ID: 949447894

View in Genome Browser
Species Human (GRCh38)
Location 3:4154804-4154826
Sequence GTGGTTGCCCAGATATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949447894 Original CRISPR GTGGTTGCCCAGATATTGGC TGG (reversed) Intronic
902369389 1:15996144-15996166 ATGGCTGCCCAGATATCTGCTGG + Intergenic
910009751 1:82446942-82446964 GTTATTCCCCAGATACTGGCTGG - Intergenic
915219883 1:154366253-154366275 GTGGTTGCCGAGATCTGGGGCGG - Intergenic
915219971 1:154366911-154366933 GCGGTTGCCCAGATCTGGGGTGG + Intergenic
920924760 1:210330589-210330611 GTGGGTGGCCAGATGTTGGTGGG + Intronic
922157654 1:223052650-223052672 GTGGTGCCCCAGAGAGTGGCCGG - Intergenic
922340063 1:224647866-224647888 GTGGCTGGACAGATAGTGGCAGG + Intronic
922902577 1:229148197-229148219 GTGGTTGCTGAGATAATGTCTGG - Intergenic
923734287 1:236588329-236588351 GTGAGAGCCCAGATATTGACGGG + Intronic
924633977 1:245767491-245767513 GTGGTTTCACACATATTGACGGG - Intronic
924839564 1:247694488-247694510 GTACTTGCCCAGACATGGGCAGG - Intergenic
1063711044 10:8478985-8479007 GTAGTTGCTCAGCTAGTGGCAGG + Intergenic
1064953917 10:20885817-20885839 TTAGGTGGCCAGATATTGGCAGG + Intronic
1065830808 10:29612046-29612068 GGGGTAGCTCAGATGTTGGCAGG + Intronic
1066660406 10:37734100-37734122 GTGGTGGGCCAGATTTTGACTGG + Intergenic
1072033180 10:91540576-91540598 TTGGTTACCCAGATATCAGCAGG + Intergenic
1073008699 10:100343553-100343575 GTGGTTGCCCAGGGCTTGGAAGG - Intergenic
1073180435 10:101579905-101579927 GGGCTTGCCCAGGTATTAGCTGG + Intronic
1074629585 10:115236913-115236935 GTGGTTGCCAAGAGTTTGGAGGG - Intronic
1075297228 10:121288425-121288447 GTGCTTGCCCAGATATAGTGGGG + Intergenic
1075432996 10:122405624-122405646 TTGGTTACCCAAATATTGGAAGG + Intronic
1076684237 10:132189897-132189919 GTCGGTGCCCAGAGCTTGGCAGG - Intronic
1081311962 11:41585361-41585383 GTGGTTTCCCAGTGATTGGATGG + Intergenic
1082749046 11:56998392-56998414 GTGATTGCCCAGAGACAGGCTGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1087122101 11:94585849-94585871 GTGGTTGACATGAAATTGGCAGG + Intronic
1087554624 11:99700531-99700553 GTGGTTAGGCAGATATTAGCAGG + Intronic
1090027752 11:123182262-123182284 GTGGTTGGCCAGCTCTTCGCAGG - Intronic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1090453616 11:126828315-126828337 GAGGTGGCCCAGGTAGTGGCAGG + Intronic
1093203637 12:16220517-16220539 GTGGTTGGCCAGCTATGGTCAGG + Intronic
1094774172 12:33703683-33703705 GTGGTTGCCCAGATATGTGCAGG + Intergenic
1096289608 12:50330632-50330654 GTGGGTACCCAGATATTCCCAGG - Exonic
1099787524 12:87285204-87285226 GTTTTTGGCCAGATATTGGGGGG + Intergenic
1101053970 12:100893431-100893453 GTTGTTTGCCTGATATTGGCTGG + Intronic
1103137681 12:118521798-118521820 GTGGTTGCTCAGTGACTGGCCGG + Intergenic
1109693756 13:65927167-65927189 GTGGTTCCCGAGATCTTGCCTGG + Intergenic
1111128143 13:83938968-83938990 GTGGTTGCACATATTTTTGCTGG - Intergenic
1113104893 13:106761033-106761055 GTTGATGGGCAGATATTGGCAGG - Intergenic
1115174325 14:30544944-30544966 GTGGTTGCCCGGGGATTGGGTGG - Intergenic
1124686906 15:31790678-31790700 GTTGTTTCCATGATATTGGCTGG - Intronic
1128135436 15:65259858-65259880 GTGTCTGCCCAGATGGTGGCAGG + Intronic
1129964262 15:79719905-79719927 GGGGTTGCTCAGATATTCCCAGG - Intergenic
1131194296 15:90342813-90342835 GTTGGTTCCCAGATCTTGGCAGG + Intergenic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1138214971 16:55196296-55196318 GTGGTTGCACAGAGCTTGGAGGG + Intergenic
1140830564 16:78746784-78746806 GAGGTTGGCCTGATATTGACTGG - Intronic
1144391542 17:14798185-14798207 GTGGATGCATAGATATTGGGTGG + Intergenic
1146810341 17:35898268-35898290 GGGGTTACCCAGGTATTGGAGGG + Intergenic
1147204855 17:38829708-38829730 GTGGTTGCCTAGAGATGGGTAGG + Intergenic
