ID: 949416507

View in Genome Browser
Species Human (GRCh38)
Location 3:3820655-3820677
Sequence GAACAAAGCCTGTCTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949416507_949416509 17 Left 949416507 3:3820655-3820677 CCTGTTTCAGACAGGCTTTGTTC 0: 1
1: 0
2: 2
3: 12
4: 208
Right 949416509 3:3820695-3820717 GAAATGCAATAAATGAAGAAAGG 0: 1
1: 0
2: 3
3: 55
4: 812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949416507 Original CRISPR GAACAAAGCCTGTCTGAAAC AGG (reversed) Intronic
902280668 1:15371906-15371928 ATACAGAGCCTGTCAGAAACAGG - Intronic
904480358 1:30789445-30789467 CAAAAAAGCCAGTCTGAATCAGG - Intergenic
905450752 1:38054541-38054563 GAACAATACCTGTCTGAGCCTGG + Intergenic
906925229 1:50108923-50108945 GAACAGAGCCTTGCTGAAATTGG - Intronic
908318718 1:62960419-62960441 GAACAACTCCTTTCAGAAACAGG + Intergenic
910918400 1:92316337-92316359 GAATAAAAGCTTTCTGAAACAGG + Intronic
912871233 1:113308863-113308885 GAACAACCCCTTTCTGACACTGG - Intergenic
913169428 1:116218947-116218969 GAACAAAGGCTGTCTGCTAGAGG + Intergenic
913648804 1:120889679-120889701 GAAAGAAGCCAGTCTGAAAAGGG + Intergenic
914077891 1:144373704-144373726 GAAAGAAGCCAGTCTGAAAAGGG - Intergenic
914101288 1:144592801-144592823 GAAAGAAGCCAGTCTGAAAAGGG + Intergenic
914172800 1:145242244-145242266 GAAAGAAGCCAGTCTGAAAAGGG - Intergenic
914297689 1:146344835-146344857 GAAAGAAGCCAGTCTGAAAAGGG - Intergenic
914450401 1:147786568-147786590 GATCAAAGACTGGCTAAAACAGG - Intergenic
914527455 1:148483372-148483394 GAAAGAAGCCAGTCTGAAAAGGG - Exonic
914638938 1:149583756-149583778 GAAAGAAGCCAGTCTGAAAAGGG + Intergenic
914801327 1:150964637-150964659 GAACAAAGTCTGTTAGAAGCAGG - Exonic
915044392 1:152999958-152999980 AAACAAAGCTTCTCTGAAAGAGG + Intergenic
915893074 1:159789330-159789352 GAACAAAGCCTGTGGGAGAGAGG - Intergenic
918350805 1:183653786-183653808 GAACAAATCTTGTCTTAAACTGG - Intronic
918905644 1:190489270-190489292 GAAAGAAGCCTGTTTGAAAGTGG + Intergenic
919690026 1:200520993-200521015 GAACAGTGCCTGTCTGAGAGAGG + Intergenic
920000366 1:202794006-202794028 GATGAAAGCCTCTCTGAGACAGG + Intronic
923421598 1:233821565-233821587 GAACAAAGCCTGGAGGTAACAGG - Intergenic
1065271475 10:24037699-24037721 GAACAAACCCTGTCTCACTCTGG - Intronic
1068159092 10:53240755-53240777 GAAGAAAGCTTGTTTGAACCTGG - Intergenic
1068503917 10:57875261-57875283 GAAGAAGGCCTGATTGAAACAGG + Intergenic
1068532710 10:58207921-58207943 GAACAAAGCCTCCCAGAAATTGG - Intronic
1070583594 10:77743661-77743683 GAACTAAGACAGTCTTAAACTGG + Intergenic
1071993622 10:91125706-91125728 GAACAAATCCTGGCTGTCACTGG - Intergenic
1072078615 10:92004828-92004850 GAAAAAAGCCTTTTTGACACTGG - Intronic
