ID: 949415568

View in Genome Browser
Species Human (GRCh38)
Location 3:3810314-3810336
Sequence ATATCACAGTGGAGGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949415568_949415574 29 Left 949415568 3:3810314-3810336 CCTCTCTGCCTCCACTGTGATAT 0: 1
1: 0
2: 0
3: 27
4: 265
Right 949415574 3:3810366-3810388 AATGCTGAGCGTGTTGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949415568 Original CRISPR ATATCACAGTGGAGGCAGAG AGG (reversed) Intronic
900836029 1:5004799-5004821 ATTTCACAGTGGAGTCAGCAGGG - Intergenic
902046415 1:13528056-13528078 ATAGCACGGTGAAGGCACAGAGG - Intergenic
903456151 1:23488333-23488355 CAATCACAGTGGGGACAGAGAGG - Intergenic
903459365 1:23509795-23509817 ATGTCCCTGTGCAGGCAGAGGGG + Exonic
904309084 1:29614009-29614031 AAATCACAGTGGCTGAAGAGTGG + Intergenic
904472593 1:30745382-30745404 GTGCCTCAGTGGAGGCAGAGAGG + Intronic
904477353 1:30773883-30773905 ACATCACAGGGGAAGCTGAGAGG + Intergenic
904622034 1:31781535-31781557 ATTGAAGAGTGGAGGCAGAGTGG + Intergenic
906872280 1:49496123-49496145 ATATCACAAAGAAGGCAGTGTGG + Intronic
911220140 1:95236674-95236696 AGAGAACAGTGGAGACAGAGAGG - Intronic
911710905 1:101071656-101071678 ATGTCAGTGTGGATGCAGAGTGG - Intergenic
912206535 1:107515473-107515495 AGACCACAGTGGATTCAGAGAGG + Intergenic
913157817 1:116117325-116117347 ATAGAACATTGCAGGCAGAGTGG - Intronic
913262681 1:117013905-117013927 AGATCACATTGGAGGTGGAGTGG + Intronic
914228484 1:145742633-145742655 ATTTCACAATGGAGGAAGAAGGG - Exonic
914876033 1:151513180-151513202 ACACCACGGAGGAGGCAGAGGGG - Intronic
914885143 1:151578540-151578562 ATATCACATTGGAAGCACTGAGG - Intronic
915301961 1:154956812-154956834 TTCTCACAGTGGAGACACAGGGG + Intergenic
920281125 1:204844477-204844499 GTATTACAGTGGAGACAAAGAGG + Intronic
920686721 1:208114522-208114544 ATACAACAGTTTAGGCAGAGAGG - Intronic
920785004 1:209032981-209033003 AAACTACGGTGGAGGCAGAGGGG + Intergenic
921446104 1:215249143-215249165 TTTGCACAGTGGAGGCAGAAAGG - Intergenic
924056784 1:240131913-240131935 ATATCACTGTGGTGGCAGATTGG + Intronic
924294674 1:242573944-242573966 CTATCTCAGAGGAGGCAGAGAGG + Intergenic
1063215463 10:3921649-3921671 ATATCAAAGTGGAGGCTGCTGGG - Intergenic
1063791836 10:9458820-9458842 ATATCACAGTTGATTCAGAAGGG - Intergenic
1067104147 10:43354475-43354497 ATATCACAGTGGGCTTAGAGTGG - Intergenic
1067420964 10:46147211-46147233 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067490790 10:46699832-46699854 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067506303 10:46853677-46853699 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067603873 10:47640535-47640557 ATAACACAGCTGAGGAAGAGAGG + Intergenic
