ID: 949427404

View in Genome Browser
Species Human (GRCh38)
Location 3:3933630-3933652
Sequence GGGGAGTGAAATATTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949427402_949427404 -4 Left 949427402 3:3933611-3933633 CCATGTAAGCAAGAAGAGAGGGG 0: 1
1: 2
2: 55
3: 370
4: 3639
Right 949427404 3:3933630-3933652 GGGGAGTGAAATATTTTAAGTGG 0: 1
1: 0
2: 2
3: 16
4: 253
949427399_949427404 5 Left 949427399 3:3933602-3933624 CCTCAGAAACCATGTAAGCAAGA 0: 2
1: 35
2: 60
3: 119
4: 359
Right 949427404 3:3933630-3933652 GGGGAGTGAAATATTTTAAGTGG 0: 1
1: 0
2: 2
3: 16
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949427404 Original CRISPR GGGGAGTGAAATATTTTAAG TGG Intronic
902251240 1:15155113-15155135 GTGGAGTGAGATATTTGGAGGGG - Intronic
903355517 1:22744326-22744348 GGGGAGTCAAATGTTATATGTGG - Intronic
904306874 1:29595470-29595492 GGGGAGTAAACTATTTTAGTAGG - Intergenic
905711439 1:40107772-40107794 GGGGATAGAAATTTATTAAGAGG - Intergenic
906763290 1:48400669-48400691 GAAGAGTCAAATTTTTTAAGTGG + Intronic
908863288 1:68515120-68515142 GGGAAGTGATTTATTTTAGGAGG - Intergenic
910133826 1:83942521-83942543 TGGTAGAGAAATATTTTTAGTGG + Exonic
910550595 1:88469554-88469576 GGGAAGTGAGAAATTTTAACTGG + Intergenic
910689128 1:89948168-89948190 GTGGAGTGACATATTTTCAAAGG - Intergenic
911712747 1:101094471-101094493 GTGGAGTGAAATAGTTAAGGTGG - Intergenic
911930506 1:103896944-103896966 GGGGAGTTAAATGTTTTATGTGG + Intergenic
912350377 1:109006832-109006854 GGAGTGTGTAATATTTTAAAAGG - Intronic
913638703 1:120789859-120789881 CAGAATTGAAATATTTTAAGTGG - Intergenic
916267758 1:162907998-162908020 GGGGAGTGCAATGTTGTATGGGG + Intergenic
916618272 1:166467819-166467841 GAGGAGTAAAATGCTTTAAGAGG + Intergenic
916686577 1:167152586-167152608 TGGGAGTGAAATGTTTTCACAGG + Intergenic
920770300 1:208878333-208878355 TGGAAGAGAAATATCTTAAGGGG - Intergenic
921342132 1:214144874-214144896 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
921624449 1:217362736-217362758 GAGGAGTGAAATATCTTTACAGG + Intergenic
922348368 1:224715961-224715983 GGGAGGAGAAATATTTTTAGGGG - Intronic
922447609 1:225710907-225710929 GGGGAGTGAGACATTTAAACAGG + Intergenic
922653966 1:227364778-227364800 GGGGAATGAAATATCCTATGTGG + Intergenic
923831273 1:237560205-237560227 GGGGAGTGAAATATCCATAGTGG - Intronic
923912023 1:238459545-238459567 GGGGAGTCAAAAATTATACGTGG - Intergenic
924658638 1:245996036-245996058 GGGAAGTTAAATATTATAATGGG - Intronic
924952392 1:248896965-248896987 GGGGAGGAAAATCTTTGAAGAGG - Intergenic
1063515776 10:6693646-6693668 GGGGAGTGAAATGTTTCACATGG - Intergenic
1064443338 10:15371976-15371998 AGGGAATGAAAAATTATAAGAGG + Intergenic
1066679104 10:37919214-37919236 GTGGAGTGAAATATTTAAAAGGG + Intergenic
1068568391 10:58600937-58600959 GGGGAGTGAAAAGTTGTACGTGG + Intronic
