ID: 949459605

View in Genome Browser
Species Human (GRCh38)
Location 3:4276101-4276123
Sequence ATAAATTTCCCCAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949459605_949459608 0 Left 949459605 3:4276101-4276123 CCATCTTCCCTGGGGAAATTTAT 0: 1
1: 0
2: 3
3: 43
4: 368
Right 949459608 3:4276124-4276146 TGTCCAGAAATCCACCCCCATGG 0: 1
1: 0
2: 3
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949459605 Original CRISPR ATAAATTTCCCCAGGGAAGA TGG (reversed) Intronic
900731161 1:4261511-4261533 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
901531121 1:9853098-9853120 ATAAATGCCACCAGGGAAGGGGG - Intronic
901961793 1:12832400-12832422 ATAAATTTAATCAGTGAAGAAGG + Intergenic
901963839 1:12849726-12849748 ATAAATTTAATCAGTGAAGAAGG + Intronic
901968401 1:12887184-12887206 ATAAATTTAATCAGTGAAGAAGG + Intronic
901969882 1:12899253-12899275 ATAAATTTAATCAGTGAAGAAGG + Intronic
901976487 1:12948562-12948584 ATAAATTTAATCAGTGAAGAAGG + Intronic
901983801 1:13057457-13057479 ATAAATTTAATCAGTGAAGAAGG + Intergenic
901998013 1:13169312-13169334 ATAAATTTAATCAGTGAAGAAGG - Intergenic
902008685 1:13253208-13253230 ATAAATTTAATCAGTGAAGAAGG - Intergenic
902015290 1:13302527-13302549 ATAAATTTAATCAGTGAAGAAGG - Intergenic
902016773 1:13314599-13314621 ATAAATTTAATCAGTGAAGAAGG - Intronic
902029181 1:13409073-13409095 ATAAATTTAATCAGTGAAGAAGG - Intergenic
902470701 1:16646186-16646208 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
902488103 1:16761274-16761296 AAAAATTTCCCCTGGGAAGCAGG + Intronic
903826410 1:26148773-26148795 AAAACTTCCCCCAAGGAAGAAGG - Intergenic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
906119429 1:43378798-43378820 ATAAATATCCCTAGGGAATCTGG + Intergenic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
907144785 1:52222113-52222135 CTAAATTTCCTAAGGGAACAAGG - Intronic
907320320 1:53597976-53597998 ATGAATTTCACCAGGGAAATTGG + Intronic
907757064 1:57320861-57320883 ATAAATTGCCCCAGGTTACAGGG + Intronic
910760181 1:90725274-90725296 AGAAATTCCCTCTGGGAAGAGGG - Intergenic
913480571 1:119285304-119285326 ATAAAATTAATCAGGGAAGAAGG + Intergenic
913667322 1:121060366-121060388 ATAAAATTAATCAGGGAAGAAGG - Intergenic
914019012 1:143847509-143847531 ATAAAATTAATCAGGGAAGAAGG - Intergenic
914657563 1:149755716-149755738 ATAAAATTAATCAGGGAAGAAGG - Intergenic
914740808 1:150463169-150463191 ATAAATTTTGCCAGGCAAGGTGG + Intronic
914785349 1:150824298-150824320 ATGGATTTCCCAAGGGAAGTAGG - Intronic
915878938 1:159644642-159644664 ATAAAATTAATCAGGGAAGAAGG - Intergenic
915947277 1:160162693-160162715 CCAAATGTCCCCAGGGAAGGGGG + Intronic
916174608 1:162027280-162027302 ATAAAATTAACCAGGGAAGAAGG - Intergenic
917255174 1:173108190-173108212 ACAAATATCACCAAGGAAGAAGG + Intergenic
917402569 1:174666920-174666942 ATAAATTTTCACAGGGCAGTAGG - Intronic
917837884 1:178955103-178955125 ATAAATGTAGGCAGGGAAGAGGG + Intergenic
918217496 1:182405247-182405269 ATAAATTTAATCAGGGAAGAAGG + Intergenic
918368046 1:183829849-183829871 ATAAATTTCACGAGGAAACATGG - Intronic
918627656 1:186676417-186676439 CTAATTTTCCCTGGGGAAGAGGG + Intronic
919056463 1:192576194-192576216 ATAAATTTCTCTAAGGAATAAGG - Intronic
919281633 1:195496499-195496521 ATACAGTTCACCAGGGAAGTGGG + Intergenic