1068096245 10:52495016-52495038 ATAACACAGTAGAGGCAAGGAGG - Intergenic
1070403172 10:76071178-76071200 ATTTCACTCTGGGGGCAGAGGGG - Intronic
1070664224 10:78332197-78332219 ATACCAAGGAGGAGGCAGAGAGG - Intergenic
1071081456 10:81817483-81817505 ATCCCACATTGCAGGCAGAGAGG + Intergenic
1072683222 10:97521525-97521547 AGATCCCACTGGAGTCAGAGAGG - Intronic
1072930369 10:99657464-99657486 ATATAACACTTGAAGCAGAGTGG + Intergenic
1073481036 10:103786227-103786249 ACATCAAAGTGGCAGCAGAGAGG + Intronic
1075549736 10:123383400-123383422 TTGTGACAGTGGAGGCAGAGAGG + Intergenic
1075958584 10:126546594-126546616 AGATGTCAGTGGAGGCTGAGTGG + Intronic
1077862298 11:6193879-6193901 ATATTATACTGGAGACAGAGAGG + Intergenic
1080183690 11:29453828-29453850 ATATCTCAGTTCAGGCACAGAGG - Intergenic
1080876691 11:36281186-36281208 AAATGACAATGGATGCAGAGGGG + Intronic
1081031891 11:38094905-38094927 AAATAACACTGGAGGTAGAGGGG - Intergenic
1084312031 11:68322637-68322659 ACATCACACTAGAGGCAGAGGGG - Intronic
1085121530 11:73970421-73970443 CTATCAAAGTGGAAGCACAGAGG - Intergenic
1086055618 11:82642798-82642820 GTATCACAGTGAAGGGAGTGGGG - Intergenic
1086158130 11:83691304-83691326 AGAAGACAGTGGAGGCAGTGGGG - Intronic
1088369240 11:109071432-109071454 ATAACACAGTGCAGACTGAGAGG - Intergenic
1089008328 11:115112142-115112164 AAACCACAGTGGAGGGAGTGGGG - Intergenic
1090538535 11:127674582-127674604 ATAGCACAGTGGAAGAAGTGAGG - Intergenic
1090641659 11:128734559-128734581 ACACCACAGTGCAGGCAGCGCGG - Intronic
1090867407 11:130713783-130713805 ACATCAGAGTAGAGGCAGGGAGG - Intronic
1091902675 12:4157265-4157287 ATATTAAAGTGTAGCCAGAGAGG - Intergenic
1092225519 12:6745875-6745897 ATAACACAGAGGAGGGAGACAGG - Intergenic
1093929028 12:24936764-24936786 ATGCCACAGTGGAAGCAAAGGGG - Intronic
1095052860 12:37569554-37569576 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1098337180 12:69416102-69416124 CTACCTCAGTGGAGGAAGAGTGG + Intergenic
1098414665 12:70219542-70219564 ATATGAAAATGGAGGCAGAATGG - Intergenic
1098597000 12:72285304-72285326 ATATCACAGATGATGGAGAGAGG + Intronic
1099072189 12:78059094-78059116 ATGTGACAGTGGATGCAGACAGG + Exonic
1100428737 12:94511499-94511521 ACATCACAGTGGTGCCAGATGGG - Intergenic
1101618434 12:106360364-106360386 AGATCTCAGGGGAGGGAGAGGGG - Intronic
1102427882 12:112858750-112858772 CCATCCCAGTGGAGGCAGATGGG - Intronic
1104500539 12:129281703-129281725 CTTTCACAGTGGATGCAGAGAGG - Intronic
1105037971 12:132940280-132940302 ACATCACAGTCGGGACAGAGCGG - Intronic
1105302485 13:19148906-19148928 AAATCACAGTGGCAGCAGGGAGG + Intergenic
