ID: 949438230

View in Genome Browser
Species Human (GRCh38)
Location 3:4051868-4051890
Sequence GTGGTAAACCGGTCTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949438223_949438230 3 Left 949438223 3:4051842-4051864 CCTTCTTTTCTACCCCTGCAGCC 0: 1
1: 0
2: 0
3: 29
4: 388
Right 949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 33
949438226_949438230 -10 Left 949438226 3:4051855-4051877 CCCTGCAGCCTAAGTGGTAAACC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 33
949438225_949438230 -9 Left 949438225 3:4051854-4051876 CCCCTGCAGCCTAAGTGGTAAAC 0: 1
1: 0
2: 0
3: 5
4: 142
Right 949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949438230 Original CRISPR GTGGTAAACCGGTCTGAGTA AGG Intronic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1074235855 10:111583734-111583756 GTGGTCCACCAGTCAGAGTAGGG - Intergenic
1077718010 11:4600622-4600644 GTGGGAGACAGGTCTGAGTGGGG - Exonic
1095638566 12:44459915-44459937 GTGGCATACCTGTCTGAGGAAGG + Intergenic
1101190650 12:102329027-102329049 GTGGTCTACCAGTCAGAGTAGGG + Intergenic
1101730675 12:107424698-107424720 GTGGTATACAGGTCTGGGTCAGG - Intronic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1133808393 16:9142776-9142798 GGGGTAAACTGGACTGGGTATGG - Intergenic
1134246147 16:12541663-12541685 GTGGTAAACGGGTGTCAGCACGG - Intronic
1137715048 16:50593449-50593471 GTGGTAAAGTGCTCTCAGTAGGG + Intronic
1140590730 16:76349174-76349196 GTGGAAAGCCTGTCTGAGTGAGG - Intronic
1149395818 17:56241985-56242007 ATGGTACACCATTCTGAGTACGG - Intronic
1153032448 18:727683-727705 GAGGTAAACCGTTCTAAGTTTGG - Intronic
1153364140 18:4235110-4235132 CTGGAAAACAGGTTTGAGTAGGG - Intronic
1154267566 18:12892321-12892343 GGGGTACACAGGTCTGAGTTTGG + Intronic
1158485711 18:57864151-57864173 GAGGAAAGCCAGTCTGAGTAAGG + Intergenic
1184420750 22:44381606-44381628 GTGGTAAAATGGTATCAGTATGG + Intergenic
949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG + Intronic
952664817 3:35891765-35891787 GTGGTTCACAGGTCAGAGTAGGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
972261824 4:37416274-37416296 GTGAGAAATCGGTCTGAGCATGG + Intronic
980132527 4:128830164-128830186 GTGGAAAACCGGGCTGGGTGTGG - Intronic
982280286 4:153677310-153677332 GTGGTATGCCAGTCTGTGTAGGG - Intergenic
992377249 5:76200090-76200112 GTGGTCAACCAGTCAGAGCAGGG + Intronic
999951256 5:156653527-156653549 GTGGTAGCCCGGACTGAGTCAGG + Intronic
1005622499 6:27632901-27632923 GTGGTACTCCAGTCAGAGTAGGG - Intergenic
1014774329 6:125491104-125491126 ATGGTAAACTGGTCTTAGTGTGG - Intergenic
1017724833 6:157269633-157269655 GTGGTAAACCAGGCTGAGCTCGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1048850414 8:138640193-138640215 GTGGAAAACCTCTCTGAGTTGGG + Intronic
1052813529 9:33082518-33082540 GTAGAAAAGCAGTCTGAGTAGGG - Intergenic
1191588064 X:62850518-62850540 GTGGTCTACCAGTCAGAGTAGGG + Intergenic
1197072621 X:122318064-122318086 GTGGTAAACTTGTCTGCCTATGG + Intergenic
1200289325 X:154856885-154856907 GTGGTCCACCAGTCAGAGTATGG + Intronic