1076851157 10:133093773-133093795 GAACAGAGCCTGGCTGACAGGGG - Intronic
1079800691 11:24864567-24864589 GGACACAGCCTGTCTGAGAATGG - Intronic
1079819990 11:25114523-25114545 GAACATTGCCAGTCTGTAACTGG + Intergenic
1079935093 11:26607487-26607509 AAACAAAGCCTCTGAGAAACAGG - Intronic
1081588839 11:44407040-44407062 GAACATAGCTTCTCTGAAAAAGG + Intergenic
1081652765 11:44835371-44835393 GATCTAAGCCTGTCTGAGAAGGG - Intronic
1084843036 11:71873548-71873570 GAACAAAGACTGAATGAAATAGG + Intronic
1088256913 11:107911669-107911691 GAAGAAAGCCTGCCTGAGAATGG - Intronic
1089848774 11:121479554-121479576 GAACAAATCCTGTCTGGAGGAGG + Intronic
1090328341 11:125908417-125908439 GCACAGAGCCAGTCTGGAACAGG + Exonic
1092855901 12:12673527-12673549 GAAAGCACCCTGTCTGAAACAGG + Intronic
1093536343 12:20228100-20228122 GAAGGAAGCCAGTCTGAAAAAGG + Intergenic
1098070655 12:66670823-66670845 GGGCAGAGCCTGTCTGAAAATGG - Intronic
1098707662 12:73711645-73711667 GAAAAAAGCCAGTCTTAAAAGGG - Intergenic
1099525348 12:83711552-83711574 GAACAAAGATTATCTGAAACTGG - Intergenic
1100722083 12:97369905-97369927 GGAGAAAGCCTGTCTGAGAATGG + Intergenic
1102518502 12:113465395-113465417 GAACAAACGCCGTCTGAAAAGGG + Intronic
1103213481 12:119183515-119183537 GAAAAAAGCATGTCTGCAAGGGG + Intronic
1104407227 12:128528024-128528046 GAAGAGAGCCTGGCTGATACTGG + Intronic
1105693501 13:22865111-22865133 GAGCAAGGCCTGTCTCAAAAGGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110300114 13:73916146-73916168 GCATAAATCCTGTATGAAACAGG + Intronic
1111040092 13:82736855-82736877 GAATAAAGCCTGTTTGATACTGG + Intergenic
1111515946 13:89331202-89331224 GAAAATAGCATTTCTGAAACTGG - Intergenic
1111689855 13:91550123-91550145 GAAAAAAGCCAATCTGAAAATGG + Intronic
1112458894 13:99585758-99585780 GACCAAAGCCAGTCTGAATTTGG - Intergenic
1114011657 14:18375696-18375718 AAACATAGCCTGTCTCACACAGG + Intergenic
1118469603 14:66063053-66063075 GAAGAAAGCTTATCTGAAACTGG + Intergenic
1118608165 14:67518237-67518259 GAGCAAAGCCTGTCTGTTCCTGG - Intronic
1118642193 14:67803330-67803352 GAAGAAGACTTGTCTGAAACGGG - Intronic
1124156721 15:27232671-27232693 CAACAAGGCCTGGCTGAAAAAGG + Intronic
1126371251 15:47949555-47949577 GGACACAGCCTGGCTGGAACTGG + Intergenic
1127552264 15:60052234-60052256 TAAGAAAGCCTCTCTGGAACAGG + Intronic
1128128282 15:65208933-65208955 GAACAAAGGCTGTCTCAGCCTGG - Intronic
1128260562 15:66229936-66229958 CAACAAATTCTGTCTGAAAGTGG + Intronic
1129276955 15:74452102-74452124 CAACAACGCCTGACTGAGACAGG + Intronic
1129306348 15:74666575-74666597 GAAAGAAGCCAGTCTGAAAAGGG + Intronic
1130180317 15:81620674-81620696 GAAGGAAGCCAGTCTGAAAAAGG - Intergenic
