ID: 949437250

View in Genome Browser
Species Human (GRCh38)
Location 3:4042920-4042942
Sequence GAGAGAATAAGCAGCACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949437250_949437254 22 Left 949437250 3:4042920-4042942 CCACCAGTGCTGCTTATTCTCTC 0: 1
1: 0
2: 1
3: 20
4: 257
Right 949437254 3:4042965-4042987 ACTGCCCTTCTCCACATCACAGG 0: 1
1: 0
2: 1
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949437250 Original CRISPR GAGAGAATAAGCAGCACTGG TGG (reversed) Intronic
901447701 1:9318294-9318316 GAGAGAACAACCAGCAAGGGAGG - Intronic
902546814 1:17195409-17195431 GAGAGAGGAAGTGGCACTGGGGG - Intergenic
902910853 1:19596399-19596421 CAGAGAAAAGGCAGCCCTGGAGG + Intergenic
903915478 1:26761043-26761065 GCGAGACTGAGCAACACTGGCGG - Exonic
904249497 1:29212906-29212928 GAGAGAAGGCACAGCACTGGTGG - Intronic
906602227 1:47139961-47139983 GTGTGAATCAGCAGCAGTGGTGG + Intronic
906744672 1:48213456-48213478 GGGAGAAGAAGGAGGACTGGAGG + Intergenic
908416096 1:63914793-63914815 GAGAGATGAAGCAGAAATGGGGG - Intronic
910830443 1:91455796-91455818 AAGAGCAGAAGCAGCAGTGGTGG - Intergenic
912360541 1:109091072-109091094 GTGAGCATAAGAGGCACTGGGGG - Intronic
913002402 1:114594126-114594148 AAGAGGATAAGGAGCACTAGAGG + Intronic
913462482 1:119102481-119102503 GATAGAATTAGTAGCACTGCGGG - Intronic
913473881 1:119218034-119218056 GAGAAAATAAACAGGACTGTGGG - Intergenic
914451306 1:147794537-147794559 CAGATCATAAGCAGCCCTGGAGG + Intergenic
914829469 1:151160143-151160165 CTGAGAAAAAGCAGCACTGTAGG - Exonic
915083010 1:153364952-153364974 GGGCGAATGAGGAGCACTGGGGG + Intergenic
915331698 1:155116703-155116725 GAGGGAAGAAGGAGCTCTGGGGG + Intergenic
916946957 1:169738646-169738668 CAGAGATTAAATAGCACTGGTGG - Intronic
917109369 1:171529417-171529439 GACAGGAGAAGCAGCACTGTGGG - Intronic
917156365 1:172003894-172003916 GAGAAAGTGGGCAGCACTGGGGG + Intronic
917224336 1:172765537-172765559 CAGTGGACAAGCAGCACTGGAGG - Intergenic
917737645 1:177935050-177935072 CAGAGAAACAGCAGGACTGGAGG - Intronic
918346972 1:183614916-183614938 GAGAGAAGAAGGAGGAATGGAGG - Intergenic
919626126 1:199912008-199912030 GAGAAATTACACAGCACTGGGGG - Intergenic
919812622 1:201418715-201418737 GAGAGAATAAGCCGCAAGGCAGG + Intronic
919983318 1:202656086-202656108 GAGTGAGCATGCAGCACTGGGGG + Intronic
920800772 1:209185441-209185463 GGGAGAAAAAGCAGCAGGGGTGG + Intergenic
924749909 1:246876896-246876918 AAGAGAATAAGGAAAACTGGAGG - Intronic
1063246112 10:4220587-4220609 CAGAGAATCAGAAGCAATGGGGG - Intergenic
1064447560 10:15409097-15409119 ATGAGAATGAGAAGCACTGGGGG + Intergenic
1064824431 10:19380352-19380374 GAGAGAATAAGCGGAACTCATGG - Intronic
1065668385 10:28087181-28087203 GAGAGAGGAAGCAGGAGTGGTGG - Intronic
1065870653 10:29953308-29953330 GGGAGCATAAGCAGAACTGAGGG + Intergenic
1066314114 10:34226563-34226585 CAGACAATAAGTAGTACTGGTGG + Intronic
