ID: 949419246

View in Genome Browser
Species Human (GRCh38)
Location 3:3848307-3848329
Sequence CATTTAGAGCAGATGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949419246 Original CRISPR CATTTAGAGCAGATGGAACT AGG Intronic
903501680 1:23803769-23803791 CTTAAAGATCAGATGGAACTGGG - Intronic
906984879 1:50672387-50672409 CATTTGGAGCAGCTGGAGGTGGG + Intronic
907910435 1:58821133-58821155 CATTTAGATAAGAATGAACTGGG + Intergenic
908408219 1:63835862-63835884 CTTTTAGAGGAAATGGAGCTTGG + Intronic
910133510 1:83937753-83937775 CATTAAGAGTTGATTGAACTTGG - Intronic
911060390 1:93742530-93742552 CAATTAGAGAAAATGGAACCTGG - Intronic
915306515 1:154982885-154982907 TATTTATAGCAGAAGGAAGTTGG - Intergenic
915584551 1:156837302-156837324 GGTTTAGAGCAGATGATACTTGG - Intronic
916742301 1:167656823-167656845 CCTTTAGAGCAGATGGAAAAGGG - Intronic
917563927 1:176191711-176191733 TTATTAGAGCAAATGGAACTGGG - Intronic
919284698 1:195541323-195541345 CATTTTTAGCATGTGGAACTAGG - Intergenic
920490815 1:206413420-206413442 CATCTGGAGCAGATGGAAAAGGG + Intronic
921182311 1:212641261-212641283 AATTTAGAGGACATGGAACATGG + Intergenic
922603714 1:226875664-226875686 CATTTAAGGCCAATGGAACTAGG - Intronic
1063136216 10:3218728-3218750 CACAGAGAGCACATGGAACTTGG - Intergenic
1065582612 10:27186642-27186664 CATTAAAAGCACATTGAACTAGG - Exonic
1067252896 10:44603005-44603027 CATATTGAGAAAATGGAACTAGG - Intergenic
1069701285 10:70428324-70428346 CATTCAGAATGGATGGAACTGGG - Exonic
1070812448 10:79305301-79305323 CATTTAGGGCAGGTGGAGGTGGG - Intronic
1074797144 10:116958573-116958595 CATCTAGAGCCAATGGATCTGGG + Intronic
1076842027 10:133050428-133050450 GACTTAGACCAGATTGAACTGGG - Intergenic
1077637469 11:3853675-3853697 CATTAAGAGAAGATGGGGCTGGG - Intergenic
1078589662 11:12628465-12628487 CATTGAGACCAGATGTAGCTGGG - Intergenic
1079413292 11:20209406-20209428 CATTTTGAGCAAATGGAAGGGGG + Intergenic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1083861806 11:65423970-65423992 CATGGCGAGCAGATGGAACCGGG + Intergenic
1087184652 11:95175935-95175957 CATGGAGAGGAAATGGAACTTGG + Intronic
1090584349 11:128194262-128194284 CATTTAGAAAAAAAGGAACTTGG + Intergenic
1093058197 12:14575901-14575923 CCTTTTGAGTAGATGGAACTAGG - Intergenic
1094184615 12:27627743-27627765 CATTTAGAGCAGATTTGAATGGG - Intronic
1095519818 12:43050318-43050340 CATTTATAGAAGATAAAACTTGG - Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1095933553 12:47653060-47653082 TATTTAGAGCAGCTGTTACTTGG - Intergenic
1096374796 12:51099867-51099889 CGTATAGAGCAGATGAAAATTGG + Intronic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097479322 12:60101398-60101420 AATTTAAAGCAGAAGGTACTGGG - Intergenic
1098213098 12:68186802-68186824 CAATTAGTGAAGATGGAGCTAGG - Intergenic
1098617196 12:72541631-72541653 CATGTAAAGCAGTTTGAACTAGG - Intronic
1099157770 12:79200690-79200712 CATTCAGAGAAGAAGTAACTGGG + Intronic
1099922731 12:88979219-88979241 CATTTTGAGCACATAAAACTGGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1105346722 13:19579691-19579713 CATTTAAACAAGATGGAAGTGGG - Intergenic
1109281771 13:60364695-60364717 CATTTAGAGCAGCTGAAAACAGG + Intergenic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1110933028 13:81246956-81246978 CAATTAGAGCAGTTGGAGCTAGG - Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1111750975 13:92331300-92331322 CATTTAGAGAAGATAGAAACTGG - Intronic
1112404357 13:99105190-99105212 TGTTTAGACCTGATGGAACTTGG - Intergenic
1116886677 14:50228995-50229017 CATTCAGAGCATCTAGAACTTGG - Intronic
1121254681 14:92522616-92522638 CATTTAAAACAGAGGGGACTTGG - Intronic