1105572069 13:21612019-21612041 TTTTCACAGTTGAGGCAGGGAGG - Intergenic
1108148956 13:47511437-47511459 AGGTCACAGACGAGGCAGAGAGG + Intergenic
1109194624 13:59364654-59364676 ATATGGCAGATGAGGCAGAGTGG + Intergenic
1110143968 13:72167194-72167216 ATCTTAAAGTGGAGGAAGAGGGG - Intergenic
1110330692 13:74268960-74268982 AGTTCACAGTGGAGGCAGAAAGG + Intergenic
1110909140 13:80933495-80933517 CAATCATAGTGGAGGGAGAGCGG + Intergenic
1114227902 14:20755536-20755558 GCATCACAGAAGAGGCAGAGGGG - Intergenic
1114718745 14:24857258-24857280 ATAACAGAGAGAAGGCAGAGGGG + Intronic
1116613914 14:47109445-47109467 ATCTCACAGTGAAAGCATAGGGG - Intronic
1117630771 14:57689086-57689108 ATATTTCAGTGGAGAAAGAGAGG - Intronic
1120043690 14:79782225-79782247 ATACCACAGAGGAGAGAGAGGGG - Intronic
1120088643 14:80305673-80305695 ATAACACACTGGATGCAAAGAGG + Intronic
1121180738 14:91926542-91926564 AGGTCAGAGTGGAGACAGAGGGG + Intronic
1122167459 14:99839286-99839308 ATATAACAGTTGGGGCAGGGTGG + Intronic
1122866936 14:104610497-104610519 ATCTCATGGTGGAGGCAGAAGGG - Intergenic
1123903933 15:24903782-24903804 CCATCACTTTGGAGGCAGAGAGG + Intronic
1124452807 15:29811950-29811972 ATATCAGAGAGGAGGCATATAGG - Intronic
1124673890 15:31666964-31666986 AGACCACAGTGGAGGCAAACTGG - Intronic
1125048723 15:35272957-35272979 ATATCACATGGGAGCAAGAGAGG - Intronic
1126528586 15:49686786-49686808 AGATCACAGTCTAGGCAGTGAGG - Intergenic
1129016312 15:72472399-72472421 ATATCACAATGGAGACGGGGTGG + Intergenic
1129415214 15:75373009-75373031 GTAACACAGTGGAGGGAGAGTGG - Intronic
1130310841 15:82752701-82752723 ATATCACAGGCCAGGCACAGTGG - Intergenic
1131833943 15:96371756-96371778 ATATCACAGGCCAGGCACAGTGG + Intergenic
1132165424 15:99582966-99582988 ATATCATAGTGTAAGCAAAGGGG + Intronic
1137706373 16:50538645-50538667 AAATCATGCTGGAGGCAGAGAGG + Intergenic
1138344525 16:56311832-56311854 AAAACACAGGTGAGGCAGAGTGG - Intronic
1140040308 16:71403146-71403168 ATGACAAAGTGGAGACAGAGGGG - Intergenic
1140579670 16:76214998-76215020 ATGTGACCCTGGAGGCAGAGTGG + Intergenic
1141195686 16:81859266-81859288 AGATCACAATGGACGCAGTGAGG - Intronic
1142995455 17:3757389-3757411 AGGGCACAGGGGAGGCAGAGAGG - Intronic
1143506581 17:7369186-7369208 ATATTACAGGGCAGGCAGGGTGG - Intergenic
1143805735 17:9424564-9424586 GTGTCACAGTGGAAGAAGAGGGG - Intronic
1144094003 17:11883467-11883489 ATAGTAAAGTGGAGGCAGAATGG - Intronic
1144397179 17:14855938-14855960 TTATCAAAATGTAGGCAGAGAGG + Intergenic
1144669411 17:17124559-17124581 GAACCACTGTGGAGGCAGAGGGG - Intronic
1144779253 17:17799651-17799673 AGGTCACAGGGGAGCCAGAGGGG + Intronic