920363209 1:205433612-205433634 ATACATTTCCCCATGCAAGAGGG + Intronic
920517762 1:206599301-206599323 AGGAACTTGCCCAGGGAAGAAGG + Intronic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922502738 1:226109299-226109321 AAAAATAACCACAGGGAAGAAGG - Intergenic
923212645 1:231818639-231818661 AAAAATGTCCCCAAGGAAAAGGG - Exonic
923586089 1:235272596-235272618 ATAATTTTTCCCAAGGATGATGG - Intronic
1063865968 10:10365983-10366005 ATAAATATCCACAGGGGAGCTGG - Intergenic
1064284873 10:13983561-13983583 ATATAATTCCCTAGAGAAGAAGG + Intronic
1064982544 10:21179119-21179141 ATAAAATTAATCAGGGAAGAAGG + Intergenic
1065165111 10:22967877-22967899 GTAGATTTCCTCAGGCAAGACGG + Intronic
1065195155 10:23257210-23257232 GTGAACTGCCCCAGGGAAGAGGG + Intergenic
1065538432 10:26737132-26737154 ATAGACTTCTCCAGGGAAAAAGG - Intronic
1065700887 10:28424334-28424356 ATCAATTTCCCCGGTGAAGGTGG + Intergenic
1065997165 10:31069829-31069851 AGAAACTTCCCCAGGGATGGGGG - Intergenic
1067250106 10:44578787-44578809 AGAAATGTCCCCTGAGAAGAGGG - Intergenic
1067259987 10:44681058-44681080 ATAAAATTCCACAGGGTAGAGGG + Intergenic
1067814430 10:49461968-49461990 ATAAATTAACTCAGGGAAAATGG - Intronic
1068879620 10:62034900-62034922 AAAAATTTCCCTGGGGAAGATGG - Intronic
1070997937 10:80802713-80802735 ATAAAGTCCCCAAGGGAGGAGGG + Intergenic
1071542419 10:86498855-86498877 TTAAATTTCCACAGTTAAGAGGG + Intronic
1071653183 10:87416927-87416949 ATAAATGTCCTTAGGCAAGAAGG + Intergenic
1072181589 10:92986992-92987014 ATAAATTACTCGAGGAAAGACGG - Intronic
1072218744 10:93309874-93309896 TTAAATTTCCCCAAAGCAGAAGG + Intronic
1073062862 10:100742628-100742650 TTAAATTTCCGCAGGGAGGCGGG + Intronic
1073727019 10:106244584-106244606 ATAAATTGCCCAAGGTAACATGG + Intergenic
1074156959 10:110807799-110807821 ATAAAATTCCCCATGGGAGTTGG - Intronic
1075006653 10:118835505-118835527 ACAAATTGCCCCCTGGAAGAGGG - Intergenic
1076191983 10:128489534-128489556 AGAAAGCTCCCCAGGGAGGAGGG - Intergenic
1076287911 10:129319108-129319130 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
1077720519 11:4623905-4623927 TTAATTTTGCCCAGGGATGAAGG - Intergenic
1078065724 11:8078100-8078122 ATCAGTTCACCCAGGGAAGAAGG - Intronic
1078451522 11:11444103-11444125 ACAACTCTCCCCAGGGAAGCCGG + Intronic
1078619795 11:12896705-12896727 ATAAATTCCTACAGAGAAGATGG - Intronic
1079291864 11:19195511-19195533 ATAAATTTCCTCCAGGAACATGG + Intronic
1079464205 11:20713427-20713449 ATATAGTTCACCAGGGAAGTGGG + Intronic
1080266704 11:30408706-30408728 ATAACTTTCCCTAGGAAAAATGG - Intronic
1080789826 11:35512382-35512404 ATAAATTGCCCCAGGTAACACGG + Intronic
1081237927 11:40668476-40668498 ATAAAGTTCGCAAGGGAAGAAGG + Intronic
1081469237 11:43354216-43354238 ATAAATACCCCTAGGGAGGAGGG - Intergenic
1082063869 11:47883000-47883022 TTACATTTCCCCAGAGAAGTGGG + Intergenic
1082624487 11:55466571-55466593 ATAGATTTGTCAAGGGAAGATGG + Intergenic
1084798966 11:71528573-71528595 AAAAACTTCCCAAAGGAAGATGG - Exonic
1084799300 11:71531447-71531469 AGAGGTTTCTCCAGGGAAGAGGG + Intronic
1085657010 11:78324812-78324834 ATAAAACTCCCAAAGGAAGATGG + Intronic
1086503846 11:87480784-87480806 CTAAAGTTGCCCAGGAAAGATGG - Intergenic
1088175605 11:107049975-107049997 ATAAAATTAGTCAGGGAAGAAGG + Intergenic
