ID: 949441372

View in Genome Browser
Species Human (GRCh38)
Location 3:4084499-4084521
Sequence TCTTCAGGTATCCTGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949441372_949441376 21 Left 949441372 3:4084499-4084521 CCCAGACACAGGATACCTGAAGA 0: 1
1: 0
2: 1
3: 10
4: 233
Right 949441376 3:4084543-4084565 CCAAAGCATTTCCAGAACCAAGG 0: 1
1: 0
2: 0
3: 19
4: 210
949441372_949441377 26 Left 949441372 3:4084499-4084521 CCCAGACACAGGATACCTGAAGA 0: 1
1: 0
2: 1
3: 10
4: 233
Right 949441377 3:4084548-4084570 GCATTTCCAGAACCAAGGCAAGG 0: 1
1: 0
2: 0
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949441372 Original CRISPR TCTTCAGGTATCCTGTGTCT GGG (reversed) Intronic
901125437 1:6925481-6925503 TCTTGAGGTAACCTGTGTTGAGG + Intronic
901528058 1:9836378-9836400 TCTCCAGATAGCCTGTCTCTGGG + Intergenic
901783680 1:11610663-11610685 TCTTCAGGGTTCCGGTCTCTTGG - Intergenic
905013096 1:34760184-34760206 TCTTCAGACATCGTGTGCCTGGG - Intronic
907004610 1:50898834-50898856 TCTTCATGTTCCCTGTGTTTGGG + Intronic
907909167 1:58811996-58812018 TCATGAGGTATAATGTGTCTTGG + Intergenic
909190634 1:72545056-72545078 TCTTCAGGTTTCCTGTATGAAGG - Intergenic
913943650 1:125135676-125135698 TCTGCATGCATCGTGTGTCTGGG - Intergenic
915077963 1:153327178-153327200 TTTCCAGGTATCCTCTGTCATGG - Intergenic
917375167 1:174344417-174344439 TCTTTAGGGACCTTGTGTCTAGG + Intronic
919086451 1:192926287-192926309 TCTTGATGTTTCCTGAGTCTTGG - Intergenic
919767227 1:201135265-201135287 TCTTCAGGAACTCAGTGTCTGGG - Exonic
921248093 1:213267579-213267601 TCTTCATAAATCCTGTGTCTGGG - Intronic
1063266968 10:4462885-4462907 TCTACAGGGATCCAGTGCCTTGG + Intergenic
1066319618 10:34288737-34288759 TCTTCAGCTATGCTGTTTCTTGG - Intronic
1066952046 10:42128976-42128998 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1071134756 10:82440487-82440509 TTTTGATGTTTCCTGTGTCTCGG + Intronic
1072380357 10:94862478-94862500 TCTTCCCATATCCTGTTTCTTGG - Intergenic
1073973358 10:109070857-109070879 TCATCAGGAATCCTGTGTTATGG + Intergenic
1075462778 10:122629780-122629802 TCTTCAGGTATTTTGTGACAAGG - Intronic
1077215415 11:1393429-1393451 CCTTCGGGAATCCTCTGTCTGGG + Intronic
1081098513 11:38970368-38970390 TCTTCTGGTGTCCGGTCTCTTGG - Intergenic
1081637199 11:44728481-44728503 TCTTGGGGTATCCTCTCTCTGGG + Intronic
1081838884 11:46180978-46181000 TCTACAGTTATCCAGAGTCTTGG + Intergenic
1082095789 11:48128099-48128121 ACATCATGCATCCTGTGTCTGGG - Intronic
1084902031 11:72316856-72316878 GATTTAGGTATTCTGTGTCTTGG + Intronic
1087331030 11:96780583-96780605 TCTTCAAGTATCTTCTGTTTTGG - Intergenic
1088967718 11:114741022-114741044 TCTTCAGCTTTCCTTTGTCTGGG + Intergenic
1089016524 11:115169734-115169756 TAATCAGGTCTGCTGTGTCTGGG + Exonic
1090319138 11:125826743-125826765 TCTTCATGTATCTTGTGCTTGGG + Intergenic
1091196617 11:133736853-133736875 ACTTCAGCTCTCCTGTATCTGGG + Intergenic
1092019069 12:5185477-5185499 CCTATAGGTATTCTGTGTCTAGG - Intergenic
1092967897 12:13662584-13662606 TCCTCAAGGAGCCTGTGTCTTGG - Intronic
1094348158 12:29494523-29494545 TTTTAAGGACTCCTGTGTCTTGG - Intronic
1094403210 12:30085131-30085153 TCTTCAGGTGGCCTGGGTATGGG + Intergenic