1145373381 17:22325487-22325509 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1146156717 17:30530466-30530488 AGAGCACAGTGTAGGCAGGGAGG - Intergenic
1146459967 17:33038585-33038607 ATAGCACAGTGGAGAAAGAGTGG - Intronic
1147648656 17:42049630-42049652 ATCTCAGAATGGGGGCAGAGGGG + Intronic
1147911614 17:43859420-43859442 CGTCCACAGTGGAGGCAGAGGGG + Intronic
1148130883 17:45262066-45262088 AGAGCACACTGGAGGCGGAGAGG - Exonic
1150891048 17:69150308-69150330 ATAACAAAGTGCAGGCTGAGTGG - Intronic
1151097509 17:71515440-71515462 AAATCACAGTGGAGGGAGAAAGG + Intergenic
1152282514 17:79393534-79393556 ATAGCACACTGGATGCTGAGCGG + Intronic
1152496149 17:80673413-80673435 TTATCACTGTGGAGGTGGAGGGG + Intronic
1153329386 18:3857776-3857798 TTATCACATAGGAGGCTGAGAGG - Intronic
1155413027 18:25566832-25566854 AGTGCACAGTGGAGGTAGAGAGG - Intergenic
1155774738 18:29746393-29746415 ATATGAGAGAGGAGGCAGCGAGG - Intergenic
1157682079 18:49615151-49615173 ATATCAGAGTGGCTGCAGTGTGG + Intergenic
1157853863 18:51085372-51085394 ATTTCACAGAGAAGGCAGATGGG - Intergenic
1159372046 18:67540596-67540618 TTATCACAATATAGGCAGAGAGG - Intergenic
1159932755 18:74331566-74331588 TTATCACAGTGGAGGAAGGATGG + Intronic
1161484359 19:4526947-4526969 ATATCATAGTCCAGGCACAGCGG + Intronic
1161631539 19:5359133-5359155 AATTCACAGAGAAGGCAGAGTGG - Intergenic
1162226002 19:9223401-9223423 ATGTCACATAGGAGGCAGATAGG - Intergenic
1165883492 19:39060326-39060348 AAATCAGACTGGAAGCAGAGAGG + Intergenic
1166369822 19:42294488-42294510 ATTTCACAGGGGAGTCAGAGAGG - Intronic
1168130951 19:54318186-54318208 ATATTACGGGGGAGGCAGAGGGG - Intergenic
1168261412 19:55197160-55197182 ATTTCACCGTGTGGGCAGAGAGG - Exonic
925522244 2:4760248-4760270 CTATGACAGTGGAGGTAGAAAGG - Intergenic
925607237 2:5672069-5672091 ACTTCACAGTAGAGGCACAGTGG + Intergenic
926542598 2:14199936-14199958 ATTACACTGTGGAGGCAGAGGGG + Intergenic
926626831 2:15097336-15097358 AGGCCACAGTGGAGGCTGAGAGG + Intergenic
926758903 2:16260023-16260045 ATATAACTGTGGAAGCTGAGAGG + Intergenic
927095346 2:19744090-19744112 ATGGGGCAGTGGAGGCAGAGGGG + Intergenic
927236995 2:20883530-20883552 AAATCAGAGTGGAAGCAGGGAGG - Intergenic
927420245 2:22923629-22923651 GTATCCCTGTGGAGGCTGAGAGG + Intergenic
928183778 2:29090889-29090911 ATTCCAGAGTGGAGGGAGAGGGG + Intergenic
930709692 2:54538954-54538976 AGCTCAGAGTGGAGGCAGTGGGG - Intronic
932318394 2:70801794-70801816 TTCCCACAGTGGAGGCAGGGCGG + Intergenic
932716479 2:74103574-74103596 ATATTAAAGTGGATGAAGAGGGG - Exonic
935079702 2:99780568-99780590 ATATCAGAGTGGAGGTAGCTGGG - Intronic
936985116 2:118301920-118301942 AAATCTCATAGGAGGCAGAGAGG - Intergenic