1068332715 10:55592317-55592339 GAGAGAAGAACAAGAACTGGAGG + Intronic
1070681285 10:78451167-78451189 GAGAGAATAAGCAGGGCCAGGGG + Intergenic
1070695298 10:78558714-78558736 TAGAGAATCAGAAGCTCTGGGGG + Intergenic
1073480152 10:103781336-103781358 GAGAGAATATGAAGGACTGCAGG - Intronic
1074965159 10:118484199-118484221 GAGAAAAAAACCAGCATTGGAGG - Intergenic
1075612636 10:123865831-123865853 GAGAGAAGAAGCAGAGATGGAGG - Intronic
1076033979 10:127183539-127183561 GAGAAAATAACCTGCACTTGGGG + Intronic
1076716398 10:132366410-132366432 GAGTGAATAAACAGCACTGGCGG - Intronic
1077985370 11:7346327-7346349 GAGAGGATGAGCAGCAGAGGGGG + Intronic
1078762131 11:14259885-14259907 GAGAGAGTAACCTCCACTGGGGG + Intronic
1081693956 11:45096615-45096637 GAGAGAATAAGCTGAATGGGAGG - Intronic
1082712206 11:56566691-56566713 AGGAGAACAAGCAACACTGGGGG - Intergenic
1082793106 11:57360919-57360941 GAGAGAAAAGGCAGCCCTGGGGG + Intronic
1085093075 11:73735868-73735890 GAGAGAATAAGCAGTATTTGAGG + Intronic
1085686828 11:78631169-78631191 AAGAGAATCAGCTGCCCTGGTGG - Intergenic
1086060888 11:82698823-82698845 TAGTGAATGAGAAGCACTGGAGG - Intergenic
1088166679 11:106946547-106946569 AAGAAAAAAAGCAGCAATGGAGG + Intronic
1089195152 11:116689936-116689958 AAGTGAATAAGCACCTCTGGGGG + Intergenic
1089271860 11:117307035-117307057 GAGGAAATCAGCAGAACTGGGGG - Intronic
1089451839 11:118603926-118603948 AAGAAAGTAAGCAGCTCTGGCGG - Intergenic
1091618751 12:2069457-2069479 GAGAAAATAAGAAGCAGAGGAGG + Intronic
1093401881 12:18755429-18755451 GAGAGAGTATGGAGCTCTGGTGG + Intergenic
1093751031 12:22800334-22800356 AAGAGAGTGAGCAGCACTGGGGG - Intergenic
1096510821 12:52127198-52127220 GAGGGAAGAAGCAGACCTGGTGG + Intergenic
1097503042 12:60430634-60430656 GACAGAAAAAACAGCTCTGGAGG - Intergenic
1097900904 12:64873068-64873090 GATAGGATTAGCAGCACAGGTGG + Intronic
1098786606 12:74766076-74766098 GAGGGAATAAGAAGCAATGAGGG - Intergenic
1100049672 12:90432471-90432493 GAGAGAATATGCTGGACTGGAGG - Intergenic
1101030900 12:100658746-100658768 GAGAGAATATCCAACAATGGTGG - Intergenic
1101747389 12:107553496-107553518 GACAGAATATGCACCACCGGGGG + Intronic
1102855282 12:116288311-116288333 GAGAGTATCTGAAGCACTGGGGG - Intergenic
1104656792 12:130579612-130579634 GAGAGAATCAGCAAACCTGGAGG + Intronic
1105038117 12:132941246-132941268 GAGAGCAGAAGCAGCACACGCGG - Intronic
1106079837 13:26490916-26490938 AAGAGAATAAACAGCACCAGTGG - Intergenic
1106730048 13:32531961-32531983 GAGAGAAGATGCTGCACTGCTGG - Intronic
1107286871 13:38802864-38802886 GAGGGAATATGGAGCCCTGGGGG + Intronic
1107756524 13:43629315-43629337 GAGAGAGTAGGCTTCACTGGGGG + Intronic
1108059224 13:46515848-46515870 GAAAGAATGAGCAGGACTGTGGG - Intergenic
1109013543 13:56979717-56979739 GAGAGATTAAAGAGCACAGGTGG - Intergenic
1109845502 13:67984664-67984686 GAGAGAATAAATAGCATTTGTGG - Intergenic
