ID: 949450630

View in Genome Browser
Species Human (GRCh38)
Location 3:4181144-4181166
Sequence ATTGTGCTTCCTCATGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949450626_949450630 -5 Left 949450626 3:4181126-4181148 CCATCAAGGGTGTCTCCCATTGT 0: 1
1: 0
2: 0
3: 9
4: 91
Right 949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG 0: 1
1: 0
2: 0
3: 17
4: 217
949450623_949450630 30 Left 949450623 3:4181091-4181113 CCACATAGAGGATAGTGGAAGAA 0: 1
1: 0
2: 1
3: 9
4: 149
Right 949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG 0: 1
1: 0
2: 0
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949450630 Original CRISPR ATTGTGCTTCCTCATGATGG TGG Intronic
905713052 1:40123705-40123727 AGTGTTCTCCCTCAGGATGGAGG - Intergenic
906570679 1:46835732-46835754 ATTGTGATTCCCTGTGATGGAGG - Intergenic
906749394 1:48245500-48245522 CTTCTACTTCCTCATGGTGGTGG - Intronic
909092857 1:71248145-71248167 ATTGTAATTCCTAATGTTGGAGG + Intergenic
910983435 1:92981413-92981435 CTTGTGCTTTTACATGATGGAGG - Intergenic
911979307 1:104546047-104546069 ATTGTGATCCCTAATGTTGGAGG + Intergenic
915609505 1:156979913-156979935 AGTGTGCTTCCTCATTACAGAGG + Intronic
916383617 1:164242049-164242071 ATTGTGATTCCTAGTGTTGGAGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920303045 1:205001224-205001246 ATTGTGCTTCCAGGTGATGTTGG - Exonic
920910896 1:210215281-210215303 ATTGTGCTTCTTTATGATACTGG - Intergenic
921693130 1:218176341-218176363 ATTCTGCTTCTTGATGAAGGAGG - Intergenic
922096342 1:222446067-222446089 ATGGTGGGTCCTCATGTTGGTGG + Intergenic
922666248 1:227471844-227471866 ATTGTAATTCCTAATGTTGGGGG + Intergenic
924768572 1:247057449-247057471 ATTGAGCTACCACATGATGACGG + Intronic
924791396 1:247253266-247253288 AATGTGCTTCCTAGTGTTGGAGG + Intergenic
1065244398 10:23742720-23742742 ATTGTAATTCCTAATGTTGGAGG - Intronic
1066973787 10:42344564-42344586 ATTTTGCTTCATGATTATGGTGG - Intergenic
1068323924 10:55459017-55459039 ATTGTGCATCCTCATTCTGCAGG - Intronic
1070091228 10:73287628-73287650 ACTTTGCTTCCTCATTTTGGTGG - Intronic
1070738140 10:78878950-78878972 ATTAGGCTTCATCATAATGGGGG - Intergenic
1071006622 10:80890895-80890917 AATGTGATTCCTAATGTTGGAGG + Intergenic
1073590952 10:104757173-104757195 GTTGTGCTGCCACATGATGTGGG - Intronic
1073730179 10:106278707-106278729 ATTGTAGTTCCTAATGTTGGGGG + Intergenic
1074290203 10:112132618-112132640 AATGTGATTCCTAATGGTGGAGG + Intergenic
1076449771 10:130548910-130548932 GTTTTGCTGCCTCCTGATGGAGG + Intergenic
1077723712 11:4652514-4652536 GTTCAGCTTCTTCATGATGGTGG + Exonic
1079673893 11:23201997-23202019 ATTGTTTGTCCTCTTGATGGTGG + Intergenic
1080659877 11:34286998-34287020 GTTCTGCCTCCTCATCATGGTGG + Intronic
1082113655 11:48305010-48305032 TGTGTGCTTCCTCTTGATGTTGG + Intergenic
1083090755 11:60197750-60197772 ATTGTAATCCCTAATGATGGGGG + Intergenic