937238102 2:120442652-120442674 CTGTCCCAGTGGGGGCAGAGTGG - Intergenic
939185300 2:138853603-138853625 GCATCAGAGAGGAGGCAGAGAGG - Intergenic
940311186 2:152280241-152280263 ATATAACAGTGGAAGGGGAGAGG - Intergenic
940586315 2:155656342-155656364 ATATTCCATTGGAGGGAGAGAGG + Intergenic
940969508 2:159880454-159880476 ATATCACACTGATGGCAGAAAGG + Intronic
943481534 2:188426142-188426164 ATATCACAGTGATGGCAGGGAGG + Intronic
943788647 2:191907465-191907487 AGATCTCAGAGAAGGCAGAGGGG - Intergenic
944360057 2:198843596-198843618 ATATAAAAGTAGAGGCAAAGAGG - Intergenic
945168054 2:206967076-206967098 AGATCACAGTCCAGGCAGGGAGG + Intronic
946415709 2:219538708-219538730 AAATCAGACTGGAGGGAGAGAGG - Exonic
947093551 2:226541095-226541117 AAGTCACAGTGGTGGAAGAGAGG - Intergenic
947905899 2:233761994-233762016 AAATCACATTGGAGGTATAGTGG - Intronic
948129913 2:235592643-235592665 ATATCAGAGTCAAGGCAGGGAGG + Intronic
1169149961 20:3281808-3281830 ATTGCAAAGTGGAGGAAGAGGGG + Intronic
1171529413 20:25842835-25842857 ATAGCACTTTGGAGGCAGAGGGG + Intronic
1171547413 20:26013045-26013067 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1172345368 20:34194105-34194127 ATATACCAGTGGCAGCAGAGAGG + Intergenic
1173836717 20:46130652-46130674 TTATCCCAGTGGAGGCTGTGAGG + Intergenic
1174705831 20:52655157-52655179 ATGTGACAGTGGAGGCAAAGAGG - Intergenic
1176290664 21:5042916-5042938 TCTTCACGGTGGAGGCAGAGAGG - Intergenic
1176876202 21:14131330-14131352 AGACCCCAGTGGTGGCAGAGTGG - Intronic
1177665682 21:24155613-24155635 AAATCCTGGTGGAGGCAGAGAGG - Intergenic
1177778009 21:25591011-25591033 GTAACTCAGTGGAGGAAGAGTGG + Intronic
1179866591 21:44220725-44220747 TCTTCACGGTGGAGGCAGAGAGG + Intergenic
1181809511 22:25394902-25394924 ACATCACACTGGAGGCAGAAGGG + Intronic
1184058442 22:42067509-42067531 AGATGGCATTGGAGGCAGAGAGG - Intronic
1184982841 22:48106484-48106506 ATGTCAGAGCCGAGGCAGAGTGG - Intergenic
949415568 3:3810314-3810336 ATATCACAGTGGAGGCAGAGAGG - Intronic
950373115 3:12547934-12547956 TTGTTACAGTGAAGGCAGAGAGG + Intronic
952177298 3:30879036-30879058 ACCTCAGAGTGGAGGAAGAGTGG + Intronic
952685156 3:36139151-36139173 AGAGCACAGTGGAGACAGAATGG + Intergenic
954053338 3:48001080-48001102 ATATTAGAGTGGTGGCACAGAGG + Intronic
955379386 3:58424735-58424757 ATATCCCTGTGGAGGAAAAGGGG - Exonic
956492388 3:69786961-69786983 ATAACACCATGAAGGCAGAGTGG - Intronic
956868092 3:73388820-73388842 GTGACACAGTGGAGGCAGGGAGG + Intronic
961214663 3:125149734-125149756 ATGGCAAAGTGGGGGCAGAGGGG + Intronic
961622656 3:128236876-128236898 ATTTCACAGTAGGGTCAGAGAGG - Intronic