1109872493 13:68352209-68352231 GAGAGAATGAGAATCACTGAGGG - Intergenic
1110080708 13:71307057-71307079 GTGATAATAAGCAGAACTGAAGG - Intergenic
1110927642 13:81175214-81175236 AAGAGAAAAAGCAGAAATGGAGG - Intergenic
1111126180 13:83912709-83912731 GGGAGAATAAGGAGGAATGGAGG + Intergenic
1114260369 14:21032219-21032241 GGGAGAAGAGGCAGCACAGGAGG + Intronic
1114453899 14:22843446-22843468 GAGGGAACAAGCAGCAGAGGAGG - Intronic
1114638306 14:24201464-24201486 GAGAGAATGAGAAGAACAGGAGG - Intronic
1119998704 14:79279570-79279592 AAGAGAATAAGAAGGACTGGAGG - Intronic
1120520589 14:85523356-85523378 GAGAGAATAAGATGCACAGTAGG + Intergenic
1121792458 14:96709405-96709427 GGCAGGATTAGCAGCACTGGTGG + Intergenic
1121801930 14:96781716-96781738 GAGAGAATATGTAGCCGTGGAGG + Intergenic
1121908429 14:97768213-97768235 GAGAAAATCAGCAGCAATGAAGG - Intergenic
1122391852 14:101394809-101394831 GTGAGCATAAGCAGCCCAGGAGG + Intergenic
1123428947 15:20197898-20197920 GAGAGAACTAGCAGAACTGAAGG - Intergenic
1126744763 15:51814819-51814841 GAGAGAAACAGCTGCAGTGGAGG - Exonic
1126843606 15:52739860-52739882 GAGAGAAGAAGGAGGAATGGAGG - Intergenic
1127723080 15:61721762-61721784 GAGAGAAAAAACAGCAGTGAGGG + Intergenic
1127727318 15:61762659-61762681 GAGTCAATTAGCAGAACTGGAGG - Intergenic
1129080549 15:73035862-73035884 TAGACAATAGGCAACACTGGTGG + Intergenic
1129362696 15:75034175-75034197 GAGTGAGTTAGCAGAACTGGGGG + Intronic
1129726333 15:77903560-77903582 GACAGATTAAGGAGCACTGTTGG + Intergenic
1130304407 15:82703466-82703488 GAGAGAAGAAGGAGGAATGGAGG - Intronic
1130466723 15:84196293-84196315 GACAGATTAAGGAGCACTGTTGG + Intergenic
1130497541 15:84477243-84477265 GACAGATTAAGGAGCACTGTTGG - Intergenic
1130844291 15:87730117-87730139 GATAAAATAAACAGGACTGGAGG + Intergenic
1130876695 15:88020814-88020836 GAGAGAATGAGCTGAACTAGGGG - Intronic
1131116619 15:89799949-89799971 GAAAGAGACAGCAGCACTGGGGG - Intronic
1134629231 16:15745073-15745095 GAGTGAAGAAGCAGGGCTGGGGG + Intronic
1136046968 16:27622739-27622761 GAGAGAACCAGCATCACTGGGGG + Intronic
1136047193 16:27624092-27624114 GAGAGAACCAGCATCACTGGGGG - Intronic
1136855373 16:33651842-33651864 GAGAGAACTAGCAGAACTGAAGG + Intergenic
1137295597 16:47090017-47090039 GAGGTAATAAACAGCACTGTGGG + Intronic
1138158694 16:54731783-54731805 GAGAGCAAAAGGAGGACTGGAGG - Intergenic
1138739857 16:59295494-59295516 GAGAGAAAAGGCAGAGCTGGTGG + Intergenic
1139290505 16:65854100-65854122 GAGAGAAAAAGCTGAACTGAGGG + Intergenic
1140590044 16:76340882-76340904 GGGAAAATTAGCACCACTGGAGG - Intronic
1142254599 16:89007574-89007596 GAGAGAAAGTACAGCACTGGAGG - Intergenic
1203116959 16_KI270728v1_random:1500323-1500345 GAGAGAACTAGCAGAACTGAAGG + Intergenic
1143149210 17:4797011-4797033 ATGAGAATAAGCAATACTGGAGG + Intronic
1145209032 17:20999627-20999649 GAGAGACTACAAAGCACTGGGGG + Exonic
1146302076 17:31697286-31697308 GAGGGCAGAAGCAGCACTGCTGG - Intergenic