1069101429 10:64325723-64325745 GGGGAGTTAAAAATTATAAATGG - Intergenic
1069581690 10:69571025-69571047 GGGGAGTAAAATATGCTCAGGGG + Intergenic
1071036075 10:81247304-81247326 GGGGAGTGAAATGTTTTCTCCGG + Intergenic
1073010079 10:100352181-100352203 GGGGGGTGATATTTTTCAAGTGG + Intronic
1073719354 10:106149070-106149092 GGGAAGTGATATATTTGAAAAGG - Intergenic
1073905952 10:108279782-108279804 TGGGAGAAAGATATTTTAAGGGG + Intergenic
1074447841 10:113534846-113534868 GGGGATTAAAAAATATTAAGAGG + Intergenic
1074521824 10:114232642-114232664 GGGAAGTGAAATAATTTTATTGG - Intergenic
1078728602 11:13955453-13955475 GGGGGGTGACACATGTTAAGAGG - Intergenic
1080928045 11:36778637-36778659 GGCAAGAGAAATATTTTCAGTGG - Intergenic
1082633664 11:55570310-55570332 GGGGAGTAAAGTCTTTGAAGAGG - Intergenic
1083036653 11:59644053-59644075 GGGGAATAAAATATTTTTTGTGG + Intronic
1083985567 11:66212666-66212688 GAGGAGGTAAATATATTAAGGGG + Intronic
1090582801 11:128178474-128178496 TGGGAGTGATATCTGTTAAGAGG - Intergenic
1092840936 12:12540618-12540640 TGGGAGAGAAAAATTTCAAGTGG + Intronic
1094284049 12:28772556-28772578 GGGGAGTGAAAAATATAAGGAGG - Intergenic
1098740673 12:74170659-74170681 TGGGAGTGAAACTTTTTGAGAGG - Intergenic
1100215497 12:92443561-92443583 GGAAAATGAAATATTTTTAGAGG + Intergenic
1101303764 12:103506357-103506379 GCGGAGCTAAATTTTTTAAGAGG + Intergenic
1103684527 12:122721409-122721431 GGTGAGTGATAAATTTTAAGTGG - Intergenic
1104026812 12:125033537-125033559 GAGGACTTAAATATTTAAAGGGG - Intergenic
1105318861 13:19297624-19297646 GGGGAGTTAAATATTTAACCGGG + Intergenic
1107182112 13:37473058-37473080 TTGGAGTGAATTATTTCAAGAGG + Intergenic
1107919774 13:45193405-45193427 TGGTAATAAAATATTTTAAGGGG - Exonic
1109178325 13:59182741-59182763 GGCTACTGTAATATTTTAAGAGG + Intergenic
1109256338 13:60088082-60088104 GGGGAGTGCAACATGCTAAGAGG + Intronic
1109856217 13:68131372-68131394 GGGGAGTGAGGCATCTTAAGTGG + Intergenic
1110159799 13:72361844-72361866 GTGGAAAGACATATTTTAAGTGG - Intergenic
1111261414 13:85745621-85745643 GGGAAGAAAAATAGTTTAAGGGG - Intergenic
1111586299 13:90288399-90288421 GGGGAGGAAAATATTGTAAAAGG + Intergenic
1116069330 14:40023663-40023685 CGTTAGTGAAATATTTCAAGAGG - Intergenic
1116563764 14:46418615-46418637 GTGGAGAGAATTTTTTTAAGTGG + Intergenic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1116733501 14:48657393-48657415 GGGGAGTCAAATTTTAAAAGAGG + Intergenic
1117429651 14:55643267-55643289 GGGGAGAGAAATCTTATAATTGG - Intronic
1118832276 14:69445553-69445575 GGGGAGTGAAAAGTTGTATGTGG + Intronic
1120145596 14:80975459-80975481 TTGGAGTGAAATTTTTTTAGAGG - Intronic
1120562202 14:86009160-86009182 GGGGTCTGAAATATTTTACCTGG - Intergenic
1120703089 14:87719910-87719932 GGGGAGGGAAATATTTTCAATGG - Intergenic
1124425299 15:29558121-29558143 GGGGAGGGGAGTATTTTATGAGG - Intronic