962240573 3:133747686-133747708 ATAGTTCAGTGGAGACAGAGGGG + Intronic
962853721 3:139326470-139326492 AGACCAGAGAGGAGGCAGAGAGG + Intronic
963296304 3:143550313-143550335 AAATGCAAGTGGAGGCAGAGAGG - Intronic
963356823 3:144218398-144218420 ATTTCACAGTGGAGAAAGATGGG + Intergenic
964317748 3:155462199-155462221 CTACCACAATGGGGGCAGAGAGG + Intronic
964734926 3:159907234-159907256 AGGGCACAGTGGAAGCAGAGAGG - Intergenic
965054633 3:163697442-163697464 AAATGCCAGAGGAGGCAGAGTGG - Intergenic
965682126 3:171262303-171262325 ATATCACAGAGGAGGTGGAGTGG - Intronic
968182894 3:196610270-196610292 GTACCACAGTAGAGGCAGCGTGG + Intergenic
969172486 4:5375336-5375358 AGAGCACCGTGGAAGCAGAGGGG - Intronic
971197684 4:24485208-24485230 ATGAGACAGTGCAGGCAGAGTGG + Intergenic
972581225 4:40397319-40397341 ATAGTACAGGGAAGGCAGAGTGG - Intergenic
973247038 4:48020044-48020066 ATATTCCAGTGGGGGCAGATAGG - Intronic
975881091 4:78908953-78908975 ACATGACAGTGGTGGCAGGGTGG - Intronic
976228926 4:82820299-82820321 ATATAACAGTGGAAGTAGTGTGG - Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
978617755 4:110613029-110613051 AACTCTCAGCGGAGGCAGAGAGG + Intergenic
980840513 4:138255159-138255181 ACAAAACAGTGGAGACAGAGTGG + Intergenic
981588238 4:146327863-146327885 ATGTGCCAGTGCAGGCAGAGTGG - Intronic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
983092899 4:163526259-163526281 ATTTCACAGTGGAGGATGATCGG - Exonic
984487461 4:180388981-180389003 AAATGACAGTGAAGACAGAGAGG + Intergenic
984963286 4:185119008-185119030 TTATCAGTGTGAAGGCAGAGGGG + Intergenic
985866245 5:2516631-2516653 ATTTCACAGGGGAGGCAAACCGG - Intergenic
988722516 5:33892383-33892405 AGAACAGAGTTGAGGCAGAGGGG + Intergenic
988994607 5:36702816-36702838 ATGTGACCATGGAGGCAGAGAGG - Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990626919 5:57623976-57623998 CGTTCACAGTGGAGGCAGTGGGG + Intergenic
991358690 5:65797199-65797221 ACATCACAATGGAGGCTAAGAGG - Intronic
992600523 5:78394350-78394372 ATATTACAATGAAGGCAGGGAGG + Intronic
992764777 5:79987684-79987706 ATGTTAGACTGGAGGCAGAGTGG + Intronic
992905722 5:81343828-81343850 ATATCCCAGTGTATGCAAAGTGG + Exonic
995221581 5:109654558-109654580 AAATCACAGCAGAGACAGAGAGG + Intergenic
995652674 5:114387859-114387881 ATATCTGAGTGGGAGCAGAGGGG - Intronic
995705819 5:114988770-114988792 CTTTCACAGTGGGGGTAGAGTGG - Intergenic
996142100 5:119923992-119924014 TTATCAGAGTGGTGGCAGTGGGG + Intergenic
996384716 5:122899097-122899119 ATCTCACAGTGGAGGCTGTCAGG - Intronic
997054390 5:130423637-130423659 ATATCACTGTGAAGAAAGAGTGG - Intergenic
997213073 5:132089080-132089102 ACTACACAGTGGAGGCAGGGAGG - Intergenic