1083164282 11:60873952-60873974 ATTTTCCTTCCTCCTGGTGGTGG - Intronic
1085383904 11:76145067-76145089 AATGTGATTCCCCATGTTGGAGG + Intergenic
1089287579 11:117417542-117417564 ACTGTGCTTCCTGGAGATGGAGG - Intergenic
1094362465 12:29644707-29644729 CTTGTGCTTGTTCATAATGGAGG + Intronic
1096944949 12:55394204-55394226 ATTCTGTTTCCTCTAGATGGAGG - Intergenic
1097403657 12:59161231-59161253 ATTGTAATTCCTAATGTTGGGGG - Intergenic
1097597762 12:61655004-61655026 AATGTGATTCCTAATGTTGGAGG - Intergenic
1099573657 12:84356562-84356584 AATGTGTTGCCTTATGATGGGGG - Intergenic
1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG + Intronic
1104980736 12:132572165-132572187 GTTGTGCTTCCTGAGGCTGGCGG - Intronic
1105233947 13:18527987-18528009 ATTGTGCTCAGTAATGATGGAGG - Intergenic
1105321368 13:19325224-19325246 AATGTGATTCCTGATGTTGGAGG - Intergenic
1112766478 13:102751131-102751153 ATTGTTCTTCCTAATGTGGGTGG + Intronic
1112829547 13:103431816-103431838 AGTGTGCTTCCTTTAGATGGTGG + Intergenic
1113079989 13:106509072-106509094 ATTGTTCTGGCTAATGATGGCGG - Intronic
1113320518 13:109228216-109228238 ATTGTAATTCCCCATGTTGGAGG - Intergenic
1115902455 14:38167855-38167877 ATTGTTCTTCCTAATGTTGGTGG + Intergenic
1116281348 14:42913120-42913142 ATTTTGCTTACTCTTCATGGTGG + Intergenic
1117824388 14:59687035-59687057 ATTGTGCTTTCTCCTGTTGCAGG + Intronic
1118079837 14:62345999-62346021 GTTGTGCTTCATCATTATGATGG + Intergenic
1118389664 14:65285494-65285516 ATTGTGCTACATGAGGATGGGGG + Intergenic
1120100385 14:80438347-80438369 ATTGTAATTCCTAATGTTGGAGG + Intergenic
1120246557 14:82012661-82012683 ATTTTGTTTCTTCATGATGCTGG - Intergenic
1120462756 14:84818029-84818051 ATTGTGTCTTCACATGATGGAGG - Intergenic
1121379730 14:93453080-93453102 ATTGTGCTTCCACAGGAAAGTGG + Intronic
1121430249 14:93881404-93881426 ATTGTAATTCCTAATGTTGGAGG - Intergenic
1121606438 14:95243870-95243892 ATTGTGATCCCTAATGTTGGAGG + Intronic
1121857307 14:97282012-97282034 ATTGTCCTCCCTCATGTAGGGGG - Intergenic
1122850196 14:104523863-104523885 ATTGTGATTCCTAGTGCTGGAGG - Intronic
1123141349 14:106082234-106082256 ATTGGGCTCCCTGATGTTGGAGG - Intergenic
1123199775 14:106651575-106651597 ATTGGGCTCCCTGATGTTGGAGG - Intergenic
1202837472 14_GL000009v2_random:89118-89140 ATTATGCTTCCTAATGTTGGAGG + Intergenic
1202906858 14_GL000194v1_random:79248-79270 GTTATGCTTCCTAATGTTGGAGG + Intergenic
1124165285 15:27320580-27320602 ATTCTGCTTCCCCGTGCTGGAGG + Intronic
1125008956 15:34849461-34849483 ATTGTGCTTGGTCTTTATGGTGG + Intergenic
1127711289 15:61600997-61601019 ATTGTGTCCCCTGATGATGGTGG + Intergenic
1130166225 15:81461702-81461724 ATTCTGGTTCCTCTTCATGGAGG + Intergenic
1131733831 15:95311366-95311388 ATTGTAATCCCTCATGTTGGAGG + Intergenic
1132210489 15:100018402-100018424 ATTGTAATTCCTCGTGTTGGAGG + Intronic
1133552721 16:6873301-6873323 CTTGAGCTTCCTTATGTTGGAGG + Intronic