1125317272 15:38444496-38444518 GGGGAGAAAAATCTTTTAAGGGG + Intergenic
1125336316 15:38630033-38630055 GGTTAATGATATATTTTAAGAGG + Intergenic
1127590562 15:60418231-60418253 TGGGGGTGAAATATGATAAGTGG - Intergenic
1128226559 15:66005679-66005701 GGGCAGTGACATATCTTAGGTGG + Intronic
1128865746 15:71114461-71114483 GGGGTGACAAATATTTGAAGAGG - Intronic
1130046468 15:80449481-80449503 GGGGAGAGAATTACTTTAAGAGG + Intronic
1130207631 15:81892252-81892274 GGGGAGTCAAAAGTTGTAAGTGG - Intergenic
1132770184 16:1557829-1557851 GAGGAGTCAAATATTTCAACAGG + Intronic
1133434605 16:5768426-5768448 GGGGAAACAAGTATTTTAAGGGG - Intergenic
1135760727 16:25136126-25136148 GGTGAGTGAAACCCTTTAAGGGG + Intronic
1135810048 16:25578753-25578775 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1136192972 16:28629403-28629425 GCGGAGTGAAACACTTTAAATGG + Intergenic
1136638821 16:31544462-31544484 GGGGAGGAAAATCTTTGAAGAGG - Intergenic
1137062196 16:35801024-35801046 GGGGAGTGAACTATTTTTGTGGG - Intergenic
1138439251 16:57024446-57024468 AGGTAGTGAACTATTTTGAGCGG - Intronic
1138743689 16:59338772-59338794 GGGGACTTCAATATTTAAAGGGG - Intergenic
1140253108 16:73312050-73312072 GGTGTGTGACGTATTTTAAGGGG + Intergenic
1142428867 16:90015473-90015495 GGGGAGTGAAAAGTTCTATGTGG + Intronic
1143826682 17:9614454-9614476 GGCAAGAGAAATATTTTGAGAGG - Intronic
1151332221 17:73417095-73417117 GGGGAGTCAAAAATTATATGTGG + Intronic
1152991549 18:367967-367989 GGGGAGAGAAATATTTTCATGGG + Intronic
1153413446 18:4819481-4819503 GGGTAGGAAAATATTTTAATTGG - Intergenic
1155356771 18:24960882-24960904 TGGAAGTGGAATATTTTGAGGGG + Intergenic
1157267154 18:46235551-46235573 GAGGAGTGAAATAGTTTACCAGG + Intronic
1158725914 18:59971747-59971769 GGGGATCAAATTATTTTAAGAGG + Intergenic
1158732430 18:60038745-60038767 AGGGAGTAAAATATGTTATGAGG - Intergenic
1163002080 19:14374903-14374925 GGGGTGTGCAATTTTTTGAGGGG - Intergenic
1164887889 19:31798785-31798807 TTGGAGTGAAATATTTAAATGGG - Intergenic
1166512808 19:43421244-43421266 GGGGACTTCAATATTTAAAGTGG - Intergenic
1167678999 19:50908043-50908065 GGGGAGTCAAAAGTTATAAGAGG + Intronic
925063386 2:910595-910617 AGGGAGTGAAATATTAGCAGAGG + Intergenic
928852295 2:35763554-35763576 GTTGAGTGAAATAGTTAAAGAGG + Intergenic
931180441 2:59894368-59894390 GGGTAATGTAGTATTTTAAGTGG + Intergenic
931884269 2:66598977-66598999 GGGGTGTGAAATATTTTTCAAGG - Intergenic
934069115 2:88367319-88367341 GGGGTTTGAACTATCTTAAGGGG + Intergenic
934783780 2:96989887-96989909 GGGGAATGATTTCTTTTAAGAGG + Intronic
935714134 2:105925022-105925044 GGGGAGTGAAAAGTTTTACTGGG - Intergenic
937712453 2:124993946-124993968 GGGCAGGGAAATATATTCAGAGG + Intergenic
937902563 2:127032260-127032282 GGGGAGATAAATATTTGAACGGG + Intergenic
937949626 2:127373995-127374017 GGGGATTGAACTATTTTAGTAGG - Intronic