997753723 5:136374832-136374854 ATTGCACAATAGAGGCAGAGAGG + Intronic
999098773 5:149005061-149005083 GGACCACAGTGGAGGGAGAGAGG - Intronic
1000299099 5:159939136-159939158 AGATCACAGTGGAAGAAGACTGG - Intronic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1001324313 5:170710152-170710174 AAATCACAGTCCAGGCACAGTGG - Intronic
1004137501 6:12981963-12981985 AAATCAAACTGGTGGCAGAGAGG - Intronic
1005427250 6:25715788-25715810 ATATATGAGTGGAAGCAGAGAGG + Intergenic
1005822537 6:29609384-29609406 ATGGCACAGGGGAGGAAGAGGGG + Intronic
1006672095 6:35735864-35735886 ATATCCCTGGGGAGGCTGAGAGG + Intergenic
1007626463 6:43249183-43249205 ATTTCACAGAGGAGGAAGAGTGG + Intronic
1007715194 6:43851670-43851692 GTTTGACAGTGGAGACAGAGAGG - Intergenic
1007754548 6:44090437-44090459 CCAGGACAGTGGAGGCAGAGTGG + Intergenic
1011227662 6:85125973-85125995 ATATTATAGTAGAGTCAGAGAGG - Intergenic
1012973801 6:105758304-105758326 ATAGCAAAATAGAGGCAGAGCGG + Intergenic
1014637282 6:123863142-123863164 AGAGCCCTGTGGAGGCAGAGGGG + Intronic
1017246740 6:152235213-152235235 ATATCACAGTAAAGCCTGAGAGG - Intronic
1017429296 6:154354761-154354783 AGATCAGAGTGGAGGAGGAGAGG - Intronic
1018880689 6:167876967-167876989 AGATGACTGTGGAAGCAGAGTGG + Intronic
1019221863 6:170479444-170479466 AGAGCAGTGTGGAGGCAGAGTGG - Intergenic
1020806836 7:12800588-12800610 ATTTCACAGTTCAGGCAGGGAGG + Intergenic
1021692385 7:23243147-23243169 ACATCACAGTGTTGGCAGGGCGG - Intronic
1025208492 7:57007617-57007639 ATATCAAAGAGGTGGAAGAGGGG + Intergenic
1025613771 7:63100610-63100632 AGTGCACAGTGGAGTCAGAGGGG + Intergenic
1025663456 7:63569261-63569283 ATATCAAAGAGGTGGAAGAGGGG - Intergenic
1026228809 7:68465752-68465774 AAACCACAGGGGAAGCAGAGTGG + Intergenic
1026960387 7:74404121-74404143 GTTTGTCAGTGGAGGCAGAGGGG + Exonic
1028000542 7:85492418-85492440 AGTTCATAGTGGAGGTAGAGAGG - Intergenic
1028529418 7:91822275-91822297 AGATCACAGTGGAAGAAGATTGG - Intronic
1028634702 7:92974785-92974807 ATATCACAGAAGAGACAGAGAGG + Intergenic
1029302503 7:99593543-99593565 ATATCACAGTGTTGACAGAGGGG - Intronic
1030521908 7:110607728-110607750 AGATCACACTGGAGACAGAATGG - Intergenic
1032804148 7:135339078-135339100 ATGGCACTGTGGGGGCAGAGAGG - Intergenic
1032959584 7:137015887-137015909 ATACCACCGTGGAGGTAGTGGGG + Exonic
1033258604 7:139822876-139822898 ATATCACTCAGGAGGCAGATTGG - Intronic
1034504571 7:151477503-151477525 AAATCAAAGTAGACGCAGAGTGG + Intronic
1035619337 8:1025733-1025755 AAATGACAGGGGAGGCAGGGAGG + Intergenic
1036959451 8:13227983-13228005 ATAAAAAAATGGAGGCAGAGTGG - Intronic
1037774079 8:21821264-21821286 ATTACACAGTGGAGGGAAAGAGG + Intergenic