1134516025 16:14887810-14887832 ATACAGTTTCCTCATGATGGGGG + Intronic
1134703697 16:16286457-16286479 ATACAGTTTCCTCATGATGGGGG + Intronic
1134963846 16:18425657-18425679 ATACAGTTTCCTCATGATGGGGG - Intronic
1134968133 16:18508193-18508215 ATACAGTTTCCTCATGATGGGGG - Intronic
1137594777 16:49716301-49716323 TTGGTGCTGCCTCATGATGGGGG - Intronic
1138199007 16:55075184-55075206 ATTGTAATCCCTCATGTTGGAGG - Intergenic
1138977001 16:62220170-62220192 ATTGTTCTTCCCAATGAGGGTGG - Intergenic
1139538983 16:67599582-67599604 ATTGTTCTTCCTCAGTCTGGAGG + Intronic
1143804492 17:9415117-9415139 ATTGTCCTTCCTCAGGCTGTGGG - Intronic
1146741524 17:35288217-35288239 TTTCTGCTTCCTCACGGTGGGGG + Intergenic
1148646918 17:49224513-49224535 CTTGTGCTTGCACATGTTGGCGG + Exonic
1149974084 17:61248577-61248599 TTTGTGCTTCCTCAGCAGGGAGG + Intronic
1150023987 17:61652491-61652513 TTTGTGCTTCCAGGTGATGGAGG + Intergenic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1151168274 17:72223526-72223548 TTTATGCTTCCTCAAGGTGGAGG + Intergenic
1152527751 17:80898834-80898856 ATTGTGGTTCCTGGGGATGGCGG + Intronic
1155542313 18:26881452-26881474 AGTGTCATTCCTCATCATGGAGG - Intergenic
1157715901 18:49886983-49887005 AATGTGATTCCTAATGTTGGAGG + Intronic
1159384112 18:67700449-67700471 AATGTGATCCCTAATGATGGAGG + Intergenic
1159748825 18:72274259-72274281 CTTGTGTTTCATCATGAAGGTGG + Intergenic
1160750244 19:730654-730676 ATCGTGCTCTTTCATGATGGGGG - Intronic
1162272513 19:9627996-9628018 ATTGTTCTATCTCATGTTGGAGG - Intronic
1165019191 19:32909143-32909165 ATTGGGCTTACTCAAGATGAAGG + Intronic
1165191347 19:34066421-34066443 AATGTGATCCCTCATGTTGGAGG + Intergenic
1166968866 19:46548658-46548680 ATGGTGCTTCTTTGTGATGGGGG - Intronic
1202635171 1_KI270706v1_random:38233-38255 GTTATGCTTCCTAATGTTGGAGG - Intergenic
1202650048 1_KI270706v1_random:171872-171894 GTTATGCTTCCTAATGTTGGAGG + Intergenic
926427221 2:12749942-12749964 ATTGTGCTTCCTTTTGAAGTAGG + Intergenic
926769131 2:16352294-16352316 ATTGTAATTCCCAATGATGGGGG + Intergenic
928848844 2:35716790-35716812 TTTGTTTTTTCTCATGATGGAGG - Intergenic
931817560 2:65919803-65919825 ATTGTGCTGCCTTTTGAAGGAGG + Intergenic
933330306 2:80884917-80884939 AATGTGATTCCCCATGCTGGAGG - Intergenic
935100037 2:99985579-99985601 ATTGTTCTTTCTCATGGTAGTGG - Intronic
937210604 2:120267051-120267073 ACTGCCCTTCCTCCTGATGGAGG - Intronic
941320532 2:164048909-164048931 ATTGTCCTCCCTAATGTTGGTGG + Intergenic
941554809 2:166964304-166964326 ATTGTGTTTTCTCATAATGCAGG + Intronic
942203438 2:173594653-173594675 TTTGTTCTTCCCCATAATGGAGG + Intergenic
946961017 2:224986042-224986064 ACTGTGCTTTGGCATGATGGAGG + Intronic
947274381 2:228373586-228373608 ATTGTAATTCCTGATGTTGGAGG - Intergenic
948141073 2:235671698-235671720 ATTCTGTTTCCTCATAATGTAGG + Intronic
1168849804 20:968794-968816 ATTGCTATTCCTGATGATGGTGG - Intronic
1170516428 20:17135082-17135104 ATTGTCCTCCCTCATGTGGGTGG - Intergenic