1130635735 15:85618109-85618131 GAATAAAGCCTGTATGTAGCTGG + Intronic
1130944105 15:88538106-88538128 GAAGAAAGCCTGACTGAATTGGG + Intronic
1131682820 15:94741926-94741948 GACCAAAGCCTGTCAGATGCTGG + Intergenic
1135794192 16:25425740-25425762 GAACTAAGACTGGCTGAAACAGG + Intergenic
1138103874 16:54276514-54276536 GAACAAAGGCAGTCTGATTCCGG + Intergenic
1138918176 16:61493824-61493846 GAACAAATTCTGTATGAAAATGG - Intergenic
1139109058 16:63866375-63866397 GAATAAAGCCAGTCTAAAAAGGG + Intergenic
1139701668 16:68711563-68711585 GAACAGAGGCTGTGGGAAACCGG - Intronic
1141201223 16:81899747-81899769 GAACCAAGCGTATCTGACACAGG - Intronic
1143234234 17:5384290-5384312 GAAGAAAGCCTCAGTGAAACAGG + Exonic
1146610913 17:34304246-34304268 GACCTAAGCCTGTCATAAACAGG - Intergenic
1148606278 17:48931669-48931691 GATCAAAGCCAGTCTTAAATGGG - Exonic
1149306122 17:55348189-55348211 GCACAAATCCTGTTTGAAATGGG + Intergenic
1150729517 17:67679856-67679878 AAACCAAGCCTTTGTGAAACTGG - Intronic
1152641976 17:81453027-81453049 GGGCAAAGCCTGTCTGGAGCAGG - Intronic
1154057958 18:11029780-11029802 CAACAAGACCTGTCTGAAAAGGG - Intronic
1156373480 18:36491679-36491701 GAAAGAAGCCAGTCTGAAAAAGG - Intronic
1162012503 19:7826314-7826336 GAACAATGCCTCTATGAACCTGG - Intergenic
1162277606 19:9669667-9669689 GCACAAAACCTGTCTGAAACTGG + Intronic
1162518504 19:11165156-11165178 GAACAGAGCCTGCGGGAAACGGG - Intronic
1163335484 19:16668720-16668742 GAAAGAAGCCAGTCTGAAAGGGG - Intronic
1163846838 19:19642909-19642931 GAAGAAAGCCGGTCTGACAATGG + Intronic
1167217439 19:48173933-48173955 GAACAACCCCTGTTTAAAACTGG - Intronic
1167771216 19:51520222-51520244 AAACTATGCCTGTCTGGAACTGG + Exonic
926014803 2:9441302-9441324 GAACAAAGCCTATTTACAACTGG - Intronic
928757134 2:34540824-34540846 AAACAAAGCCTATGTGATACAGG - Intergenic
928769504 2:34689692-34689714 GAACAAAGCCTATATGACAGTGG - Intergenic
930463688 2:51716838-51716860 GATCAAAGCTTTTGTGAAACGGG + Intergenic
933040967 2:77466171-77466193 GAACAAAGCTTATCAGAAAGGGG + Intronic
933265635 2:80178026-80178048 GCACAAAGCCTGTGTAAATCAGG + Intronic
935519394 2:104085229-104085251 TACCAAAGCCTCTCTGAAAATGG - Intergenic
936751020 2:115641690-115641712 GAAGAATGCCTGTCAGATACTGG + Intronic
940071708 2:149695940-149695962 GAACAAAGCCTGTCTGGGAACGG + Intergenic
941018683 2:160385505-160385527 GAACAATGACAGTCTGGAACAGG - Intronic
942780045 2:179630989-179631011 GAACAAAGCCTCCAAGAAACAGG + Intronic
943035373 2:182738432-182738454 GGTCAAAGGCTGTCTGAGACAGG + Intronic
943235375 2:185311663-185311685 TAAGAAGGCCTGTGTGAAACTGG + Intergenic
943321755 2:186452755-186452777 GAACAAAGCTTGACAGAAATAGG + Intergenic
946397377 2:219449711-219449733 GCACAAAGCGTGTCTGTAACAGG - Intronic
