ID: 949418258

View in Genome Browser
Species Human (GRCh38)
Location 3:3836781-3836803
Sequence TCTCCCTAGACTACAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949418258 Original CRISPR TCTCCCTAGACTACAGTGGG TGG Intronic
900340332 1:2185593-2185615 TCACCCTAGACCACAGCGGCTGG - Intronic
902311304 1:15584040-15584062 TCTCCCCAGCTTACAGTGGCAGG - Intronic
904627029 1:31812294-31812316 CCTCACTACACTACAGTGGTTGG + Intronic
906974157 1:50550827-50550849 TCTCCCTTGACTTCAGTGTCAGG + Intronic
909034553 1:70582144-70582166 TCCTGCTAGATTACAGTGGGTGG + Intergenic
909510535 1:76447630-76447652 TGTCCCTAGGCTACACGGGGAGG - Intronic
909713133 1:78674498-78674520 TCTCCCTTTGCTACAGTAGGTGG - Intergenic
914747803 1:150512336-150512358 TCTCTCTGGTCCACAGTGGGAGG + Exonic
923749707 1:236736296-236736318 TCTTGATAGACTGCAGTGGGCGG + Intronic
924159737 1:241218605-241218627 ACTCCTTAGACTTAAGTGGGGGG + Intronic
1074400198 10:113135301-113135323 TATTCATCGACTACAGTGGGGGG - Intronic
1075973269 10:126673033-126673055 TCTCCCTTGACCACAGCTGGTGG + Intergenic
1078154870 11:8790658-8790680 TCTCCAGAGGCTGCAGTGGGAGG + Intronic
1086186838 11:84028074-84028096 TCTCTCTAGAATACAGTGATAGG - Intronic
1089676521 11:120093647-120093669 TCTCCCATGAGTACAGTCGGTGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1092826356 12:12403461-12403483 TCTCCCTAGTCCGCTGTGGGGGG + Intronic
1096218097 12:49809439-49809461 TCTCCCTAGAGGACTCTGGGGGG - Intronic
1096455537 12:51781985-51782007 TCTTCCTATACAACTGTGGGTGG - Intronic
1096732266 12:53623697-53623719 TTTTCCTAGGCTACAGTGGGAGG - Intronic
1099233662 12:80056592-80056614 ACTCCCTAGACTAAAATAGGAGG - Intergenic
1099834934 12:87897000-87897022 TCTCCCTACAGTGCAGTTGGGGG + Intergenic
1101059487 12:100955956-100955978 TCTCCCTAGTCCACAGTGCCTGG + Intronic
1104166504 12:126235775-126235797 TCTCCCAAAAACACAGTGGGAGG - Intergenic
1109814056 13:67556071-67556093 TCTCCCTACACTGCAGTAGTTGG - Intergenic
1111956811 13:94768152-94768174 TCTTCCAGTACTACAGTGGGGGG + Intergenic
1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG + Intergenic
1119784165 14:77300077-77300099 TCTCCATTGACCACAGAGGGTGG + Intronic
1123756573 15:23401661-23401683 TCTCCCCAGCCTGCACTGGGAGG + Intergenic
1126941824 15:53776006-53776028 GCTCCCTTGCCTACAGTGGAGGG - Intergenic
1128563460 15:68683571-68683593 TCTCAATATCCTACAGTGGGGGG - Intronic
1129852481 15:78801637-78801659 CCTTCCTAGACTACACTGGGAGG - Intronic
1129898409 15:79125924-79125946 TCTCCCTAGAATATTGTGGGTGG + Intergenic
1130250506 15:82297439-82297461 CCTTCCTAGACTACATTGGGAGG + Intergenic
1131903030 15:97109793-97109815 TCTCCCAAGACTAAAGCAGGAGG + Intergenic
1132573255 16:653244-653266 TCTCCCTGGGCTGGAGTGGGAGG + Intronic
1132665078 16:1077887-1077909 TCTCTCTGGGCCACAGTGGGGGG + Intergenic
1134350949 16:13437300-13437322 TCTCCCCAGGGTAGAGTGGGAGG - Intergenic
1138667802 16:58586513-58586535 TCTTTGTAGCCTACAGTGGGTGG - Intronic
1139487680 16:67267545-67267567 CCTCACTAGACTACAAAGGGAGG - Intronic
1141118541 16:81332667-81332689 TCTCCTTAGTCTCCAGTGTGTGG + Intronic
1144660280 17:17063642-17063664 TGTCCTTAGACTGCAGTGGGTGG - Intronic
1149492803 17:57097205-57097227 TTTCCTTAGGCTGCAGTGGGTGG - Intronic
1152969872 18:151265-151287 ACTCCGGAGGCTACAGTGGGAGG - Intergenic
1156421005 18:36953094-36953116 TCTACCTAGATTTCAGTGGTTGG + Intronic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1164209079 19:23082175-23082197 TCACCAGAGACTAAAGTGGGAGG - Intronic