1172996700 20:39075913-39075935 ATTCCCCTTCCTCATGAAGGTGG + Intergenic
1173734790 20:45352264-45352286 AATGTGATTCCTAATGTTGGAGG + Intergenic
1174490388 20:50889172-50889194 AGTGTGTTTCCTCATTAAGGTGG - Exonic
1174773136 20:53319986-53320008 ATTGGGCTTTCTCATGAAGAAGG - Intronic
1174878748 20:54253861-54253883 AATGTTCTTCATCATGAAGGTGG - Intergenic
1176601765 21:8800679-8800701 GTTATGCTTCCTAATGTTGGAGG - Intergenic
1176626207 21:9094048-9094070 GTTATGCTTCCTAATGTTGGAGG + Intergenic
1176647384 21:9363997-9364019 ATTATGCTTCCTAATGTTGGAGG - Intergenic
1176777934 21:13156263-13156285 ATTGTGCTCAGTAATGATGGAGG - Intergenic
1178027753 21:28487494-28487516 ATTGTGATTCCTTTTGTTGGTGG - Intergenic
1180344051 22:11692230-11692252 GTTATGCTTCCTAATGTTGGAGG - Intergenic
1180365534 22:11934994-11935016 GTTATGCTTCCTAATGTTGGAGG + Intergenic
1181170811 22:21008815-21008837 GGTGTGCTTGCTCTTGATGGTGG + Intergenic
1181637686 22:24181895-24181917 ATTGTGGGTCCTCATCAGGGTGG + Intronic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
952248721 3:31627523-31627545 ATTGTGCTTTTACATGATGAAGG + Intronic
953407129 3:42665051-42665073 AATTTGCTTCCTCATCTTGGAGG + Exonic
953483662 3:43274294-43274316 ACAGTGATTCCTCGTGATGGTGG + Intergenic
957770088 3:84679483-84679505 ATTGTAATTCCCCATGTTGGGGG + Intergenic
959167565 3:102799510-102799532 ATTGTGATTCCCAATGTTGGGGG - Intergenic
962179691 3:133192785-133192807 ATTCTCCTTCCTCATGAAGCTGG - Intronic
962828001 3:139114270-139114292 ATTGTGCTTCGACATTATGATGG - Intronic
963329954 3:143903185-143903207 ATTGTAATTCCCAATGATGGAGG - Intergenic
964547441 3:157849690-157849712 ATTGTAATTCCTAATGTTGGGGG - Intergenic
964878035 3:161392002-161392024 ATTGAGCTTCTTGATGGTGGAGG + Intergenic
966210258 3:177445744-177445766 ATTATGCTTCCTGGTGATAGAGG + Intergenic
967835200 3:193956502-193956524 TTTGAGCATCCTCAAGATGGTGG - Intergenic
1202739495 3_GL000221v1_random:40990-41012 ATTATGCTTCCTAATGTTGGAGG + Intergenic
970665729 4:18334028-18334050 ATTGTGATTCCTAATACTGGAGG + Intergenic
971755471 4:30702318-30702340 ATTGTCCTCCCTAATGTTGGTGG + Intergenic
973073103 4:45889771-45889793 ATTGTGCTTCGTCATGTCAGTGG + Intergenic
973135494 4:46700809-46700831 TTTCTGCTTCATCATGAGGGAGG - Intergenic
973365091 4:49202486-49202508 GTTATGCTTCCTAATGTTGGAGG - Intergenic
973395499 4:49589968-49589990 GTTATGCTTCCTAATGTTGGAGG + Intergenic
973846728 4:54920445-54920467 ATTGCTCTCCCTCATGAGGGTGG - Intergenic
974290912 4:59928906-59928928 ATTATAATTCCTAATGATGGAGG - Intergenic
975926155 4:79456207-79456229 CACGTGTTTCCTCATGATGGTGG - Intergenic
976756167 4:88500112-88500134 ATTGTTCTTCATCATGATCTAGG + Intronic
977979398 4:103305539-103305561 TCTGTGTTTCCTCATGATTGCGG + Intergenic
979783779 4:124689500-124689522 ATTGTCCTTCCTAATGTGGGTGG + Intronic
980860220 4:138490374-138490396 ATCGTCCTTCCTCATTATAGAGG - Intergenic