946711657 2:222512736-222512758 GAAAGAAGCCTGTCTGCAAAGGG - Intronic
947139104 2:227004601-227004623 AAACAAAGGCTGTGTGAGACGGG + Exonic
947264414 2:228261164-228261186 AACAAAAGCCTGACTGAAACAGG + Intergenic
947272446 2:228352281-228352303 GATCAAAGCCAGTCTTAAATGGG - Intergenic
947698051 2:232209386-232209408 GAACAAAGCCTGTCTTACCATGG + Intronic
948555642 2:238808630-238808652 GAGTAAAGTCAGTCTGAAACTGG - Intergenic
1171038557 20:21738615-21738637 GAACAAAGCCTCCAAGAAACTGG - Intergenic
1171154425 20:22859263-22859285 TAAGAAAGACTGTCTGAAAGTGG - Intergenic
1173182732 20:40816861-40816883 GGACAAAGCCTGTGTGAAGAGGG - Intergenic
1174455368 20:50645185-50645207 GAACAAGGCCTCTCTGGAGCTGG - Intronic
1180436150 22:15306504-15306526 AAACATAGCCTGTCTCACACAGG + Intergenic
1182186255 22:28405714-28405736 GACTAAAGACTGGCTGAAACAGG + Intronic
1183748532 22:39705969-39705991 GGACAGAGCCTGTCTGAGCCAGG - Intergenic
949416507 3:3820655-3820677 GAACAAAGCCTGTCTGAAACAGG - Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
955841254 3:63115247-63115269 AAAGAAAGCCTGTCTGTATCTGG + Intergenic
956188492 3:66585043-66585065 GAAAGAAGCCTATCTGAAAAGGG - Intergenic
956497334 3:69842485-69842507 GAAGGAAGCTTATCTGAAACTGG + Intronic
957154385 3:76529042-76529064 GAAAAAACCCTGACTGAAATGGG + Intronic
960460658 3:117930789-117930811 AAAGAAAGCCTGTCTAAGACTGG + Intergenic
961118370 3:124351056-124351078 GAACAAAGCAGGTCTCAGACAGG - Intronic
965676979 3:171207821-171207843 GAACAAAACCTGGTTGCAACAGG - Intronic
966649178 3:182280272-182280294 GTACAAAGCCTGACTAAGACAGG - Intergenic
968423959 4:508871-508893 GACCATGGCATGTCTGAAACAGG + Exonic
968540285 4:1164811-1164833 GGACAAGGCCTTCCTGAAACTGG + Intergenic
969784123 4:9439606-9439628 GAACAAAGACTGAATGAAATAGG + Intergenic
969950782 4:10832897-10832919 GAAGAGAGCCTTTCTCAAACTGG - Intergenic
970113328 4:12663474-12663496 GAACAAACCTTGTCTGGACCAGG + Intergenic
971790149 4:31159751-31159773 GAATAAATCCTTTCTAAAACAGG - Intergenic
974087568 4:57277503-57277525 GAACAGAGCATTCCTGAAACAGG - Intergenic
975002491 4:69241895-69241917 GAACAAAGTCAGTTTGAAATAGG - Intergenic
975007407 4:69307880-69307902 GAACAAAGTCAGTTTGAAATAGG + Intronic
975010595 4:69345877-69345899 GAACAAAGTCAGTTTGAAATAGG - Intronic
978317225 4:107451835-107451857 GAACAAAGACTATAGGAAACTGG - Intergenic
978591501 4:110329441-110329463 GAACCAAGATTATCTGAAACTGG + Intergenic
979607918 4:122658387-122658409 GAGAAAAGCCTGGCTGAAAAAGG + Intergenic
981916545 4:150040058-150040080 GAATGAAGACTGACTGAAACAGG - Intergenic
985445682 4:190020158-190020180 CAATATAGCCTGTTTGAAACTGG + Intergenic
986130291 5:4923744-4923766 GAACAGAGCACTTCTGAAACTGG + Intergenic