1095316733 12:40771515-40771537 TAGTCAGGTTTCCTCTGTCTGGG - Intronic
1096625941 12:52896056-52896078 TCTCCAGGGCTCCTGTCTCTGGG - Intergenic
1096860195 12:54520963-54520985 GCTTGATGTATCCTGTCTCTGGG + Intronic
1096984699 12:55748707-55748729 TCTGCAGGTAGACTGTGGCTGGG - Exonic
1099804079 12:87495535-87495557 TCTTCAAATATTCTATGTCTGGG - Intergenic
1103730848 12:123026839-123026861 GCTTCATCTTTCCTGTGTCTTGG + Intronic
1104220956 12:126784761-126784783 TGTTCAGATTTCCTCTGTCTTGG + Intergenic
1112522308 13:100107453-100107475 TCTCAAGGAATCCCGTGTCTCGG - Intronic
1113356744 13:109588345-109588367 TCTCCAGGAATCCTGTGTGGAGG - Intergenic
1114017419 14:18443780-18443802 TGTTCTGGTATCCTGTGTGAGGG + Intergenic
1114020924 14:18477957-18477979 TCTTCTGGAATCCTGTTTGTGGG + Intergenic
1114022046 14:18488893-18488915 TTTTCAGGAATCCTATGTGTTGG - Intergenic
1117369911 14:55067887-55067909 TGTTCAGGAATGCTGTTTCTTGG + Exonic
1119109108 14:71955178-71955200 TCCTCAGGGACGCTGTGTCTTGG + Intronic
1120143129 14:80950811-80950833 TCTTCAAGTTTCCTGTGCTTGGG - Intronic
1120535161 14:85686031-85686053 TCTTCATGTTTCTTGTCTCTTGG + Intergenic
1122253331 14:100456894-100456916 TCTTCATGTTTCCTGTGCCAGGG - Intronic
1123178127 14:106441444-106441466 TTTTCATGTTTCCTGAGTCTGGG - Intergenic
1123216661 14:106814402-106814424 TCCTCAGTTTTCCTTTGTCTGGG - Intergenic
1202838377 14_GL000009v2_random:96043-96065 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1202907744 14_GL000194v1_random:86108-86130 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1202885475 14_KI270722v1_random:103031-103053 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1202887197 14_KI270722v1_random:118889-118911 TGTTCAGGAATCCTGTGTGAGGG + Intergenic
1202938071 14_KI270725v1_random:111601-111623 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1125757816 15:42076275-42076297 TCTCCAGGTATCATGTGGATAGG - Intronic
1128212792 15:65914018-65914040 GCTTCAGGTCTCCTGGGCCTGGG + Intronic
1136278021 16:29191051-29191073 TCTGCAGGGCTCCTGTGTCCCGG + Intergenic
1136770132 16:32830424-32830446 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1136936250 16:34468341-34468363 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1136940292 16:34518179-34518201 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1136945477 16:34645612-34645634 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1136948403 16:34684759-34684781 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1136955802 16:34784634-34784656 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1136959528 16:34830391-34830413 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1136963570 16:34880229-34880251 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1136967714 16:34934760-34934782 TCTGCATGCATCGTGTGTCTGGG - Intergenic
1137092713 16:36214718-36214740 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1137220487 16:46444848-46444870 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1141120825 16:81354575-81354597 TCTCCAGGTATTCTGTGGCAAGG - Exonic
1142082397 16:88157091-88157113 TCTGCAGGGCTCCTGTGTCCCGG + Intergenic