981357012 4:143800355-143800377 ATTGTAATTCCCCATGATGGTGG - Intergenic
981368543 4:143930953-143930975 ATTGTAATTCCCCATGATGGTGG - Intergenic
981378341 4:144041240-144041262 ATTGTAATTCCCCATGATGGTGG - Intergenic
983965393 4:173802931-173802953 ATTCTGCTTCATCATGATACTGG - Intergenic
985373765 4:189313406-189313428 AATGTGATTCCTAATGTTGGAGG - Intergenic
1202762472 4_GL000008v2_random:124113-124135 GTTATGCTTCCTAATGTTGGAGG - Intergenic
986538778 5:8821795-8821817 ATTATGATTCCTAATCATGGAGG + Intergenic
988220283 5:28336615-28336637 ATTGTTCTACCTCATGATTTGGG - Intergenic
989518374 5:42371611-42371633 ATTTTGGTTCCTCATTCTGGTGG + Intergenic
993667337 5:90716475-90716497 ATTGTCCTTGCTAATGATGACGG + Exonic
993853378 5:93039148-93039170 ATTGTGCTACATCATTATGATGG - Intergenic
995388754 5:111616025-111616047 ATTGTGCTTCCCCCTGTTGCAGG - Intergenic
997142704 5:131399541-131399563 ATTGTAATTCCCAATGATGGAGG - Intergenic
999118008 5:149181836-149181858 TTTGTTCTTGCTCATGATAGAGG + Intronic
999388349 5:151171762-151171784 ATTTTTCTTCCTCATGGAGGAGG - Intergenic
999828641 5:155298454-155298476 ATTTTGCTTCTTCATGAATGTGG + Intergenic
1003876459 6:10441992-10442014 ATTGTAATTCCTAATGTTGGGGG - Intergenic
1006179280 6:32144433-32144455 ATTTTATTTCCTCATGAGGGAGG + Intergenic
1006225678 6:32534849-32534871 ACTGGGCTTCCTCAGCATGGTGG - Intergenic
1007750284 6:44067062-44067084 ATTGTCCTTCCTCAGGAGGGTGG - Intergenic
1007969912 6:46041057-46041079 ATTGTGATACATCAAGATGGTGG + Intronic
1012073321 6:94651864-94651886 ATTGTGCTTGCTGAGCATGGTGG + Intergenic
1012872412 6:104687846-104687868 ATTGTGCCTCCTCCTGCTTGAGG + Intergenic
1013490986 6:110646276-110646298 CTTGTGCTTGCACATGTTGGCGG - Intronic
1014929008 6:127310850-127310872 GTGGTGCTTCCTGATGATTGAGG - Intronic
1015486161 6:133772317-133772339 ACAGTGCTTTCTCATTATGGAGG - Intergenic
1015894154 6:138000138-138000160 ATTGTGATCCCTAATGTTGGAGG - Intergenic
1017188563 6:151627116-151627138 ATTCAGCTTCCCAATGATGGAGG + Intergenic
1018534431 6:164805402-164805424 AGTGTGCTTCATCATCATGGGGG - Intergenic
1019119394 6:169791271-169791293 AATGAGCTTACTCATAATGGTGG - Intergenic
1019972681 7:4554160-4554182 ATTGTGCTCCCTAATGTGGGTGG - Intergenic
1022057481 7:26753975-26753997 ATTATGTTTCTTCATGTTGGTGG - Intronic
1024705177 7:51949680-51949702 ATTATTCTTCCTCATGATTTTGG - Intergenic
1026549339 7:71354147-71354169 ATTGTAATTCCTGATGTTGGAGG - Intronic
1027556283 7:79668525-79668547 AATGTGATTCCTAATGTTGGAGG - Intergenic
1027636302 7:80679450-80679472 ATTCTGCATACTCATGAAGGGGG + Intergenic
1028422817 7:90652280-90652302 ATTATGCTTCCTCATGCAGGAGG - Intronic
1028532058 7:91849090-91849112 ATCCTGCTTCCCCATGCTGGTGG - Intronic
1028791286 7:94855889-94855911 ATTGTACTTCCCAATGTTGGAGG - Intergenic
1030761624 7:113358992-113359014 ATTGTAATTCTTCATGTTGGAGG + Intergenic