938590983 2:132735933-132735955 GGAAAGTAAAATAATTTAAGGGG - Intronic
939440243 2:142239285-142239307 TGGGAGTGAGATATTTTTTGAGG - Intergenic
939821165 2:146958654-146958676 GGTTAGTAAAATATTTTGAGAGG + Intergenic
940556204 2:155232015-155232037 GGGAAGTGAAATAAATAAAGAGG - Intergenic
941130531 2:161644129-161644151 AGTGAGTTAAATATCTTAAGTGG + Intronic
941722671 2:168828257-168828279 AGGGAATCAAATATTTAAAGTGG + Intronic
941844059 2:170116128-170116150 GGGGATTGAACTATTTTAGTAGG - Intergenic
942093445 2:172516099-172516121 GGGGAGTGAACTATTTTTGTAGG - Intergenic
942238349 2:173934927-173934949 TGGGAATTAAATACTTTAAGTGG + Intronic
943807220 2:192137259-192137281 GTGAAGTGAAAGATTTTAACAGG + Intronic
943862633 2:192888522-192888544 GGGTAGTAAATTATTTTCAGGGG + Intergenic
944351599 2:198734110-198734132 AGGGAGTAAAGAATTTTAAGAGG + Intergenic
945266521 2:207896490-207896512 AGGGATTGGAATATTTTCAGAGG + Intronic
946127977 2:217581097-217581119 GGGCATTGAAAGGTTTTAAGTGG + Intronic
946203219 2:218083805-218083827 GGGGTGTGCATTATTTTCAGGGG - Intronic
946915263 2:224513211-224513233 GGGGAGTCAAAAGTTTTATGTGG + Intronic
947556116 2:231094712-231094734 GGGGAGTGAACTACTTTTATAGG + Intronic
1169666825 20:8047013-8047035 GGGGATTTCAATATTTAAAGGGG - Intergenic
1171418158 20:24997729-24997751 GGGGAGTCAAATGTTATATGTGG + Intergenic
1172443780 20:34982638-34982660 GGGGAGTAAAATTTTTAAAAAGG - Intronic
1172691266 20:36792015-36792037 GGGGTGTGAAAGATTCTCAGAGG + Intronic
1173316057 20:41944627-41944649 GGGGAGAGATATTTTTTAAAAGG - Intergenic
1174252736 20:49231572-49231594 GGGGAGAGAAATGCTGTAAGGGG + Intronic
1174733821 20:52944819-52944841 GGGGAGTCAAAAATTATATGTGG - Intergenic
1175472713 20:59243195-59243217 AGTGATTGAAATATTTTAACTGG + Intronic
1177501628 21:21964260-21964282 TGGGAGTGCAATATTCTGAGAGG - Intergenic
1178024837 21:28454376-28454398 GGGGAGAGGATAATTTTAAGTGG - Intergenic
1178427459 21:32490494-32490516 GGGGAGAGAACCATTTGAAGGGG + Intronic
1180673132 22:17568976-17568998 GGGGAGGAAAGTCTTTTAAGAGG + Intronic
1180939842 22:19652776-19652798 GGGGAGTCAAAAATTATATGCGG - Intergenic
1181617729 22:24066055-24066077 AGGGAGTGAAAGGTTTTAAATGG + Intronic
1183071208 22:35397675-35397697 GGGAAGTGAAATATTACAAAAGG + Intergenic
949093001 3:51355-51377 GGGGAGGAAAATCTTTGAAGAGG - Intergenic
949323424 3:2837627-2837649 GGGGAGTGCATTATGCTAAGAGG + Intronic
949365720 3:3278445-3278467 GGGGACTTCAATATTTGAAGGGG - Intergenic
949427404 3:3933630-3933652 GGGGAGTGAAATATTTTAAGTGG + Intronic
949606601 3:5660398-5660420 GAGGATTGTAATTTTTTAAGTGG + Intergenic
951072056 3:18340986-18341008 GGGGAGTCAAAAGTTGTAAGTGG + Intronic
951446379 3:22785021-22785043 GTGGAGTAAAATATTTAAAGTGG + Intergenic
951728779 3:25787552-25787574 GGTAAGTTAAATATTTTAAGTGG + Intronic
952058215 3:29474742-29474764 GGTGAGTGAAATATTTATAGAGG + Intronic