1146978246 17:37134937-37134959 GAAAGAATAAGCAGGAGTAGAGG + Intronic
1148211917 17:45813786-45813808 GAGAGAATTAGCACCCATGGTGG + Intronic
1150204390 17:63391079-63391101 GAGAGAATGAGCAACACCGTGGG - Intronic
1150716649 17:67577954-67577976 CAGAGAATAACCAGCAGTAGAGG - Intronic
1151121891 17:71801831-71801853 GAGAGAACAAGCATCACAAGAGG + Intergenic
1151216389 17:72579663-72579685 GAGAGAAGAGGCAGAGCTGGAGG + Intergenic
1154992829 18:21612450-21612472 GAGTGACCAAGCAGCTCTGGGGG + Intronic
1156872885 18:41967911-41967933 GAGAGAAGAAACAGCACAGCAGG - Intronic
1157395545 18:47337976-47337998 GAGAGAAAAAGAAGCACTAGAGG + Intergenic
1157560582 18:48642846-48642868 CAGAGAAAAAGGAGCTCTGGAGG + Intronic
1157906548 18:51574512-51574534 GGGAGAAGAAGCAGGAATGGAGG + Intergenic
1158776774 18:60592205-60592227 GAGAGAAAAAGATGCAATGGAGG + Intergenic
1159147489 18:64472852-64472874 AGAAGAATAAGCAGAACTGGAGG + Intergenic
1160173428 18:76573080-76573102 GAGTGAATCAGCAGGGCTGGGGG + Intergenic
1165547172 19:36549640-36549662 GAGGGAATAAGCAATAGTGGTGG - Intronic
1166131877 19:40750564-40750586 GACAGAAAACGCAGCTCTGGCGG + Intronic
1166399348 19:42466650-42466672 GACAGAAAAAGCAGCATTCGGGG - Intergenic
1167503537 19:49860197-49860219 GGGAGACTGAGCAGCCCTGGAGG - Intronic
1168427660 19:56252241-56252263 GAGAGAAAAAGGAGAACTGATGG + Intronic
925639797 2:5976382-5976404 GAGGGAACAAGCTGCATTGGTGG + Intergenic
925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG + Intergenic
927972557 2:27315011-27315033 GAGAGACGAGGCAGGACTGGGGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
930176966 2:48311380-48311402 GAGAGGATGAGCAGGAATGGGGG - Intergenic
932338773 2:70946473-70946495 GACAGAATCAGAAGCTCTGGGGG + Intronic
933774793 2:85765488-85765510 GAGAGAGGAAGCGCCACTGGCGG + Intronic
937122238 2:119448901-119448923 GAGAGGAGCGGCAGCACTGGTGG - Intronic
938673362 2:133605501-133605523 GAGAGAATGAGCAGAGTTGGAGG + Intergenic
938923477 2:136017317-136017339 AAGAGAATAAGCAAGACTAGTGG - Intergenic
942711831 2:178845440-178845462 GAGAGAAGAAGCACCAATAGAGG + Intronic
943398838 2:187378153-187378175 AAGAGAAGGAGCAGCAGTGGCGG + Intronic
947745703 2:232506342-232506364 GAGAGAAGAAGCAGAAAGGGAGG + Intergenic
947912240 2:233809092-233809114 AAGAGAAAAAGAACCACTGGGGG - Intronic
947933405 2:233983132-233983154 GGCAGAATGAGCAGCGCTGGAGG + Exonic
948316941 2:237035186-237035208 CAGAGGAGAAGCAGCACAGGTGG + Intergenic
1172441146 20:34967566-34967588 GAAAGACCAAGCAGCAGTGGAGG - Intergenic
1172736730 20:37131903-37131925 GACAGAATCAGAATCACTGGAGG - Intronic
1173462470 20:43254300-43254322 GAAGGAAGAGGCAGCACTGGAGG - Intergenic
1173790766 20:45826543-45826565 GGGAGAAGGAGGAGCACTGGTGG - Intronic
1174250673 20:49217263-49217285 GAGAGAGAACGGAGCACTGGAGG - Intergenic
1176913528 21:14597637-14597659 AAGAGAATAACCAACAGTGGTGG + Intronic