987147676 5:15008349-15008371 TAACAAAGACTTTCTGAAAAAGG - Intergenic
987379650 5:17273349-17273371 CAATAGAGCCTGTCTGAAGCAGG + Intronic
989453301 5:41612274-41612296 GAAGAAAGCCTTTCTGAAAAAGG - Intergenic
989980064 5:50632988-50633010 GAAAGAAGCCAGTCTGAAAAGGG + Intergenic
990779974 5:59349444-59349466 GATCAAAGCCTGTCTGATCTGGG - Intronic
990990564 5:61679318-61679340 GAACAAAGCCTTTCGGGAAAAGG - Intronic
992351406 5:75932827-75932849 GACCTAAGCCTGTCATAAACAGG - Intergenic
993260043 5:85646335-85646357 GAACATAGCCTGTATGTAATTGG + Intergenic
994821691 5:104660119-104660141 TAACAAAGCTAGTTTGAAACAGG + Intergenic
995226964 5:109711388-109711410 TATCAAAGGCTGTCTGAAATAGG - Intronic
995537148 5:113148153-113148175 GAACTGAGCCTGTGGGAAACTGG - Intronic
996097582 5:119415079-119415101 GAAGAAAGCCCATCTGAAAAAGG + Intergenic
997863609 5:137442040-137442062 GAACAAAGTCTGTCAGTGACAGG + Intronic
1003059529 6:2851961-2851983 GTACAAAGTCTGTCTGCAGCAGG + Intergenic
1003351428 6:5321132-5321154 GAACAAAGCCTTTATGGAATTGG - Intronic
1005173585 6:23017144-23017166 CAACTAAACCTTTCTGAAACAGG + Intergenic
1007417644 6:41701328-41701350 GAACAAAGCATGGCAGACACAGG - Intronic
1007863615 6:44942333-44942355 GATCAAAACCAGACTGAAACTGG + Intronic
1007932761 6:45707346-45707368 CTACAAAGCCTGTCTGAAACAGG - Intergenic
1008221992 6:48865483-48865505 AAAAAAAGCCAGTCTGAAAAGGG + Intergenic
1009617301 6:66026265-66026287 GAACAAAGTCTTGCTGACACAGG - Intergenic
1010489956 6:76463700-76463722 GAACAAAGACTGTTTCAATCAGG - Intergenic
1013604827 6:111738252-111738274 GAACCATGCCTACCTGAAACAGG + Intronic
1014685888 6:124499756-124499778 GAAGAAAGGCTGTCTGAGCCAGG + Intronic
1015210005 6:130686208-130686230 AAAGATAGCATGTCTGAAACTGG - Intergenic
1018531303 6:164766455-164766477 GAAGAAAGCATGTCTTAGACTGG - Intergenic
1021584874 7:22197298-22197320 AAATCAAACCTGTCTGAAACAGG + Intronic
1023301888 7:38782125-38782147 GAATAAAGCCTGAATGAGACAGG - Intronic
1025711440 7:63914028-63914050 AAAAAAAACCTATCTGAAACTGG - Intergenic
1028036131 7:85985876-85985898 AAGCAAAGCGTGTCTGTAACAGG + Intergenic
1028498027 7:91484151-91484173 GAACAAAGCTAGTGAGAAACAGG - Intergenic
1028596266 7:92548561-92548583 GAACAATGCCTGGCTGATAGTGG - Intergenic
1031216372 7:118898206-118898228 AAATAAATTCTGTCTGAAACAGG - Intergenic
1031910669 7:127513623-127513645 GAACAAAGCCTAAAGGAAACTGG + Intergenic
1032707231 7:134431982-134432004 GAATACAGCCCGTCAGAAACGGG + Intergenic
1032771646 7:135064994-135065016 GAAGAAAGTCTGTCTGAGAATGG - Intronic
1036834912 8:12054522-12054544 GAACAAAGCCTGAATGAAATAGG - Intergenic
1036856755 8:12301086-12301108 GAACAAAGCCTGAATGAAATAGG - Intergenic