952850034 3:37720289-37720311 CGGGAGTCAAATGTTTGAAGGGG - Intronic
953279215 3:41536467-41536489 GGGGAGTCAAAAGTTGTAAGTGG - Intronic
955789347 3:62572343-62572365 GGGGACTGAAATAGTGGAAGTGG - Intronic
956057754 3:65318500-65318522 TGAGCATGAAATATTTTAAGTGG - Intergenic
956691085 3:71878001-71878023 GGGGAGCGAGTTATTGTAAGAGG - Intergenic
957101931 3:75838460-75838482 GGAGAGACAAATATGTTAAGGGG - Intergenic
961470793 3:127110283-127110305 TGGGAATGAACTATTTCAAGCGG + Intergenic
962005907 3:131349575-131349597 GGGGACAGAAGTATTTGAAGAGG + Exonic
963868835 3:150391696-150391718 GTGGAGAGAAATATATTGAGAGG - Intergenic
964113462 3:153111131-153111153 GGAGAGTCAAAAATTTTATGTGG + Intergenic
964411533 3:156403094-156403116 TTTGAATGAAATATTTTAAGTGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965357015 3:167688216-167688238 GGGGAGAGGAATATTTTCTGAGG - Intronic
966133614 3:176672988-176673010 AGGGAGTGAAAAATGTAAAGAGG + Intergenic
966462115 3:180188224-180188246 GGAGAGAGAAATATTTCTAGTGG - Intergenic
967682724 3:192383749-192383771 GAGGAGGGAAATATTAGAAGAGG + Intronic
968797310 4:2716083-2716105 GGGAAGTGGAATATTTCAAAAGG + Exonic
970669081 4:18375540-18375562 AGGCAGAAAAATATTTTAAGGGG - Intergenic
970716641 4:18934311-18934333 TGGGAATGAAATATTTCACGTGG + Intergenic
970883982 4:20965463-20965485 ATGGAGGGAAATTTTTTAAGTGG - Intronic
970944069 4:21669551-21669573 GGGGAGTCAAAAGTTTTATGTGG + Intronic
971520984 4:27550243-27550265 GGAGAATTAAATATTTTAAATGG - Intergenic
974604633 4:64135522-64135544 ATGGAGTGAAAATTTTTAAGAGG + Intergenic
975954443 4:79820962-79820984 GGGGAGAGAAATATGTCAAGAGG - Intergenic
976958745 4:90939993-90940015 GGGGAGTGCTTTAATTTAAGGGG - Intronic
977978877 4:103299226-103299248 GGGAAGTGAAATATCTTTACAGG - Intergenic
978010784 4:103681071-103681093 GTTGAGTGTAATATTTTAAAAGG - Intronic
978111098 4:104964539-104964561 GGTGAGTGAGAGATTTTCAGTGG - Intergenic
980547464 4:134286498-134286520 GATGACTGTAATATTTTAAGTGG - Intergenic
982175092 4:152698497-152698519 GGGGAGAGAAATGTGCTAAGGGG - Intronic
982521687 4:156425272-156425294 GGGGAGTCAAAAATTATATGTGG + Intergenic
983752105 4:171287115-171287137 AGGGAGTGTAATATTTTCATTGG + Intergenic
985021729 4:185698558-185698580 GGGTACTGTAATATTTTAAAGGG - Intronic
986898570 5:12402587-12402609 GGATAGTTAAATATTTAAAGTGG - Intergenic
987296081 5:16552674-16552696 GGGGAGTGAAAAAAATTAACAGG - Intronic
989028252 5:37090590-37090612 GGGGAGTGAACTATTTTTGTGGG - Intergenic
994132341 5:96244790-96244812 GTGGTGTGAAAATTTTTAAGTGG + Intergenic
995665632 5:114539049-114539071 AGGGAATGAAATTATTTAAGAGG - Intergenic
995779595 5:115761544-115761566 AGGAGGTGAAATCTTTTAAGAGG - Intergenic
996400965 5:123061942-123061964 TGTGAGTGAAATGTTTTAAAAGG + Intergenic