1040279703 8:46033220-46033242 AAATCACAGTGGAGGCTGTGAGG + Intergenic
1040677007 8:49762554-49762576 ATACATCAGTGGAGGCAGAGTGG + Intergenic
1043932984 8:86111753-86111775 ATGTAAGAGTGGAGGAAGAGGGG - Intronic
1044491255 8:92818593-92818615 ATATCATAGGGGATACAGAGAGG - Intergenic
1045685020 8:104702867-104702889 ATATTACAGTGGAGGCAATCAGG + Intronic
1045961127 8:107969876-107969898 ATATTACAGTAGAAGTAGAGCGG + Intronic
1046199375 8:110903036-110903058 ATATGACAGTGGAGGGAGTCAGG + Intergenic
1047037622 8:120956720-120956742 ACATCAGAGTGGTGGGAGAGAGG + Intergenic
1047546746 8:125825396-125825418 ATAGCACAGTGGACTCAGGGTGG + Intergenic
1047610640 8:126517524-126517546 AGAAGACAGTGGAGGTAGAGAGG + Intergenic
1047833219 8:128658810-128658832 ATTGCACAGGGCAGGCAGAGCGG - Intergenic
1048567043 8:135612025-135612047 ATATCGAAGGGGATGCAGAGAGG - Intronic
1051210572 9:14738159-14738181 ATTTGCCAGTGGAGGTAGAGAGG - Intronic
1051890354 9:21935760-21935782 ATCCCACATTGGAGGAAGAGAGG + Intronic
1051963816 9:22801360-22801382 CTATCGCAGGGCAGGCAGAGGGG - Intergenic
1052394601 9:27923699-27923721 ACAACATAGAGGAGGCAGAGTGG - Intergenic
1052820660 9:33135694-33135716 ATTTTACAGTGGAGTCAGAGCGG - Intronic
1053003038 9:34588202-34588224 TTGTGACAGTGGAGACAGAGAGG + Intronic
1056028268 9:82524141-82524163 ACATGAAAGAGGAGGCAGAGGGG - Intergenic
1058117219 9:101098113-101098135 ATATCACTCTGGAGGCCGAGTGG + Intronic
1058577689 9:106421327-106421349 ATGCCACAGAGGAGGGAGAGTGG - Intergenic
1058765815 9:108181686-108181708 CTCCCAGAGTGGAGGCAGAGAGG - Intergenic
1059626122 9:116068409-116068431 ACAGCAGAGTGGAGACAGAGAGG - Intergenic
1060113350 9:120922114-120922136 ACTTCCCAGTGGAGGTAGAGAGG + Intronic
1060243062 9:121921362-121921384 TTAACCCAGTGGAGGCAGGGGGG + Intronic
1061917985 9:133766600-133766622 ACATCACACTGGAGGGGGAGGGG + Intronic
1187505104 X:19873064-19873086 AAATCACACTGTAGGCAGTGTGG - Intronic
1187511565 X:19924355-19924377 ATAAGACAGAGAAGGCAGAGAGG + Intronic
1189590189 X:42502726-42502748 ATATAATAGTAGAGGTAGAGTGG + Intergenic
1190248557 X:48706269-48706291 TTACCTCAGAGGAGGCAGAGCGG + Exonic
1190626792 X:52344667-52344689 ACATGACTGTGGAGGCTGAGAGG - Intergenic
1190740349 X:53284485-53284507 AGATGACAGTGGGGGCACAGCGG - Intronic
1191923889 X:66287666-66287688 TCATTGCAGTGGAGGCAGAGTGG + Intergenic
1192582977 X:72300018-72300040 ATGTCACAGGGCTGGCAGAGGGG - Intronic
1194822786 X:98527828-98527850 GTCTCACAGTGGAGGCAAGGAGG + Intergenic
1195966749 X:110436008-110436030 ATAGCACAGTGGAGCCACACCGG - Intronic
1196735993 X:118981574-118981596 ATATCACAGGGCAGCTAGAGGGG - Intronic