1177100484 21:16893440-16893462 GAGAGAAGAAGCAGGAATGGAGG - Intergenic
1177273618 21:18878202-18878224 GAGTGAGTAAGCAACCCTGGGGG - Intergenic
1178001054 21:28162435-28162457 GAGAGAAGAAGGAGGAATGGAGG - Intergenic
1178619321 21:34160073-34160095 GAGAGAACCATCAGCAATGGAGG - Intergenic
1178639003 21:34330951-34330973 GGGAGAATGAACAGCTCTGGGGG - Intergenic
1178685056 21:34704083-34704105 GAGAGAGTTATCAGCACTGGGGG + Intronic
1179132911 21:38654752-38654774 GACAGAATAAGCAAAAGTGGAGG - Intronic
1180976645 22:19852282-19852304 GAGAGGAGAGCCAGCACTGGTGG + Exonic
1181144285 22:20833244-20833266 TTGAGAACATGCAGCACTGGAGG + Intronic
1183608561 22:38882143-38882165 CAGGGAACAAGCAGCACAGGGGG - Intergenic
949437250 3:4042920-4042942 GAGAGAATAAGCAGCACTGGTGG - Intronic
949476495 3:4451530-4451552 GATAGAATAAGCAGAATTTGGGG - Intronic
949614305 3:5737077-5737099 GAAAGAATGAGTAGAACTGGAGG + Intergenic
949656352 3:6225405-6225427 GAGAAAACCAGCAGCTCTGGAGG - Intergenic
950643740 3:14364909-14364931 GAGGGAATGAGCACCAGTGGGGG - Intergenic
950767491 3:15284042-15284064 GAGAGAAGAAGCACCAATGCAGG + Intronic
953450889 3:43005032-43005054 GAGAGAAGATGCTGCACTGGTGG - Intronic
953496744 3:43393983-43394005 GAGAGAATGAACACCCCTGGGGG + Intronic
954215473 3:49122030-49122052 GACAGTACAGGCAGCACTGGAGG - Exonic
956480247 3:69665990-69666012 AAGAGAAGAAGCAGAACTGAAGG + Intergenic
956724104 3:72142894-72142916 GAGAGAGTAGGCAACTCTGGTGG - Intergenic
956852038 3:73237756-73237778 CCGAGAATAAGGAGCACTGTAGG + Intergenic
956913922 3:73850922-73850944 GAGAAAAAAATCAGAACTGGGGG + Intergenic
957892363 3:86376956-86376978 GAGAGAAAGAGTAGCACTAGTGG + Intergenic
962668903 3:137685124-137685146 GAAAGAAAGAGCAGCAGTGGGGG - Intergenic
963077436 3:141360247-141360269 CAGATTATAAGCAGCACTGTGGG - Intronic
963288281 3:143459785-143459807 TAGAAAATATGCAGCACTGTGGG - Intronic
963431015 3:145202837-145202859 GAGAGATTGAGGAGCACTGAGGG + Intergenic
964176235 3:153828088-153828110 GAGAGAAGAAGGAGGAATGGAGG + Intergenic
966729508 3:183138822-183138844 GAGAGAATAAGCAGCAGGTGAGG - Intronic
966863250 3:184242147-184242169 GAGGGAGTAAGAAGCAGTGGGGG - Exonic
967309414 3:188091892-188091914 GAGAGAAAAGACAGCCCTGGAGG + Intergenic
967536967 3:190616399-190616421 CAGAGAATAAGCACCATTTGTGG + Intronic
968758395 4:2428360-2428382 GAGAGACGTAGCAGCACGGGTGG - Intronic
969097419 4:4744113-4744135 GGAAGAATGAGGAGCACTGGTGG + Intergenic
970840833 4:20466660-20466682 CAGATCATAAGCAGCAGTGGGGG + Intronic
972237155 4:37147515-37147537 GAGAGAATGAGTAGCAAAGGGGG - Intergenic
972974900 4:44622271-44622293 GAGAGACAAAGCAGCACTTAAGG - Intronic
973842950 4:54880941-54880963 TAGAGATCAAGCAGTACTGGAGG + Intergenic
974219136 4:58943790-58943812 TAGAGAATAATCAGCAGTAGAGG + Intergenic
974715714 4:65668299-65668321 GAAAGATGAAGCAGCAGTGGTGG - Intronic
975707413 4:77124920-77124942 GAGAGAATAAACAACAATGTAGG + Intergenic