1203072553 16_KI270728v1_random:1092531-1092553 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1142482716 17:228623-228645 TCTGAAGGCATCCTGTGTCCTGG - Intronic
1144236835 17:13269800-13269822 ACTGAAGGAATCCTGTGTCTTGG - Intergenic
1144256057 17:13469878-13469900 TCTTCAGAAACCCTGTGTCTGGG - Intergenic
1144374380 17:14625179-14625201 TCTCTGGGTATCGTGTGTCTAGG - Intergenic
1144410017 17:14991703-14991725 TCTTCAGGTGTTCTGTGTCAGGG + Intergenic
1145691745 17:26748692-26748714 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1146180787 17:30697073-30697095 TCTAAAGGGATCCTGTGTTTGGG - Intergenic
1147728750 17:42583482-42583504 TCCTCAGGTATCTTGAGTGTGGG - Exonic
1148666861 17:49381528-49381550 GCTTAAGGGATCCTCTGTCTCGG - Intronic
1149064268 17:52461430-52461452 TCTTCTGTTCTTCTGTGTCTGGG + Intergenic
1149630783 17:58120678-58120700 TCTTCAGCTTTACAGTGTCTTGG - Intergenic
1151457576 17:74235489-74235511 TCTGCAGGCACCCTGGGTCTGGG + Intronic
1152017832 17:77763494-77763516 TCTTCAGGTTTGCTGTTTCCTGG - Intergenic
1203158812 17_GL000205v2_random:30282-30304 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1203183265 17_KI270729v1_random:86239-86261 TCTGCATGCATCGTGTGTCTGGG - Intergenic
1153301364 18:3594805-3594827 CCTGCAGGAATCCTGTTTCTGGG - Intronic
1159252651 18:65900285-65900307 TCTGCAGGTATCGTTAGTCTTGG + Intergenic
1159894462 18:73983306-73983328 GCTTCATGTAGCCTGTGCCTGGG - Intergenic
1160058608 18:75509506-75509528 TCTCCAGGCAGCCTGTGTGTTGG - Intergenic
1162496630 19:11026845-11026867 GCCTCAGGAATCCTGTCTCTTGG - Intronic
1162774216 19:12969345-12969367 TCTTCAGACATTGTGTGTCTCGG + Intronic
1162977793 19:14218462-14218484 TCTAAAGGGATCCTGTGTTTGGG + Intergenic
1163163647 19:15480474-15480496 TCCTCAGGTGTCCTCTTTCTGGG + Intronic
1164120192 19:22259019-22259041 GTTTCAGGTATCCTGAATCTTGG + Intergenic
1164609003 19:29619696-29619718 GATTCAGCTATTCTGTGTCTTGG + Intergenic
1164621064 19:29696374-29696396 TGTCCAGGTATCAGGTGTCTGGG - Intergenic
1167741837 19:51328666-51328688 TCTCCAGGGATCCTGGGCCTGGG - Exonic
1167773410 19:51538085-51538107 TCTTCAGTAATCCTCTGCCTGGG - Intergenic
1202634648 1_KI270706v1_random:34537-34559 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1202651230 1_KI270707v1_random:5506-5528 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1202660878 1_KI270708v1_random:70057-70079 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1202662625 1_KI270708v1_random:85882-85904 TGTTCAGGAATCCTGTGTGAGGG + Intergenic
1202681734 1_KI270712v1_random:11551-11573 TCTGCACGCATCGTGTGTCTGGG - Intergenic
925822807 2:7817022-7817044 CCTTCATGTATCCTATTTCTGGG - Intergenic
926188523 2:10709849-10709871 TCTCCAGGTATCCTGTTTGGTGG - Intergenic
928046939 2:27943914-27943936 TATTCAGGATTCCTTTGTCTTGG + Intronic
929752960 2:44736499-44736521 TCTTCATGTTTCTTGTGTTTGGG + Intronic
930368048 2:50467743-50467765 TCTTCAGGTTTCCTGGATTTGGG - Intronic
932689752 2:73902222-73902244 TCTCCTGCTATCCTGTTTCTGGG + Intronic
933269443 2:80217326-80217348 TCATCAGGAACCCAGTGTCTCGG + Intronic
934250035 2:90343525-90343547 TCTGCACGCATCGTGTGTCTGGG + Intergenic