1150530260 17:65973704-65973726 GTGGTTGCCTGGATATGGGGAGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160710860 19:550424-550446 GTGGTTGCCCAGCTCTGTGCAGG - Intergenic
1161300264 19:3539091-3539113 GTGGTTGCCGAGACACTGGGTGG + Intronic
1163861698 19:19746387-19746409 GTGGTGGCCCAGCTGCTGGCTGG + Intergenic
933888711 2:86744664-86744686 GTGGTAGCCAAGATATTGTTTGG + Intronic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
935681090 2:105637855-105637877 GTGGCTGTCCATATGTTGGCTGG - Intergenic
937953393 2:127405514-127405536 GTGGGGGCCCAGATAATGTCAGG + Intergenic
941857213 2:170243217-170243239 GTGGTTCTGCAGATCTTGGCTGG + Intronic
945144541 2:206723632-206723654 GTGGCTGCCCAGGTTCTGGCTGG - Intergenic
947655346 2:231821897-231821919 GTGGTTGCCAGGATAATGGAGGG - Intergenic
1170914704 20:20611328-20611350 TTGTTTGCCCAGAGCTTGGCAGG - Exonic
1171324896 20:24282707-24282729 CTGGTTCACCCGATATTGGCAGG + Intergenic
1174616228 20:51837674-51837696 GCTGTTGCCCAGACAGTGGCAGG - Intergenic
1176001898 20:62836007-62836029 CTGGTTGCCCAGAGGTGGGCAGG - Intronic
1182290335 22:29272814-29272836 GTGGTTGCACAGTAAGTGGCGGG + Intronic
1183184643 22:36285035-36285057 GTTGTGGCCCAGATTTGGGCAGG + Intronic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
949501414 3:4683644-4683666 GTAGTTGTCCACATCTTGGCTGG - Exonic
955315302 3:57933610-57933632 CTGGTTGCCCAGATATTCTCTGG - Intergenic
957807112 3:85162075-85162097 TTGGTTGCCCAGATATTGATTGG + Intronic
962267629 3:133955049-133955071 GTGGTTGCCCAGCTGCTGGCTGG - Exonic
963817231 3:149844973-149844995 GTGGTTGCCTAGGGATTGGCAGG - Intronic
974462453 4:62205467-62205489 GTGTGTGCAGAGATATTGGCAGG - Intergenic
984600158 4:181717230-181717252 GTGGATGCACAATTATTGGCAGG + Intergenic
987825056 5:23020556-23020578 GGGGTGGCTCAGAGATTGGCAGG + Intergenic
990216700 5:53540856-53540878 GCGGTTGCCCTGCTGTTGGCTGG + Intergenic
992258717 5:74948581-74948603 GTGGCTGCCCAGTCGTTGGCTGG + Intergenic
992367578 5:76108954-76108976 CTCGTTGGCCAGATATTGGCTGG - Intronic
1000307925 5:160012916-160012938 GTGGTTAACCAGAGACTGGCAGG - Intronic
1003466882 6:6389144-6389166 GTGGTAGCCCAGCTCTGGGCTGG - Intergenic
1008703693 6:54131859-54131881 GTGGTTCTGCAGATATGGGCTGG + Intronic
1009275643 6:61675695-61675717 TTTGTTGCCCAGATATTAGTAGG + Intergenic
1015455822 6:133424959-133424981 ATGGTTGCCAAGAGATTGGAGGG - Intronic
1020029242 7:4921163-4921185 GTGGTGGCCCAGAGAGGGGCTGG - Intronic
1028677186 7:93478802-93478824 GTGACTGCCCAGATATTTTCAGG - Intronic
1033710053 7:143933750-143933772 GTCTTTGCTCTGATATTGGCTGG + Intergenic
1035301467 7:157900364-157900386 GTGGTTGCCAAGAGGTTGTCTGG + Intronic
1036126512 8:6068030-6068052 GTGGTTGCTTAAAAATTGGCAGG - Intergenic
1036575184 8:10021428-10021450 TTGGTTTCAAAGATATTGGCTGG + Intergenic
1044079908 8:87870406-87870428 GTGGTTTCCCAGATTTCAGCAGG - Intergenic
1048759499 8:137777665-137777687 GTGGTTGCCTAGATAGGGGCTGG - Intergenic
1051290767 9:15543430-15543452 GAGGTTGCCAAGATGTTGGTAGG - Intergenic
1057329312 9:94097968-94097990 GTGCCTGCCCAGATCTTGGTTGG + Exonic
1057544482 9:96007341-96007363 GTGGTGGGCCAGATATGGGTGGG + Intronic
1059804945 9:117788722-117788744 GTGTTTGCCAAGATATTGGAAGG + Intergenic
1060945020 9:127565300-127565322 GTGGTTGCCTAGATTTAGGAGGG + Intronic
1185908335 X:3958767-3958789 GTTGGAGCCCAGATATTAGCAGG - Intergenic
1186077200 X:5893361-5893383 GTGGTTGGCCATATCTTGGCGGG + Exonic
1189265094 X:39709215-39709237 GTGGTTGCCAGGCTATTGGCTGG + Intergenic
1190397343 X:49998411-49998433 GTGGGTGCCCACAAAATGGCAGG - Intronic
1190422839 X:50302628-50302650 GTGGTTGCCCAAAGCTGGGCAGG - Intronic
1201518134 Y:14840696-14840718 GTGGTTGGCCATATCTTGGCGGG - Exonic