1037042084 8:14248476-14248498 GAACTAAGCCTCTATTAAACTGG + Intronic
1037243670 8:16806092-16806114 CAACAAAACCTGTCACAAACTGG - Intergenic
1039413426 8:37374627-37374649 CAACAAAGCCTGTTAGAAATGGG + Intergenic
1040598635 8:48863514-48863536 CAACAAAGCAAGTCTGAAAATGG - Intergenic
1041551926 8:59112631-59112653 GAAAAAAGCATGTCTAAAATTGG + Intronic
1041699876 8:60776470-60776492 CAACAAATCCTGCCTGAGACTGG - Intronic
1041907916 8:63053864-63053886 GTACAAAAGCTTTCTGAAACAGG - Intronic
1043824734 8:84912404-84912426 GAACAATGCTTTTTTGAAACTGG - Intronic
1044223477 8:89697779-89697801 GAACAAAACCTCTGAGAAACAGG - Intergenic
1044451102 8:92336318-92336340 GGGTAAAGCCTGTCTGAGACTGG - Intergenic
1044657387 8:94562789-94562811 GAAAAAAGCTGGTCTGAAATGGG - Intergenic
1045042554 8:98240406-98240428 GAAAATAGCCTGTCTGAATCAGG - Intronic
1048218171 8:132515795-132515817 GAATTAATCTTGTCTGAAACGGG - Intergenic
1050171567 9:2824821-2824843 GAACAAATGCTGTCAGGAACAGG + Intronic
1052404570 9:28043282-28043304 ACACAATGGCTGTCTGAAACAGG - Intronic
1052692743 9:31835947-31835969 CAATAAAGCCTTTCTTAAACTGG - Intergenic
1052862676 9:33446596-33446618 GAACAAAACCAGGGTGAAACTGG + Intronic
1057097367 9:92324550-92324572 TAACAAAGTCTGACAGAAACAGG + Intronic
1057144766 9:92750519-92750541 GAAAGAAGCCAGTCTGAAAAGGG + Intronic
1057759862 9:97863343-97863365 GAACCAACCCTGGCTGAAGCTGG - Intergenic
1060009181 9:120028336-120028358 GAATATAGCAAGTCTGAAACTGG + Intergenic
1060778781 9:126396504-126396526 GAACAAAATCTGTCAGGAACCGG + Intronic
1060896708 9:127223592-127223614 GAAAAAGGGCTGTCTTAAACGGG + Intergenic
1188017618 X:25122644-25122666 CAAGAAGGCCTGTCTGAAAACGG - Intergenic
1190432491 X:50391598-50391620 GTAGAAAGACTGTCTGAAAAGGG - Intronic
1191596229 X:62947036-62947058 GAACAAAGCCTCCATGAAATTGG + Intergenic
1194352764 X:92840622-92840644 GAACAGAGATTATCTGAAACTGG - Intergenic
1195472705 X:105250089-105250111 GAAATAAGCCAGTCTGAAAAGGG + Intronic
1196323576 X:114373082-114373104 CAACAAAGCATGGCTCAAACAGG + Intergenic
1197175103 X:123477163-123477185 GGACAAAGCATTTCAGAAACAGG - Intronic
1197415386 X:126166475-126166497 AAACAACGCATGTCTGATACTGG - Intergenic
1197480179 X:126974152-126974174 GATCAAAGAGTGTTTGAAACTGG - Intergenic
1199491665 X:148406665-148406687 GAACAGAGCCTGTTTGCAACAGG + Intergenic
1199602195 X:149548114-149548136 GACCAAAGCCTGTCTTGGACAGG + Intronic
1199648192 X:149931362-149931384 GACCAAAGCCTGTCTTGGACAGG - Intronic
1199806564 X:151306083-151306105 GAACAAAAATTATCTGAAACTGG - Intergenic
1200661067 Y:5957364-5957386 GAACAGAGATTATCTGAAACTGG - Intergenic
1202071045 Y:20991818-20991840 GAACAAGGCCTGTCTGGACAGGG + Intergenic