934259537 2:91459915-91459937 TCTGCACGCATCGTGTGTCTGGG - Intergenic
934302833 2:91791836-91791858 TCTGCACGCATCGTGTGTCTGGG - Intergenic
934468650 2:94290825-94290847 TCTGCACGCATCGTGTGTCTGGG + Intergenic
939356643 2:141111303-141111325 TTTTCAGCTTTCCTCTGTCTTGG - Intronic
939875890 2:147577448-147577470 TCTTCGTGGATCATGTGTCTTGG - Intergenic
941927844 2:170914145-170914167 ACATCAGGAATCCTGTCTCTAGG - Intergenic
943276720 2:185876620-185876642 TCCTCAGGTCTCCTGTGTCTAGG - Intergenic
943753720 2:191536758-191536780 ACTTCAGGTGTGCTGTATCTAGG + Intergenic
948298691 2:236885527-236885549 CCTCCAGGTATCCTATGCCTGGG + Intergenic
949066986 2:241997460-241997482 TCTTCATGTTTCCTGTGCTTGGG + Intergenic
1169891990 20:10463340-10463362 TCTTTGGGTATCCAGTTTCTGGG + Intronic
1170865274 20:20149995-20150017 TCTACAGGCAGCCTGTGTGTAGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1176585243 21:8577535-8577557 TCTGCATGCATCGTGTGTCTGGG - Intergenic
1176600911 21:8794132-8794154 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1176646867 21:9360306-9360328 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1177458573 21:21378202-21378224 AATTCAGGAATCCTTTGTCTGGG - Intronic
1180268051 22:10554435-10554457 TCTGCATGCATCGTGTGTCTGGG - Intergenic
1180328364 22:11453653-11453675 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1180329436 22:11463425-11463447 TGTTCAGGAATCCTGTGTGAGGG + Intergenic
1180343198 22:11685669-11685691 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1180366058 22:11938691-11938713 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1180417444 22:12780405-12780427 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1180441924 22:15374649-15374671 TGTTCTGGTATCCTGTGTGAGGG + Intergenic
1180445411 22:15408543-15408565 TCTTCTGGAATCCTGTTTGTGGG + Intergenic
1183329035 22:37209482-37209504 TCATCAGGTCTCCTGAGCCTGGG + Intronic
1184906835 22:47493646-47493668 TCAGCAGGCATCCTGGGTCTTGG + Intergenic
1203237086 22_KI270732v1_random:14732-14754 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1203323515 22_KI270737v1_random:93023-93045 TCTGCACGCATCGTGTGTCTGGG + Intergenic
949441372 3:4084499-4084521 TCTTCAGGTATCCTGTGTCTGGG - Intronic
950865466 3:16184949-16184971 TCTTCAGGGATGCTCTGACTGGG + Intronic
951041888 3:17997393-17997415 ATTTCAGTTTTCCTGTGTCTTGG - Intronic
951051586 3:18099759-18099781 TCTCCAAGTTTCCTGTGTGTAGG + Intronic
952836576 3:37607486-37607508 TCTTCTGGAATCCAGTGTCTGGG + Intronic
957092933 3:75749977-75749999 TGTTCAGGCATCCTGTGTGAGGG - Intronic
957093407 3:75754029-75754051 TGTTCAGGAATCCTATGTCAGGG - Intronic
960909433 3:122634195-122634217 GCTCCAGATAACCTGTGTCTGGG - Intronic
962005079 3:131340688-131340710 CCTTCAGGACTCCTGTGTCAAGG + Intronic
963799342 3:149660461-149660483 TTTTCAGTTATCCTGTGTTAAGG - Intronic
964527549 3:157631232-157631254 TCTCCAGGTATCCTTGGTCCAGG + Intronic
965579940 3:170257247-170257269 TATTAAGAAATCCTGTGTCTCGG - Intronic
965791478 3:172392916-172392938 TCTGCCTGTATCCTGTATCTGGG + Intronic
966242186 3:177766892-177766914 TCTGAAGATATCCTGTTTCTGGG - Intergenic
