ID: 949426951

View in Genome Browser
Species Human (GRCh38)
Location 3:3928090-3928112
Sequence CTGTGGGAACAACCCTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949426951_949426956 2 Left 949426951 3:3928090-3928112 CCAGTAGAGGGTTGTTCCCACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 949426956 3:3928115-3928137 CTTAACTTCCCCAAGTTTTCAGG 0: 1
1: 0
2: 2
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949426951 Original CRISPR CTGTGGGAACAACCCTCTAC TGG (reversed) Intronic
900564781 1:3326906-3326928 CTGAGGGAAAATCCCTCTACAGG + Intronic
902939274 1:19788134-19788156 CAGTGGGAACACCCTTCTCCTGG + Intronic
907329750 1:53663271-53663293 CTGTGGGCCCAGCCCTGTACCGG - Intronic
916782364 1:168048953-168048975 CTGTGGTAAAATGCCTCTACTGG + Intronic
917534700 1:175865766-175865788 CAGTGGGAACGACCCTCTTCTGG - Intergenic
1067662234 10:48244814-48244836 CTTTAGGAATGACCCTCTACTGG - Exonic
1073960461 10:108921035-108921057 CTGTGTGAATCACCTTCTACAGG - Intergenic
1074961377 10:118448972-118448994 CTCTGGGAACACCCCCCTGCTGG + Intergenic
1075689814 10:124387334-124387356 CGCTGGGAACAACCCTCTTAGGG - Intergenic
1084019864 11:66411003-66411025 CTGTGAGAACGACCCCCAACGGG + Intergenic
1084873574 11:72114296-72114318 CTGTGCTCACAACCCTCCACTGG - Intergenic
1092501633 12:9053215-9053237 AGGTGGGAACAACCCTGCACAGG - Intergenic
1094277468 12:28694403-28694425 CTGTGTGAACAAACATTTACTGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1099088822 12:78279592-78279614 CTATGGCAACAACCCTTTAAAGG + Intergenic
1104778234 12:131403776-131403798 CTGAGGGCACAACCCGCCACTGG - Intergenic
1105546282 13:21353045-21353067 CTGGGGGAAGGACCCTCTGCAGG + Intergenic
1115309500 14:31965245-31965267 CTCTGGGAGCACCCCTCTGCTGG - Intergenic
1118308221 14:64673836-64673858 CTGTGAGGACAACACTCCACAGG + Intergenic
1122462300 14:101905680-101905702 ATGGGGGAACCACCCTCTAGTGG + Intronic
1129487056 15:75884374-75884396 CTGTAGGAACAAAGCTCTTCTGG - Intronic
1132698915 16:1213994-1214016 CAGTGGGCACAACCCTGGACCGG + Intronic
1135651599 16:24211067-24211089 CTGTGGGAGCTTCCCTCCACTGG + Intronic
1136549946 16:30977677-30977699 CTGTGGCAGCAACCCACTCCAGG - Intronic
1139503724 16:67388573-67388595 CTTTGGGAGCCACCCTCTCCTGG + Intergenic
1143119373 17:4597494-4597516 CTCTGGGAAAATCCCTCTCCAGG - Intronic
1143320323 17:6064344-6064366 CTGTGGGATCAGCCATCCACTGG - Intronic
1143685835 17:8514896-8514918 CTCTGGGGACTACCCACTACTGG + Intronic
1143758537 17:9084436-9084458 CTGTGAAAACAACACTCTAGTGG - Intronic
1157129056 18:44985921-44985943 CTCTGGGAACAAGACTCTAGTGG - Intronic
1157327200 18:46677849-46677871 CTGTGGACAGAGCCCTCTACTGG - Intronic
1159327999 18:66949198-66949220 CTAGGGGAACAAACCTCTAGGGG + Intergenic
1162260450 19:9529467-9529489 CTGTGTGAGAAAACCTCTACTGG - Exonic
1165105256 19:33465440-33465462 CTGAGGCCACACCCCTCTACTGG + Intronic
1165315839 19:35054888-35054910 CTGTGGGAAGACCCCTCAGCTGG + Intronic
1166628478 19:44383402-44383424 CTATGGGACCAACCCTCGATTGG + Exonic
925052523 2:828370-828392 TTGTGGGAACAAGCCTCTCAGGG + Intergenic
