGGCAGTCAATGG + Intergenic
997587396 5:135051609-135051631 CCAGAGGGAGTTACTGCCTCAGG + Intronic
998439513 5:142145326-142145348 TAAGATGGAGTGTCAGCCTCTGG - Intronic
999252886 5:150192959-150192981 CCAGCTGGAGAGGCAGCCTCAGG + Intronic
999356815 5:150942616-150942638 CCAGGAGGAGTGGCAGCAACTGG - Intergenic
999357697 5:150952400-150952422 ACAGGAGGAGTGGCAGCAACTGG - Intergenic
999454159 5:151701075-151701097 CCAGAAGTAATGTTAGCCTCTGG + Intergenic
999806686 5:155087784-155087806 TCAGAAGGAGAGGCAGACTTTGG - Intergenic
1000188284 5:158882408-158882430 CCAGAATACGTGGCAGGCTCTGG - Intronic
1000850350 5:166331955-166331977 TCAGAAGGTGTGGAACCCTCAGG - Intergenic
1001553448 5:172620651-172620673 CCAGGGGGAGTGGCAGGCTGTGG - Intergenic
1001874213 5:175185383-175185405 TCAGAAGGAGTGGCAAACTCAGG + Intergenic
1002921634 6:1577231-1577253 CCAGAAGGAGTGGCTGAGTGAGG - Intergenic
1003419291 6:5941200-5941222 CCAGAAGGTGTGGCAGCACTGGG - Intergenic
1003849328 6:10205590-10205612 CAAGAAGGGGTGGGAGCCTAAGG + Intronic
1004222001 6:13755116-13755138 CCAGAAGGCCTGACACCCTCAGG - Intergenic
1004709027 6:18152852-18152874 ACAAAAGGAGGGGCAGCATCAGG - Intronic
1005838218 6:29723652-29723674 CCTCAAGGAGTGGGAGCCTGGGG - Exonic
1006219241 6:32474124-32474146 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1006225107 6:32530829-32530851 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1006285976 6:33094646-33094668 CCAGCAGGAGAAGCAGGCTCAGG + Intergenic
1006291521 6:33141407-33141429 CCAGCAGGAGAAGCAGGCTCAGG + Intergenic
1006294635 6:33164726-33164748 GGAGAAGGGGTGGCAGGCTCCGG + Intronic
1006389975 6:33752441-33752463 CCAACAAGAGTGGCAGGCTCAGG - Intergenic
1007450906 6:41940114-41940136 CAGGAAGGAGTGGCATCCCCTGG + Intronic
1007729452 6:43937089-43937111 GAAGGAGGAGTGGGAGCCTCAGG - Intergenic
1008037247 6:46758759-46758781 CCAGCAGAAGGGGCTGCCTCTGG + Exonic
1010749875 6:79606117-79606139 CCAGATGGAGTGGCTGACTAAGG + Intergenic
1011753277 6:90474486-90474508 CCATAAGTATTTGCAGCCTCAGG + Intergenic
1017581823 6:155873204-155873226 CCGGAAGCAGTGGCAGCAACAGG - Intergenic
1018472125 6:164106498-164106520 CCAGGAGGAGTCGGTGCCTCCGG + Intergenic
1019374845 7:683887-683909 GCAGAAGAAGTGGGGGCCTCTGG - Intronic
1019940217 7:4283601-4283623 ACAGCAGCAGTGGCAGCCGCAGG - Intergenic
1020047943 7:5057333-5057355 CCAGGAGGAGTGGCAGCAGCTGG + Exonic
1020057432 7:5127683-5127705 CCGGAAAGAGTGGCAGCAGCTGG - Intergenic
1020170318 7:5839987-5840009 CCGGAAAGAGTGGCAGCAGCTGG + Intergenic
1020262262 7:6536967-6536989 CCAGAGGGAGGGGCAGGCTGCGG + Intronic
1020287677 7:6697751-6697773 CCAGGAGGAATGGCAGCAGCTGG - Exonic
1021027771 7:15689084-15689106 TAAGAAGAAGTGGCAGCCTCGGG - Intergenic
1021861811 7:24913415-24913437 CCAGCAGGAGTGGGATGCTCTGG - Intronic
1024042021 7:45563328-45563350 CCTGAAGTAGTGGCAGTCTATGG + Intergenic
1024345713 7:48310895-48310917 CCAGAAGGAGGAGAAGCTTCTGG - Intronic
1024345718 7:48310948-48310970 CCAGAAGGAGGGGAAGCTTCTGG - Intronic
1025198262 7:56948068-56948090 CCAGAAGCAGTGGCTCACTCCGG - Intergenic
1025673687 7:63628865-63628887 CCAGAAGCAGTGGCTCACTCCGG + Intergenic
1027115390 7:75475128-75475150 CCAGGAGGAGTGGCGGCAACTGG - Exonic
1027120574 7:75516160-75516182 CCAGGAGGAGTGGCGGCAACTGG - Intergenic
1027286516 7:76650822-76650844 CCAGGAGGAGTGGCGGCAACTGG - Intergenic
1027793481 7:82661469-82661491 CCAGACAGGGTGGCAGCCTGTGG + Intergenic
1028108160 7:86904886-86904908 GCAGAAGGAATGCCACCCTCAGG - Intronic
1029020928 7:97364249-97364271 CCAGGAGTAGTGGCAGCTGCAGG - Intergenic