996431516 5:123384541-123384563 TAGGAGTAAAATATTTTAAGTGG + Intronic
997915457 5:137920414-137920436 AAGGTTTGAAATATTTTAAGTGG + Intronic
998194792 5:140059048-140059070 GGGGAGTCAAAAATTATACGTGG + Intergenic
998711740 5:144833714-144833736 GGGGACTGAAATATGTGAATAGG - Intergenic
1000243431 5:159429419-159429441 GGGGAGTGAGGTATTTCATGGGG + Intergenic
1000402319 5:160843301-160843323 GTTTAGTGAAATATTTTTAGTGG + Intronic
1000942753 5:167382593-167382615 GGGGACTGAAATATTTGAGTAGG + Intronic
1002858910 6:1062474-1062496 GGGGAGTCAAAAATTGTATGTGG + Intergenic
1003255771 6:4473665-4473687 GGGGAGTGTGATATTATGAGTGG + Intergenic
1004525796 6:16406492-16406514 GGGGAGGAAAATCTTTGAAGAGG - Intronic
1004769901 6:18770010-18770032 GTGAAGGGGAATATTTTAAGGGG + Intergenic
1005186152 6:23165035-23165057 GGGGAGTGAACTATTTTTGTAGG - Intergenic
1005425349 6:25697382-25697404 TGGTAGAGAATTATTTTAAGTGG + Intronic
1005507775 6:26484893-26484915 GAGGAGTGAAATATATACAGAGG + Intergenic
1006001616 6:30969526-30969548 GTGGAGGGAAATATTCTCAGTGG + Intergenic
1008048220 6:46873297-46873319 CGGGAGTGAAAAATTGGAAGTGG - Intronic
1008329920 6:50232480-50232502 TGGGAGTGAGGTATTTAAAGAGG - Intergenic
1009442665 6:63700299-63700321 GGGGAGACAAACATTTTGAGTGG - Intronic
1009491876 6:64301758-64301780 GGGGAGTGAACTATTTTTGTAGG - Intronic
1009534929 6:64869810-64869832 GGGCATTCAATTATTTTAAGTGG + Intronic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1010535295 6:77020469-77020491 GGGGAGTTGAAGAGTTTAAGAGG + Intergenic
1010864533 6:80958531-80958553 GGGGCGTGAAAAATCTTCAGGGG + Intergenic
1011046205 6:83086150-83086172 GGGGAGTCAAAAATTATACGTGG - Intronic
1012588269 6:100948957-100948979 GGGGAGTGAAGTATTTTTGTAGG - Intergenic
1012823344 6:104116759-104116781 GAGGAGTGTATTATTGTAAGAGG + Intergenic
1013914532 6:115319562-115319584 GGGGAGTTAATTTTTTTAAAAGG - Intergenic
1013951100 6:115782795-115782817 AGGGAGTGGAATGTTTTCAGAGG - Intergenic
1016243481 6:141957806-141957828 GGGGATTGAAAGCATTTAAGAGG - Intergenic
1016925137 6:149337722-149337744 ATTGAGTGAAATATTTAAAGTGG + Intronic
1018925191 6:168201024-168201046 GGGGACTTCAATATTTAAAGTGG + Intergenic
1021064403 7:16155751-16155773 GGGGAGTCCAAAATTTTATGTGG + Intronic
1021305041 7:19022087-19022109 GGGGAGTGAAATTCTTCTAGTGG - Intronic
1021678992 7:23110539-23110561 GGGGAGAGAAGTATTTAGAGGGG - Intronic
1021725562 7:23544944-23544966 GGTGAATGAACTATTTAAAGAGG - Intergenic
1021996760 7:26186127-26186149 GGGGATCAAATTATTTTAAGAGG + Exonic
1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG + Intronic
1027958512 7:84913661-84913683 GGAAAATAAAATATTTTAAGAGG - Intergenic
1029642106 7:101827605-101827627 GGGGAATGAAAAGTTTTATGTGG - Intronic
1030274114 7:107701219-107701241 GGGAAAGGAAATAATTTAAGGGG - Intronic
1031537388 7:122952117-122952139 GGGGAGTTAAAAATTATATGTGG - Intergenic