966680397 3:182636288-182636310 TATTCATGTATTTTGTGTCTGGG - Intergenic
1202740019 3_GL000221v1_random:44734-44756 TCTTCAGGAATCCTATGTGAGGG - Intergenic
969990177 4:11253942-11253964 TCATCATGTTTCATGTGTCTAGG + Intergenic
973364351 4:49196881-49196903 TCTTCAGGAATCCTATGTGAGGG + Intergenic
973396735 4:49599857-49599879 TCTTCAGGAATCCTATGTGAGGG - Intergenic
977231879 4:94461406-94461428 TCTTTAGGTATTCTATGTGTTGG + Intronic
979102550 4:116638850-116638872 TCTTCAAGTCTCATATGTCTGGG - Intergenic
979279610 4:118850630-118850652 TCTTCCTGTATCCTCTTTCTTGG - Intergenic
979314225 4:119241695-119241717 TCTTCATGTTTCTTGTGTTTGGG + Intronic
982551667 4:156808839-156808861 TCTTCAGCCGTCCTTTGTCTTGG - Intronic
982827656 4:160020763-160020785 TCTAGAAGTCTCCTGTGTCTGGG + Intergenic
984944853 4:184962886-184962908 TCTTCAGGTATCCTTTAGTTGGG - Intergenic
985046308 4:185943815-185943837 TCTTGGGGTCTCCTGTTTCTAGG + Intronic
1202761655 4_GL000008v2_random:117910-117932 TCTTCAGGAATCCTATGTGAGGG + Intergenic
987318933 5:16749700-16749722 TCTTTAGGTTTGCTGTGTCCAGG - Intronic
987613151 5:20234893-20234915 TCTTCATGTTTCTTGTGACTGGG - Intronic
988406919 5:30835690-30835712 TCTGCTGGCATCCTGTATCTTGG + Intergenic
990430479 5:55730064-55730086 TCTTCAGCTATCTGGTGACTGGG - Intronic
996013476 5:118506211-118506233 TCTTCTGGTCTCTTGTTTCTTGG - Intergenic
999594667 5:153189514-153189536 TCTTCACGTATGTTGTCTCTTGG - Intergenic
999820557 5:155223692-155223714 TCTTCAGGGATTCTGATTCTTGG + Intergenic
1001388550 5:171359849-171359871 TTTTCATGCATCCCGTGTCTGGG + Intergenic
1001676979 5:173526988-173527010 TCTTCATGTTTCCTGTGCTTGGG - Intergenic
1003764903 6:9224589-9224611 CATTCAGGTATCCTGAGTTTAGG + Intergenic
1008003066 6:46381027-46381049 AATTCAGGTTTCCTGTCTCTGGG + Intronic
1008917461 6:56804111-56804133 CCTTAGTGTATCCTGTGTCTTGG - Intronic
1012790032 6:103681560-103681582 TATTCAGAAATCCAGTGTCTGGG - Intergenic
1012858951 6:104535908-104535930 TCTTCAGGCATCCTTCTTCTAGG + Intergenic
1014463993 6:121732528-121732550 TCTTCATGTATCTTGCATCTTGG - Intergenic
1014624280 6:123706828-123706850 TCTTCAGGAACCTTTTGTCTTGG - Intergenic
1014661580 6:124179324-124179346 TCTTCAGCTATTCTGTGTGTAGG + Intronic
1015321879 6:131885416-131885438 GCTACAGATATCCTGAGTCTAGG + Intronic
1016050844 6:139528470-139528492 TCTTCAACTATCCTCTGTTTAGG + Intergenic
1017533038 6:155315636-155315658 TTGTCAGGTATACTGTGTTTTGG - Intergenic
1018432862 6:163736688-163736710 TCTTCAGGCATGCTCTCTCTGGG + Intergenic
1019791880 7:3019525-3019547 TCTCCAGGTTTACTGTGTGTAGG + Intronic
1021713630 7:23440975-23440997 ACTTTAGGTATCCTGGGACTTGG + Intronic
1021972610 7:25980596-25980618 GCTGCAGGTGTCCTGTGTCTTGG - Intergenic
1023477686 7:40598783-40598805 TCTACACAGATCCTGTGTCTGGG - Intronic
1025474037 7:60897310-60897332 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1025480203 7:60973465-60973487 TCTGCACGCATCATGTGTCTGGG - Intergenic
1025488723 7:61084384-61084406 TCTGCACGCATCATGTGTCTAGG + Intergenic