1089662264 11:119993344-119993366 ATAAATGCCCCCAGGTCAGAGGG - Intergenic
1089897524 11:121946656-121946678 ATGAGTATCCCTAGGGAAGAAGG + Intergenic
1090187757 11:124749412-124749434 AGAAATCTCCCCAAGGCAGATGG + Intronic
1090291514 11:125549880-125549902 GTAAATTTTCCCAGGGATGAGGG - Intergenic
1090511211 11:127377122-127377144 GTAAGATTCACCAGGGAAGATGG - Intergenic
1090511219 11:127377170-127377192 GTAAGATTCACCAGGGAAGATGG - Intergenic
1090511227 11:127377218-127377240 ATAAGAGTCACCAGGGAAGATGG - Intergenic
1092490126 12:8937392-8937414 ATTCATTTGCCCAGGTAAGAGGG + Intronic
1092501676 12:9053588-9053610 ATAAAATTAATCAGGGAAGAAGG + Intergenic
1092719651 12:11428857-11428879 ACACATGTACCCAGGGAAGAAGG - Intronic
1093469217 12:19482845-19482867 ATATAGTTCACCAGGGAAGTGGG + Intronic
1093668926 12:21849082-21849104 ATACATTTCCCCACAGAAAAGGG - Intronic
1094051749 12:26227805-26227827 ATGAATTTGCCCAGGGACCATGG + Intronic
1094716520 12:33019631-33019653 ATACAATTCCCCAAGGATGAAGG + Intergenic
1096200622 12:49679677-49679699 AAAAATTTACCCAGGCATGATGG - Intronic
1096448754 12:51719710-51719732 ATAAAATTCCCTAGGGAATATGG + Intronic
1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG + Intergenic
1098437474 12:70483275-70483297 ATAAGTATTGCCAGGGAAGAAGG + Intergenic
1099041973 12:77667486-77667508 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
1099081533 12:78189163-78189185 ATAAATACCCCCCAGGAAGAGGG + Intronic
1099285669 12:80711457-80711479 ATTAATTTCCCAAGGCAAGCTGG - Intergenic
1099468017 12:83010597-83010619 ATGACTATCACCAGGGAAGAAGG - Intronic
1099481710 12:83175143-83175165 ATAAAATTCCGGAGTGAAGAGGG + Intergenic
1101498666 12:105280415-105280437 AGAAACTTCCCCAGGGATGAAGG - Intronic
1101580371 12:106037279-106037301 ATATCATCCCCCAGGGAAGAGGG + Intergenic
1102255126 12:111410634-111410656 ATAAATGTCCCCGGGGCACAAGG + Intronic
1102582049 12:113895659-113895681 ATGAATTTCTCCAGGGAGGAGGG + Intronic
1102847211 12:116198406-116198428 TTAGATTTCACCAGGAAAGAAGG - Intronic
1102870561 12:116410821-116410843 CTGAATTTCCCCAGAGAAGCTGG + Intergenic
1104178699 12:126357349-126357371 ATATATGTACCAAGGGAAGAGGG + Intergenic
1104641546 12:130470325-130470347 ATTAATTTCCCCAGGGGTAAAGG - Intronic
1106708622 13:32308263-32308285 ATAACTTTCCCAAGGTTAGATGG - Intronic
1107959868 13:45548181-45548203 TTCCATTTCCTCAGGGAAGATGG - Intronic
1108936497 13:55888057-55888079 ATAGTTATCCCAAGGGAAGATGG - Intergenic
1109501269 13:63238791-63238813 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1109792130 13:67262817-67262839 ATAAGTATCACCAGGCAAGAAGG - Intergenic
1110272343 13:73604926-73604948 ACAAATGGCCCCAGGGCAGATGG + Intergenic
1110408926 13:75183132-75183154 ATAAAATTAATCAGGGAAGAAGG + Intergenic
1110520762 13:76473288-76473310 ATAAGTATTGCCAGGGAAGAAGG - Intergenic
1111086685 13:83384342-83384364 ATAAATTTTGCCAGCGAACAGGG - Intergenic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1112337122 13:98524971-98524993 AAAAATTACCCCTGGCAAGAAGG + Intronic
1112687410 13:101846513-101846535 TTAAATTTCAACAGAGAAGAGGG - Intronic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1114477722 14:23009552-23009574 ATTCATTTCCCTAGGGAAGGGGG - Intronic