1031038192 7:116811060-116811082 ATTATGCTTCCTCAAGATCGAGG + Intronic
1031719416 7:125152723-125152745 AATGTGATTCCTAATGTTGGAGG + Intergenic
1033332734 7:140429609-140429631 AGAGTGCTTCCTGATGATGGTGG - Intergenic
1033828296 7:145219541-145219563 AATGTGTTTCCTAATGTTGGAGG + Intergenic
1035589997 8:805397-805419 ATGGTGCTTCCTCATCTTTGGGG + Intergenic
1035682077 8:1495488-1495510 ATTCTGACCCCTCATGATGGCGG - Intergenic
1035853968 8:2952968-2952990 AATGTGATTCCTCATCATGGTGG - Intronic
1036254132 8:7190871-7190893 ATAGAGCTTCCTGGTGATGGTGG - Intergenic
1036363359 8:8096616-8096638 ATAGAGCTTCCTGGTGATGGTGG + Intergenic
1039512836 8:38105427-38105449 ATTATGCTTCCTCAGGCAGGCGG + Exonic
1045097246 8:98810747-98810769 AATGTGATTCCCAATGATGGAGG + Intronic
1047636040 8:126763693-126763715 ATTGTACTTCCTAATGTTGGGGG + Intergenic
1048523887 8:135183431-135183453 ATTGTAATCCCTCATGTTGGAGG + Intergenic
1052913422 9:33904927-33904949 ATTATGCCTCTTCCTGATGGAGG + Intronic
1053232560 9:36423033-36423055 ATTGTGCTTCATAATTATGAAGG - Intronic
1055320913 9:75082748-75082770 ATTCTCCTTCATCACGATGGAGG - Intronic
1056585920 9:87926946-87926968 ATTGTACTTCTTAATGTTGGAGG - Intergenic
1056610964 9:88125997-88126019 ATTGTACTTCTTAATGTTGGAGG + Intergenic
1057224713 9:93286286-93286308 TTTGTGGTTCTTCATGATGCTGG - Intronic
1057312434 9:93950817-93950839 CTTGTGCTTCCTGAAGCTGGGGG - Intergenic
1057961479 9:99461667-99461689 ATTGTAATCCCTCATGTTGGAGG + Intergenic
1059088146 9:111327026-111327048 CTTGTTCTACCACATGATGGTGG - Intergenic
1059535286 9:115075052-115075074 ATTGAGCTTCCACATTATGCGGG - Intronic
1060748234 9:126151767-126151789 ATTGTGCCTCCCCAGGAGGGAGG - Intergenic
1061958039 9:133973775-133973797 GGTGTCCTTTCTCATGATGGGGG - Intronic
1203749379 Un_GL000218v1:64468-64490 GTTATGCTTCCTAATGTTGGAGG + Intergenic
1203708141 Un_KI270742v1:70947-70969 ATTATGCTTCCTAATGTTGGAGG + Intergenic
1203543236 Un_KI270743v1:108994-109016 GTTATGCTTCCTAATGTTGGAGG - Intergenic
1185719023 X:2367079-2367101 ATTGTGGTTCCTCTTGAAAGGGG - Intronic
1187159799 X:16753745-16753767 ATGGTGCTACCTCATGACGGAGG + Intronic
1188016615 X:25113664-25113686 AATGTGATTCCTGATGTTGGAGG - Intergenic
1189139376 X:38585654-38585676 AATATGATTCCTCATGTTGGAGG + Intronic
1193121302 X:77825204-77825226 ATTGTAATTCCCAATGATGGAGG + Intergenic
1193572709 X:83162806-83162828 ACTGAGCTACCTCTTGATGGGGG + Intergenic
1195122506 X:101769860-101769882 ATTGTGATCCCTAATGTTGGAGG + Intergenic
1195455692 X:105066722-105066744 ATTATTCTTCATCATGAAGGAGG + Intronic
1195477929 X:105308296-105308318 ATTGGGCTACCTTATCATGGAGG - Intronic
1199011004 X:142758976-142758998 ATTGTACTCCCTAATGTTGGAGG + Intergenic
1199657558 X:150011896-150011918 AATGTGATTCCTAATGTTGGAGG - Intergenic
1200125933 X:153814910-153814932 ATTGTGCTAGCACGTGATGGAGG - Intronic
1201162744 Y:11179479-11179501 GTTATGCTTCCTAATGTTGGAGG + Intergenic