976188973 4:82470987-82471009 GAGATAATTAAGAGCACTGGGGG - Intergenic
978693320 4:111543519-111543541 CAGAAAATATGCAGCACTGGAGG - Intergenic
980853323 4:138410423-138410445 CAGAGAATGAGAAGGACTGGTGG - Intergenic
982017959 4:151174645-151174667 GAGTGAAAAATCAGCAGTGGAGG - Intronic
982810850 4:159824303-159824325 CAGAGAGTCAGCAGCACTGGAGG - Intergenic
985028720 4:185767101-185767123 GAGAGAAAAACAAGCACGGGAGG - Intronic
985519681 5:367725-367747 GAGAGAACGAGCAGCAGAGGGGG - Intronic
987336396 5:16901348-16901370 GAGAGTAGAACCAGCACGGGTGG - Intronic
989274325 5:39569389-39569411 GAAAGAAGAGGCAGGACTGGTGG - Intergenic
990770204 5:59235318-59235340 GAGGGCATAAGAAGCACAGGAGG - Intronic
991046481 5:62228329-62228351 GAGAGAACTAGCAGAACTGAAGG - Intergenic
993291296 5:86074993-86075015 GTGAGAATAAGCAGAACTCATGG + Intergenic
996068280 5:119104988-119105010 GAGAGAATATCCATAACTGGTGG - Intronic
996509762 5:124305042-124305064 GGGAGAAGAAGGAGGACTGGAGG - Intergenic
996811604 5:127521719-127521741 GAAAGAAGAATCAGGACTGGAGG - Intronic
998127529 5:139634645-139634667 GGGAGAATAAGCAATTCTGGGGG - Intergenic
999056828 5:148587051-148587073 GAGACAATAGGGAGCAGTGGGGG - Intronic
999178909 5:149654759-149654781 GAGAGAATAAGCAGAAGAGACGG + Intergenic
999480319 5:151942214-151942236 GAGAGAATTATTAGGACTGGTGG - Intergenic
1001936668 5:175710380-175710402 AAGAGACTAAGCACCTCTGGGGG - Intergenic
1002136022 5:177108084-177108106 CAGAGGCTAAGAAGCACTGGAGG + Intergenic
1004253240 6:14040002-14040024 CAGAGAATGAACAGCACTGTTGG - Intergenic
1010710986 6:79174011-79174033 GAGATAATAAATAGCACTGGGGG + Intergenic
1011281622 6:85683723-85683745 CAGAGAAGAATCAGCACTAGAGG + Intergenic
1013851890 6:114526238-114526260 GAGGGAATAAGCAGACATGGAGG + Intergenic
1014155532 6:118104950-118104972 GAGTGAAGGAGCAGCTCTGGAGG - Intronic
1014833839 6:126134982-126135004 TACAGAAAAAGCAGCACTGAGGG + Intergenic
1016705326 6:147100433-147100455 AATAGAATAAGCACCACTGATGG + Intergenic
1017336840 6:153271207-153271229 GACAGAATAACCAGGAATGGTGG - Intergenic
1018702116 6:166435639-166435661 GTGAGAAACAGCAGCACTCGTGG - Intronic
1018754803 6:166839708-166839730 GAGAGGAGAGGCGGCACTGGAGG + Intronic
1020769597 7:12371888-12371910 GATACAATAAACATCACTGGGGG + Intronic
1020901904 7:14014258-14014280 GAGAGAATTAACATCTCTGGTGG - Intergenic
1021328896 7:19310085-19310107 CAGAGCATTAGCAGCATTGGAGG - Intergenic
1022450372 7:30508227-30508249 AAGAAAAAAAGCAGCACTGAGGG + Intronic
1027761520 7:82285084-82285106 CAGTGATTAAGCAGCACTGGGGG - Intronic
1028088782 7:86671657-86671679 GAGATAATCAAAAGCACTGGAGG - Intronic
1028634719 7:92975108-92975130 GAGAGACCAAGCAACACTGGGGG - Intergenic
1029818549 7:103122524-103122546 AAGAGAAGGAGCAGCACAGGTGG + Intronic
1030399653 7:109032277-109032299 GAAAGAACAACCAGCACTTGTGG - Intergenic