1034602421 7:152273531-152273553 GGGGAGGGAAATGTTATCAGTGG - Intronic
1035090717 7:156307776-156307798 GGAGAGGGTAATATTTTCAGAGG - Intergenic
1039902706 8:41764853-41764875 AGGGAGTGAATTAATTTATGTGG - Intronic
1040861243 8:52001483-52001505 GGGAAGTGAAATTTTGTGAGAGG + Intergenic
1041078732 8:54193435-54193457 GGGGAGTCAAATGTTGTATGTGG + Intergenic
1041168853 8:55119797-55119819 GTGGAGTGAAAGCATTTAAGTGG + Intronic
1041312449 8:56530568-56530590 CTGGAGTAAAATATTTTAACTGG + Intergenic
1041402330 8:57458971-57458993 GGGGAGTGAACTATTTTTTGTGG - Intergenic
1043188878 8:77191447-77191469 TGGTATTGAATTATTTTAAGTGG - Intergenic
1043337794 8:79198675-79198697 GGGGAGTCAAAAGTTTTATGTGG + Intergenic
1043538227 8:81229684-81229706 GAGGAGTGACATAATTTAAGAGG - Intergenic
1043958759 8:86390970-86390992 GGGGAGTGATTTATTTGAATAGG + Intronic
1044137912 8:88610316-88610338 GGGGAGTGAACTATTTTTGTAGG + Intergenic
1044755147 8:95453801-95453823 AATGAGGGAAATATTTTAAGAGG - Intergenic
1045617676 8:103937671-103937693 GGGGAGTGAAATTCCTGAAGAGG + Intronic
1045896589 8:107225977-107225999 GGGGACAGAAATATTTCATGAGG - Intergenic
1050386787 9:5099289-5099311 AGGTTTTGAAATATTTTAAGAGG - Intronic
1050925467 9:11258031-11258053 GGGGATTGAACTATTTTAGTAGG + Intergenic
1052350380 9:27452467-27452489 GGGGAATGAAAAATTCTGAGTGG + Intronic
1052442025 9:28510244-28510266 TGGGAGTGAAAAGTTTTATGTGG - Intronic
1055448896 9:76412566-76412588 GTGAAGTGAAATATTTAAAGTGG - Intergenic
1055652597 9:78421268-78421290 TGGAAGTGAAATATTTTGTGGGG + Intergenic
1059531022 9:115035859-115035881 GGGAAGGAAAAGATTTTAAGAGG - Intronic
1185513958 X:684520-684542 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1186311266 X:8322417-8322439 GGGGAGTCAAAAATTATAAATGG - Intergenic
1188158328 X:26769568-26769590 GTGGTGTGAGATTTTTTAAGGGG + Intergenic
1188255044 X:27951796-27951818 GGGGAAGGAAATATTTCAACTGG - Intergenic
1188300636 X:28503077-28503099 GGGCAGTGAAAATTTTTAGGGGG + Intergenic
1188908357 X:35815257-35815279 GAGGACTGAAATATTTTTTGTGG - Intergenic
1192058195 X:67794806-67794828 GTGGAGAGGAGTATTTTAAGTGG + Intergenic
1192717764 X:73661895-73661917 GGGGAGTGAAATATTTTTGTAGG + Intronic
1193168909 X:78314084-78314106 GGTGAGAGAATTATTTGAAGAGG + Intronic
1194393508 X:93350064-93350086 GTGGAGTGAAATATTTAAAGTGG - Intergenic
1195242189 X:102963164-102963186 GGGAAGTGAAGAATTTTAACAGG + Intergenic
1197450038 X:126601085-126601107 GGGGAGTGGAATGTGGTAAGGGG + Intergenic
1197507040 X:127318729-127318751 GGGAAGTAAATTATTTTTAGAGG + Intergenic
1201054744 Y:9977450-9977472 GGGGAGTAAATTATTTTTATAGG - Intergenic
1201937897 Y:19427160-19427182 GGGGAGTGAAAATTTTTTGGGGG - Intergenic
1202053230 Y:20802844-20802866 GGGGATTGAAATATTTTTGTAGG - Intergenic
1202063392 Y:20911912-20911934 GGGGACTGGAATAGATTAAGTGG - Intergenic