1122530662 14:102424126-102424148 CATTTAGCCCAGGTGGAAGTAGG - Intronic
1122708647 14:103639026-103639048 CATTTACAGCTGAGGAAACTGGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129830993 15:78670098-78670120 CACTTACAGCAAGTGGAACTTGG + Intronic
1131126416 15:89861554-89861576 CATTTAGAGCCTAGGGTACTTGG - Intronic
1132170895 15:99653118-99653140 CATTTAGGGCAGAAGATACTAGG + Intronic
1134327811 16:13223065-13223087 CTTTGACAGCAGATGGATCTGGG - Intronic
1135971714 16:27076887-27076909 CATTAAGAGCAGGTGGCCCTAGG - Intergenic
1137821835 16:51453374-51453396 CATTCAGAGCTGGGGGAACTTGG + Intergenic
1140801631 16:78493757-78493779 CATACAGAAGAGATGGAACTAGG + Intronic
1141309958 16:82903904-82903926 GCTTTAGAGCAGACAGAACTGGG - Intronic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1150473492 17:65457335-65457357 CATCTAGAGCAGGTGGAGTTGGG - Intergenic
1158362133 18:56687113-56687135 CATTTTGAGAAGTTGGGACTTGG + Intronic
1158376792 18:56879822-56879844 CATTTTCAGCAAATGGCACTAGG - Intronic
1159289471 18:66396863-66396885 CATCTAAAGCAGGTGTAACTGGG - Intergenic
1159733441 18:72062080-72062102 ACTTTAGAGCAGATGGAGATAGG - Intergenic
1160020924 18:75180636-75180658 TATTTAGAGCAGATAGAATTAGG + Intergenic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
926088131 2:10032835-10032857 CTCTGAGAGCAGATGAAACTAGG + Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931916083 2:66958060-66958082 CATGTAGGGCAGATCCAACTAGG + Intergenic
934612512 2:95751743-95751765 GACTTAGAGCAGATGTACCTTGG + Intergenic
935883224 2:107587736-107587758 CATTTGGAGCACATGAAAGTTGG - Intergenic
939536841 2:143441968-143441990 CATTAAGGGGATATGGAACTGGG - Intronic
941800931 2:169658995-169659017 CATTCTGAGTAGATGGGACTAGG - Intronic
947815408 2:233033353-233033375 GATTTGAAGCAGATGGACCTGGG + Intronic
1168785744 20:538756-538778 TTTTTAGAGGAGATGGAAATGGG - Intronic
1168842440 20:917994-918016 CATTTACAGCTGAGGCAACTGGG - Intergenic
1170403631 20:16013318-16013340 CATTTACACCACATGGAATTGGG - Intronic
1170756022 20:19207909-19207931 CATTTAGAGAAAAAGGAAATGGG + Intergenic
1173519960 20:43692055-43692077 CATTTACAGGAGCAGGAACTTGG + Intronic
1173942520 20:46923749-46923771 CATTAACAGCAGATGCATCTGGG + Intronic
1174532944 20:51229205-51229227 AATTGAGAGCATATGGAATTTGG + Intergenic
1176820637 21:13652057-13652079 CAGGAAGAGCAGATGGCACTGGG + Intergenic
1178094732 21:29202100-29202122 CATTGAGATCAGAAGGAAATGGG - Intronic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1178728268 21:35074772-35074794 CATTTTGAGTATATGGAACTTGG + Intronic
1179322244 21:40303121-40303143 CATTTAGTTGAGATGGGACTTGG + Intronic
1182686746 22:32126652-32126674 TATTTAGAGAAGAGGGAAGTAGG + Intergenic
1184839077 22:47042080-47042102 TTTTTATAGAAGATGGAACTGGG + Intronic
1185018570 22:48359838-48359860 CATTTAGAGATGAAGAAACTGGG + Intergenic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
952821564 3:37490893-37490915 CACTTAGAGGAGCTGGAACCAGG - Intronic
956956091 3:74342541-74342563 CACCTAGAGAAGATGGACCTTGG + Intronic
963641867 3:147870666-147870688 CATTTAGACCATAGGCAACTAGG + Intergenic
965906577 3:173714981-173715003 CATAAAGAGCAGATGGAAGGAGG + Intronic
968897869 4:3415255-3415277 CATCTAGAGCAGTTGGAAAGTGG + Intronic
971303798 4:25463241-25463263 CAATAAGAGGAGAAGGAACTCGG + Intergenic
974086503 4:57266440-57266462 CATCTTGAGCAGACAGAACTTGG - Intergenic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
979023164 4:115528677-115528699 CAGATAGAGTAGATGGACCTGGG + Intergenic
981322222 4:143405867-143405889 CATTTGGAGTAGATGGAATTTGG - Intronic