1030465869 7:109902703-109902725 GAGCAAAAAAGCAACACTGGAGG - Intergenic
1030469292 7:109942927-109942949 GAGAGAATAATCAGAATTGGAGG + Intergenic
1030561425 7:111091757-111091779 GAGAGAAAAAGCAGTGTTGGGGG + Intronic
1033422231 7:141213945-141213967 GAGACACTAAGCAGCACATGGGG + Intronic
1034763202 7:153693102-153693124 GAAAGAATAAGCAGGCCAGGTGG - Intergenic
1036636927 8:10557590-10557612 AAGAGAAGGAGCAGCCCTGGGGG - Intergenic
1039259348 8:35753651-35753673 GAGAGAGAAAGAATCACTGGAGG - Intronic
1040991425 8:53354241-53354263 GAGAGAAGACGCAGCATTGCTGG - Intergenic
1041566693 8:59286635-59286657 GGGAGAAGAAGTAGAACTGGAGG - Intergenic
1043718039 8:83509572-83509594 GGGAGAAGAAGCAGGAATGGAGG + Intergenic
1044097586 8:88087377-88087399 GTGAGAATAAGCAGGACAGTCGG - Intronic
1045899511 8:107260538-107260560 CAGAGAATAAGTAGTAGTGGTGG + Intronic
1047635299 8:126755318-126755340 TAGAGAAGAATCAGAACTGGAGG - Intergenic
1048410938 8:134171812-134171834 GAGTGAATAGGTCGCACTGGTGG - Intergenic
1048430691 8:134367739-134367761 CAGTGAATAAGCAGGGCTGGTGG + Intergenic
1048670764 8:136716835-136716857 CAGGGAACAAGAAGCACTGGAGG + Intergenic
1050189556 9:3010412-3010434 GAGAGAAAAAAAAGCACTGGGGG - Intergenic
1051874899 9:21781968-21781990 GAGAGATTAATCAGCATTTGGGG - Intergenic
1052279660 9:26718512-26718534 GAAAGAATATGCAACAGTGGTGG - Intergenic
1054963826 9:70999422-70999444 GAAATAATAAGCAGAATTGGTGG + Intronic
1055508259 9:76970285-76970307 GGGAGAAGAAGCATCAATGGAGG - Intergenic
1055961300 9:81822709-81822731 GAGAGAATGGGCAGTGCTGGTGG + Intergenic
1057086171 9:92212864-92212886 AAGAGAATAAGGAGCTTTGGGGG + Intronic
1057830389 9:98401822-98401844 GAGAGATTATGAAGCCCTGGAGG + Intronic
1059058870 9:111014317-111014339 GAGAGAAATGGCAGCACTGATGG - Intronic
1059743035 9:117171670-117171692 GAGAGAAGAAGGAGCAAAGGGGG - Intronic
1061117128 9:128620937-128620959 GTGAGAGTAACCAGCAGTGGTGG - Intronic
1061594326 9:131619183-131619205 GAAGGAAGAAGCAGCACAGGAGG + Intronic
1062344091 9:136106937-136106959 GATTGCAGAAGCAGCACTGGAGG - Intergenic
1189026833 X:37403978-37404000 GAGACAACAAGCATCACTGGAGG - Intronic
1189251699 X:39605311-39605333 GAGAAGATAGGCAGCCCTGGGGG - Intergenic
1190185465 X:48229898-48229920 TAGAGAAGAATCAGCACTGCAGG + Intronic
1192819862 X:74633652-74633674 GAGAGAACAAGCAGAAGAGGAGG - Intergenic
1193312132 X:80022405-80022427 GAGAGAAGGAGCAGCGCTGCAGG + Exonic
1194503130 X:94703261-94703283 GAGAGAAGAAGGAGGAATGGAGG + Intergenic
1198673570 X:139107787-139107809 GAGAGGAGAGGCAGCAGTGGCGG + Intronic
1200335894 X:155351054-155351076 GAGAAAATTAGCAGAAATGGAGG - Intergenic
1200344966 X:155439172-155439194 CAGAGAATAAGAAGAACAGGAGG + Intergenic
1200350575 X:155490172-155490194 GAGAAAATTAGCAGAAATGGAGG + Exonic
1201903970 Y:19070913-19070935 GAGAGAGTAAGAAGCAGTGAGGG - Intergenic
1202202923 Y:22373429-22373451 GAGTGGATAAGCTGCAGTGGAGG + Intronic