1165861373 19:38911270-38911292 GCTGCCCAGACTACAGGGGGAGG + Intronic
927245251 2:20952320-20952342 TCTCCCTAGGCGACAGTGCCTGG - Intergenic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
941926726 2:170902960-170902982 TCTCACAAGACTGAAGTGGGAGG - Intergenic
943378830 2:187117645-187117667 TCTCCATGGGCTCCAGTGGGTGG + Intergenic
947970908 2:234323732-234323754 TCTTCCCAAAGTACAGTGGGGGG - Intergenic
1169437882 20:5610119-5610141 TCTCCCCAGACTCCACTGGCTGG - Intronic
1170442666 20:16395144-16395166 TCTGCCTTGACTAAACTGGGAGG - Intronic
1174192365 20:48749437-48749459 TCTCCCTAGACAAGCGTGGTGGG - Intronic
1175045577 20:56101875-56101897 TCTCCCTTGACTAAAGTTAGGGG + Intergenic
1179164302 21:38923986-38924008 TCTGCCCAGACTATAGAGGGAGG - Intergenic
1179621603 21:42620030-42620052 CCTGCCTAGTGTACAGTGGGGGG - Intergenic
1182175633 22:28284269-28284291 GCTCCCAATTCTACAGTGGGGGG + Intronic
1183474406 22:38027938-38027960 CCTCCCTAGAATACAGTGGCGGG - Intronic
949410161 3:3754865-3754887 TCTCCCTAGTTTCCAGTGGTTGG - Intronic
949418258 3:3836781-3836803 TCTCCCTAGACTACAGTGGGTGG + Intronic
956168729 3:66416110-66416132 TCTCCCTGCACAAAAGTGGGAGG - Intronic
958934759 3:100244457-100244479 TCTCCATAGCCCACAGTGGTTGG - Intergenic
963037931 3:141048588-141048610 TGTCCCTAGAGTACAGTTGTGGG - Intergenic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
967354604 3:188554231-188554253 TCTCCATGCACCACAGTGGGTGG - Intronic
969292521 4:6249207-6249229 AGTGCCTAGACCACAGTGGGGGG + Intergenic
972729241 4:41776988-41777010 TCTCCCTTGACTGCAGTTGTGGG + Intergenic
976617964 4:87097229-87097251 TCTCCCAGGAGTAGAGTGGGTGG + Intronic
977386248 4:96343195-96343217 TCTCCCTGGAGCAGAGTGGGAGG - Intergenic
980962841 4:139493386-139493408 TCTGGCTGGAGTACAGTGGGTGG + Intergenic
985926779 5:3025338-3025360 GTTCCCAAGACTACACTGGGAGG + Intergenic
992229821 5:74653082-74653104 TCTAGCTTGACTACAGTAGGAGG + Intronic
998679130 5:144445885-144445907 TCTCCCTAAACTAGACTGGAAGG - Intronic
1008099553 6:47376694-47376716 TCTCCCTAGAACACATTGGCAGG + Intergenic
1019341259 7:510165-510187 ACGCCCTAGACCACAGTGCGGGG - Intronic
1022074297 7:26952144-26952166 TCTCCTTATACTACAGTGCCTGG + Intronic
1028427127 7:90702084-90702106 CCTCCTTAGACTGCAGTGGATGG + Intronic
1028598451 7:92573274-92573296 TCTCCCGAGACTGAAGTGGGAGG - Intronic
1032725312 7:134585616-134585638 TCACCTGAGACCACAGTGGGAGG + Intergenic
1032726264 7:134592446-134592468 TCACCTGAGACCACAGTGGGAGG + Intergenic
1034935791 7:155199838-155199860 TCTCCCTAGACCTCCGTGTGAGG + Intergenic
1036560902 8:9899592-9899614 TCTCTCAAAATTACAGTGGGAGG - Intergenic
1042485911 8:69345505-69345527 TCTCCCTAGAAGACAGCAGGAGG + Intergenic
1044230271 8:89767465-89767487 TCTCCTTAGAATAAAGTGGTAGG + Intronic
1044744677 8:95360963-95360985 TCTCCCTAGAAGCCAGTGTGGGG - Intergenic
1050258492 9:3816963-3816985 TCTCCCTGGGGTACTGTGGGGGG - Intergenic
1057865213 9:98674918-98674940 CCTCCCTAGGCTTCAGTGGCAGG + Intronic
1059327616 9:113513823-113513845 GCTCCCTTGGCTACAGAGGGAGG + Intronic
1061285088 9:129618026-129618048 TCTACCTAGAGTACTGTGTGAGG + Intronic
1190681716 X:52831592-52831614 GCACCATAGACTGCAGTGGGAGG + Intergenic
1196201380 X:112889598-112889620 TCACCCTAGACCACAGCGGCTGG + Intergenic
1196584369 X:117412454-117412476 ACTCCCAAGACTAAACTGGGAGG + Intergenic
1196814689 X:119655420-119655442 GCTCACTGGACTCCAGTGGGTGG + Intronic
1198130997 X:133694912-133694934 TCTTTCTATACTAAAGTGGGAGG - Intronic