981936428 4:150244854-150244876 CATTTATAGCAGCTGGTTCTTGG - Intronic
988677403 5:33446785-33446807 GCTTTAGAGTGGATGGAACTGGG + Intronic
988714898 5:33815781-33815803 TAGTTAGAGGAGATGGAATTAGG - Intronic
990426018 5:55689945-55689967 CAATTAGAACAGATTGATCTAGG + Intronic
996615114 5:125432179-125432201 CATTTTAAGCAGAAGGAATTGGG - Intergenic
996633091 5:125660856-125660878 CATTTAGAGCACCAGGCACTAGG - Intergenic
997413011 5:133704473-133704495 CATTCAGCTCAGATTGAACTAGG + Intergenic
999532958 5:152482620-152482642 CATATAGAGCAAAAGGAAATGGG - Intergenic
1000767049 5:165305024-165305046 CATGTACAACATATGGAACTAGG + Intergenic
1000931452 5:167256513-167256535 TATTTATAGCAGATGTAATTGGG + Intergenic
1005209836 6:23447829-23447851 CAGGTAGAGAAAATGGAACTAGG + Intergenic
1005356038 6:24984535-24984557 CATTTAAAGCACTTGGAGCTGGG + Intronic
1006995432 6:38255611-38255633 CATTTAATGCATATGGCACTGGG - Intronic
1012074890 6:94670995-94671017 CAATTAGGGCAGATGGATCATGG + Intergenic
1013168027 6:107611141-107611163 CCTTTAGTGAAGAGGGAACTGGG - Intronic
1014185832 6:118433114-118433136 CAATGAGAACAGATGGAAATAGG + Intergenic
1014287576 6:119518035-119518057 CATTTAGAGCAAAAGAAATTTGG + Intergenic
1015307173 6:131722759-131722781 TATTTAGAGCAGAAAGAACTAGG + Intronic
1017719463 6:157234833-157234855 GATTTGGAGCAGATTGAATTTGG + Intergenic
1018703021 6:166442214-166442236 TATTCAGAGCAGATGGGGCTGGG - Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1020472806 7:8558387-8558409 GAGTTAGAGCAGCTGGAGCTTGG + Intronic
1020953612 7:14711307-14711329 TATTTAGAGTATATGGTACTTGG - Intronic
1027510719 7:79076268-79076290 AATTTAGAGCAGATGGACTGGGG + Intronic
1033439757 7:141367881-141367903 CCTTTAGAGCAGGTCGACCTTGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1038806573 8:30798796-30798818 AATTTAGAGCAGAAGGAATAAGG + Intronic
1042352891 8:67795640-67795662 CAGATAGAGCAGCTAGAACTTGG + Intergenic
1042950714 8:74198457-74198479 CATTAGGAGCAGATGGGACTGGG + Intergenic
1043342169 8:79253028-79253050 CATTAACAGCTGATGGCACTGGG - Intergenic
1046824917 8:118678000-118678022 TTTTTAGATCAGATGGAGCTTGG + Intergenic
1047629317 8:126689727-126689749 CATTTACAGATGAGGGAACTGGG + Intergenic
1050170258 9:2808536-2808558 GATTTAGTGCAGATGGAGGTAGG + Intronic
1055023882 9:71698701-71698723 TATGAAGAGCAGATGGACCTGGG + Intronic
1056286518 9:85092729-85092751 AATTTAGAGAAGAGGAAACTGGG - Intergenic
1057346628 9:94257332-94257354 CAACTTGAGGAGATGGAACTGGG - Intergenic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1058826402 9:108779122-108779144 CATAGAGAACAGATGGAAATAGG + Intergenic
1059880338 9:118682079-118682101 CATTTTCAGCTGATGGAAATGGG - Intergenic
1187279799 X:17849392-17849414 CACTTACAGGAGGTGGAACTGGG - Intronic
1187314060 X:18175540-18175562 CTTTTAGTGATGATGGAACTTGG - Intronic
1188766653 X:34100874-34100896 ATTTTAGAGAAGATGGTACTTGG + Intergenic
1188887737 X:35570966-35570988 CATTAGGAGCAGATGCAAATTGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189751562 X:44227875-44227897 CATTTCAGGCAGAGGGAACTTGG + Intronic
1190063283 X:47224191-47224213 CATCTAGGGCAGGTTGAACTGGG - Intronic
1191220918 X:57987011-57987033 CCTTTAGACCAAATGGAACTTGG - Intergenic
1193692734 X:84667598-84667620 CAATCACAGCAGGTGGAACTTGG + Intergenic
1197633892 X:128892409-128892431 CATGTAGAGCAGGTGAAACTGGG - Intergenic
1198333347 X:135642711-135642733 CATTAAGAGAAGATGGAAAATGG - Intergenic
1199376595 X:147118917-147118939 GAATGAGATCAGATGGAACTTGG + Intergenic
1200722311 Y:6621545-6621567 CATTTAGAATAGATTGAACATGG + Intergenic
1201943360 Y:19483310-19483332 CACATAGGGCAGATGGCACTAGG - Intergenic