933765767 2:85707621-85707643 CTGAGGCTACAACCCCCTACAGG + Intergenic
937892642 2:126950395-126950417 CTGTGGGGATAACTCTCTCCAGG - Intergenic
940655180 2:156479706-156479728 CTGTGGCCACAAACCTCTGCAGG - Intronic
1173141905 20:40491992-40492014 CTGTGGTAACAACAGTCTCCTGG - Intergenic
1176587734 21:8605110-8605132 CTGTGAGAAGAACCCACTTCAGG - Intergenic
1180270564 22:10582109-10582131 CTGTGAGAAGAACCCACTTCAGG - Intergenic
1181741639 22:24925827-24925849 GTCTGGGAACAATCCTCTCCAGG + Intronic
1185326386 22:50227786-50227808 CTGTGAGAACAGCCCTCAGCAGG - Intronic
949139619 3:616635-616657 CTGTGAGAAGAACCCACTTCAGG + Intergenic
949426951 3:3928090-3928112 CTGTGGGAACAACCCTCTACTGG - Intronic
950959620 3:17092038-17092060 CTTTGGGAACAACTCCCGACAGG - Intergenic
960142021 3:114159979-114160001 CTGTGGGAACAACGGTACACAGG - Intronic
968240325 3:197075870-197075892 CTCTGGGGACTACCCTCTACAGG - Intronic
968646146 4:1741556-1741578 CTGTGGGCAGAACCCTCTGGCGG - Intronic
968808081 4:2787996-2788018 CTGTGGGCCCCACCCTCCACAGG + Intergenic
969668361 4:8575221-8575243 CTGTGTGAAGAACCCTCCAGAGG - Intronic
969999093 4:11345707-11345729 CTGTTGGAACAACTCTCTCTAGG - Intergenic
970764388 4:19530089-19530111 CAGAGGGAACAACCATCTAAAGG - Intergenic
974099743 4:57403555-57403577 CTGAGGAAAGAACCCTCTAGAGG + Intergenic
974974396 4:68871948-68871970 CTCTTGGATCAACCCTCTTCTGG + Intergenic
975073355 4:70171839-70171861 AGGTGGGAACAGCCCTGTACAGG + Intronic
976315582 4:83655554-83655576 CTTTGGGAACCACCCTCAGCTGG - Intergenic
979066546 4:116143673-116143695 CTGTGTGAATAAACTTCTACTGG - Intergenic
985382322 4:189407529-189407551 CTGTTGGTACAAGCCTCTCCTGG + Intergenic
985810510 5:2080181-2080203 CTGGGGGAACACCCTTCTAAGGG - Intergenic
990754994 5:59058648-59058670 ATCTGGGTACTACCCTCTACCGG + Intronic
996067153 5:119091787-119091809 CTGTGGGACAAACCTCCTACAGG + Intronic
1000276106 5:159736213-159736235 CTTTGGGAACAACACACTCCGGG + Intergenic
1003833219 6:10037965-10037987 TTGTGGGAACAGCCCTTTAAGGG - Intronic
1003879086 6:10464213-10464235 TTGTCTGAACAACCCCCTACAGG + Intergenic
1015465888 6:133548258-133548280 CTGTGGGACCAACACTCTCTGGG + Intergenic
1020097347 7:5376442-5376464 CTGTGGGAACATCCCACCCCGGG - Intronic
1020533555 7:9364724-9364746 CTGTGGATACACCCCTCTAATGG - Intergenic
1021597501 7:22332844-22332866 CTGAGGGAGCAACCCACTACAGG + Intronic
1021953450 7:25798178-25798200 CTGAGGAAACAGCTCTCTACAGG + Intergenic
1022131068 7:27405077-27405099 CTCTGGGACCAACCCTCAAAGGG - Intergenic
1022525496 7:31034531-31034553 CTAAGGGAACAGCCTTCTACAGG + Intergenic
1032692340 7:134301227-134301249 ATGTGAGAACAAAGCTCTACAGG + Intronic
1052855713 9:33404948-33404970 CTGGGGCAACAGCCCCCTACTGG - Intergenic
1058825013 9:108767455-108767477 CTATGGGAATAACCCTGTAGGGG + Intergenic
1203617695 Un_KI270749v1:83291-83313 CTGTGAGAAGAACCCACTTCAGG - Intergenic
1188461081 X:30428060-30428082 CTGTGGTAGCTACCATCTACAGG - Intergenic
1195026253 X:100880609-100880631 GGGTGGGATCAACCGTCTACAGG - Intergenic