1029274802 7:99397690-99397712 CCCGAGGGAGTGGCAGGCACAGG + Intronic
1029359076 7:100075201-100075223 CCGGAAGGAGTGGAAGCGTTTGG - Exonic
1029722214 7:102375861-102375883 CCAGGAGGAGTGGCAGCAACTGG + Exonic
1029853928 7:103494151-103494173 CCTGAAGGAGTGGTAGCATTTGG + Intronic
1030126286 7:106155529-106155551 CCTGAAGGTGAGCCAGCCTCTGG - Intergenic
1032790750 7:135240808-135240830 CCAGCAGAAGTGGCAGCTCCAGG - Intronic
1034555195 7:151845856-151845878 CCTGAGGGAGCGGCAGACTCTGG - Intronic
1035049208 7:155988797-155988819 ACAGATGGGGCGGCAGCCTCAGG + Intergenic
1035406875 7:158604422-158604444 CCAGAAGCAGGGACAGCCTGTGG - Intergenic
1035919655 8:3663110-3663132 CCTGAAGCAGTGGGGGCCTCAGG + Intronic
1039638013 8:39186953-39186975 CCAGACTGAGTGCCAGCATCTGG - Exonic
1042136051 8:65634018-65634040 CCTGATGGTGTGGCAGGCTCTGG - Exonic
1042207438 8:66343483-66343505 ACAAAAGGAGGGGCAGCGTCAGG - Intergenic
1042337199 8:67640812-67640834 GCAGCAGCAGTGGCAGCCCCTGG + Intronic
1042345877 8:67727455-67727477 CCACAGGGAGAGGCTGCCTCTGG + Intronic
1042655081 8:71087108-71087130 TCAGAAGTAGCGGCAGCCTGGGG - Intergenic
1043982554 8:86658396-86658418 CCAGCAGAAGTAGCAGCCACAGG - Intronic
1045805100 8:106149936-106149958 CAAGAAATAGGGGCAGCCTCTGG + Intergenic
1045860013 8:106805763-106805785 CCAGAATCAGTGGCAGCATCAGG - Intergenic
1049052315 8:140208406-140208428 CCAGAAGTAGCGGCAGCACCTGG + Intronic
1049093460 8:140534221-140534243 ACAGCAGCAGTGGCAGCCTTGGG + Intronic
1049322333 8:142003171-142003193 CCAGAGAGACTGGCAGCATCGGG + Intergenic
1049570934 8:143370002-143370024 CCAGGAGGTGCTGCAGCCTCTGG - Intronic
1050603377 9:7274825-7274847 CTAGAAAGAGTGACAGCCACAGG - Intergenic
1051294221 9:15577810-15577832 CCATAAGGATTTGCAGCCACAGG + Intronic
1051429649 9:16968821-16968843 CCAGTAGCATTGGCAGCATCTGG + Intergenic
1053585766 9:39456946-39456968 CCGGGAGGAGTGGCAGCACCTGG - Intergenic
1054580542 9:66908276-66908298 CCGGGAGGAGTGGCAGCACCTGG + Exonic
1057034798 9:91804212-91804234 GCAGCAGGAATGGCAGGCTCAGG + Intronic
1057632221 9:96729143-96729165 CCAGGAGGAGTGGCAGCACCTGG + Intergenic
1057635637 9:96763572-96763594 CCAGGAGGAGTGGCAGCAAATGG - Exonic
1057642950 9:96844956-96844978 CCAGGAGGAGTGGCAGCACATGG - Exonic
1057897694 9:98922958-98922980 CCAGCAGCAGGAGCAGCCTCCGG - Intergenic
1057930443 9:99188760-99188782 ACAGAAGCAGTGAGAGCCTCGGG - Intergenic
1058906888 9:109489220-109489242 CCACAAGGACTGGCAGAGTCTGG - Intronic
1059038401 9:110785602-110785624 TCAGAAGGAGCGGCATCCTCTGG - Exonic
1059267547 9:113049857-113049879 CCAGAAGGAATGGAAGCAACTGG - Exonic
1061256267 9:129455452-129455474 CCTGAAGGAGTGGGGGCCACAGG - Intergenic
1061283874 9:129611504-129611526 CCGGAAGGGTTGGCACCCTCTGG - Intronic
1061408342 9:130404911-130404933 CAAGAAGGCGTGGGAGCCTTCGG - Intronic
1061799112 9:133104481-133104503 CCAGAGGGGGAGGCAGGCTCAGG - Intronic
1062218372 9:135401340-135401362 GCAGAAAGAGTGGGACCCTCGGG + Intergenic
1062289862 9:135789646-135789668 CCAGGAGGTCTGGAAGCCTCTGG + Intronic
1189266716 X:39722339-39722361 CTAGAAGGAGTAGAAGCCTGAGG + Intergenic
1189976145 X:46462786-46462808 CCTGGAGGAGTGGCAGCAACTGG + Exonic
1189982925 X:46528849-46528871 CCTGGAGGAGTGGCAGCAACTGG - Exonic
1192009033 X:67248262-67248284 CCAGCAGGACTAACAGCCTCTGG - Intergenic
1193040176 X:76996749-76996771 ACAGAGGGAGTGGGAGACTCAGG + Intergenic
1195924913 X:110015677-110015699 CCAGTAGCAGTGGCAGCCCAAGG - Intronic
1197728780 X:129793557-129793579 CCAGAAGGAGAGACTGCCTATGG + Intronic
1200838187 Y:7753484-7753506 CCATAAGGTCTGACAGCCTCAGG + Intergenic