1025512965 7:61592564-61592586 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1025551771 7:62258892-62258914 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1025557520 7:62327612-62327634 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1025565107 7:62424791-62424813 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1027357887 7:77377344-77377366 TCCTCAGCTATTCTGTCTCTTGG + Exonic
1029795232 7:102887617-102887639 TCTTCAGGAAACCTCAGTCTTGG + Intronic
1030159779 7:106495271-106495293 GATTCTGGTATGCTGTGTCTTGG - Intergenic
1035102402 7:156412038-156412060 TCTTCAGAAATTCTGTTTCTGGG + Intergenic
1038990209 8:32859590-32859612 TCTTGGGGTCTCCTGTGGCTAGG - Intergenic
1040581068 8:48699048-48699070 TCTCCAGGTATCCAGTTTCCAGG + Intergenic
1043428894 8:80175295-80175317 GCTTCAGGTAGCCTGGGTCTAGG + Intronic
1043695053 8:83207665-83207687 TCTGCAGGTTTCCTATGTCAAGG + Intergenic
1051554131 9:18363966-18363988 TCTTCACGTGTTCTGTGTCTAGG - Intergenic
1052034016 9:23659828-23659850 TCCACAGGTTTCCTCTGTCTTGG - Intergenic
1052764023 9:32622205-32622227 GCTTTAGGTCTCCTGTGTCACGG - Intergenic
1053699043 9:40668848-40668870 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1053945051 9:43299092-43299114 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1054074867 9:60519172-60519194 TGTTCAGGAATCCTGTGTGAGGG + Intergenic
1054310332 9:63468249-63468271 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1054409121 9:64792399-64792421 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1054442282 9:65276216-65276238 TCTGCACGCATCATGTGTCTGGG + Intergenic
1054487999 9:65745280-65745302 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1203749940 Un_GL000218v1:68480-68502 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1203484819 Un_GL000224v1:42865-42887 TGTTCAGGAATCCTGTGTGAGGG + Intergenic
1203494296 Un_GL000224v1:136293-136315 TGTTCTGGAATCCTGTGTGTGGG - Intergenic
1203497958 Un_GL000224v1:170592-170614 TCTTCAGGAATCCTTTGTGAGGG + Intergenic
1203506915 Un_KI270741v1:78168-78190 TGTTCTGGAATCCTGTGTGTGGG - Intergenic
1203510510 Un_KI270741v1:112842-112864 TCTTCAGGAATCCTTTGTGAGGG + Intergenic
1203708660 Un_KI270742v1:74691-74713 TCTTCAGGAATCCTATGTGAGGG - Intergenic
1203542425 Un_KI270743v1:102791-102813 TCTTCAGGAATCCTATGTGAGGG + Intergenic
1203581117 Un_KI270746v1:6045-6067 TCTGCACGCATCGTGTGTCTGGG - Intergenic
1203588186 Un_KI270747v1:27670-27692 TCTGCACGCATCGTGTGTCTGGG + Intergenic
1203615148 Un_KI270749v1:55053-55075 TCTGCATGCATCGTGTGTCTGGG - Intergenic
1186562899 X:10631788-10631810 TCTTAAGGATTCCTGTGCCTTGG - Intronic
1186839039 X:13466704-13466726 TCCTCAGTGATCTTGTGTCTGGG + Intergenic
1188732419 X:33666496-33666518 TTTTCAGGAATCTTGTTTCTGGG + Intergenic
1190014218 X:46812927-46812949 TGTTCAGGCATCCTGAGGCTGGG + Intergenic
1194494322 X:94592796-94592818 TTTTCACGTATTCTGTTTCTTGG - Intergenic
1196014683 X:110925200-110925222 TCTTCATGTTTCTTGTGTTTAGG - Intergenic
1196648603 X:118146015-118146037 TCTTCAGTCATCCTGAATCTGGG + Intergenic
1197339799 X:125252898-125252920 TCTTTAAGGATCCTGTGGCTAGG + Intergenic
1198695083 X:139326903-139326925 CCCTCAGCTATCCTCTGTCTAGG - Intergenic
1201163594 Y:11186122-11186144 TCTTCAGGAATCCTATGTGAGGG - Intergenic