1114537334 14:23431471-23431493 ATGAATTTCCCCTGGAGAGATGG + Exonic
1115465204 14:33707674-33707696 ATAAACTTCAGCAGGCAAGATGG + Intronic
1117240675 14:53829394-53829416 ATATAGTTTGCCAGGGAAGAGGG - Intergenic
1118386333 14:65258389-65258411 ATAAAATTAATCAGGGAAGAAGG + Intergenic
1119712563 14:76832985-76833007 ATAAAATTGATCAGGGAAGAAGG - Intronic
1119750915 14:77076685-77076707 AAACAATTCCCCAGGGATGATGG + Intergenic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1121659107 14:95621401-95621423 AAAAAATTCCCCAGGGACCAGGG - Intergenic
1122501450 14:102202727-102202749 ATAAATATCTCCAAGGAAGCAGG - Intronic
1122731451 14:103801870-103801892 AGAAATGTGCTCAGGGAAGAGGG - Intronic
1125711297 15:41789008-41789030 ATGAAACTCTCCAGGGAAGAAGG - Intronic
1126348822 15:47723467-47723489 ATAAATTCCCCCCGGGAAATGGG - Intronic
1127691915 15:61404915-61404937 ATAACTTTCCCGAGGGCAGCTGG + Intergenic
1127853843 15:62938734-62938756 CTAACGTTCCCTAGGGAAGAAGG + Intergenic
1128395618 15:67222489-67222511 ATAAATTTTCTCAGTGAAGTAGG - Intronic
1129125944 15:73441533-73441555 AAAAATTTCCCGAGGGAAGATGG - Intergenic
1129360010 15:75018793-75018815 ATAAATTTTACCGGGGAAGTGGG + Exonic
1129576699 15:76756423-76756445 AAAAATTTAACCAGGCAAGATGG + Intronic
1129782330 15:78280882-78280904 ATAACTCTGCCAAGGGAAGAGGG - Exonic
1131602832 15:93867034-93867056 ATAAATTTCCCCTGGAAGGAAGG + Intergenic
1132017973 15:98335856-98335878 ATAAATATTGCCAAGGAAGAAGG - Intergenic
1132268575 15:100502579-100502601 AAAAAATTCCCCAGGAAATAAGG + Intronic
1133470481 16:6070202-6070224 CAAAATCTCCCCAGGGATGATGG - Intronic
1135039873 16:19110071-19110093 AGAAATATGCACAGGGAAGAAGG + Intergenic
1135269053 16:21053325-21053347 ATACATTCTCCCAAGGAAGAGGG + Intronic
1136865001 16:33741317-33741339 ATTATTTTCCTCAGGGAAGAAGG - Intergenic
1136865130 16:33743192-33743214 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG + Intergenic
1137838518 16:51618221-51618243 GTAAATAACCACAGGGAAGAAGG + Intergenic
1138396814 16:56710637-56710659 TCAAAATTCCCCAGGGGAGAAGG + Intronic
1139501666 16:67371404-67371426 ATGACTTTCCCAAGGGCAGAAGG - Intronic
1140374042 16:74430521-74430543 CTAAAGTTCCCCCAGGAAGAAGG - Intergenic
1140526961 16:75631094-75631116 GTTCATTTTCCCAGGGAAGAGGG + Intronic
1140825630 16:78703294-78703316 AGAAATTTTCACAGGAAAGATGG - Intronic
1203126499 16_KI270728v1_random:1589460-1589482 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1142940472 17:3376546-3376568 ATACATATCACCAGGGAAGTGGG + Intergenic
1146228124 17:31085016-31085038 AAAAATTTAGCCAGGCAAGATGG + Intergenic
1150236011 17:63593191-63593213 ATTGGTTTTCCCAGGGAAGAGGG + Exonic
1151520698 17:74627403-74627425 ATAAAATTAATCAGGGAAGAAGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1153863597 18:9239335-9239357 ACAAATTTTCCCACGGAAGAAGG + Intronic
1154009745 18:10564627-10564649 ATAGAGTTTCCCAGGTAAGATGG - Intergenic
1155564990 18:27124195-27124217 AGAAATTGCTTCAGGGAAGAAGG + Intronic
1155841558 18:30651188-30651210 AAAAATGTCGTCAGGGAAGAAGG + Intergenic
1155859624 18:30880813-30880835 GTAAATTTCACCATGGAGGAGGG + Intergenic
1156844454 18:41648163-41648185 ATGAATCTCTCCATGGAAGAGGG - Intergenic
1157733460 18:50024943-50024965 ATAAAATTAATCAGGGAAGAAGG + Intronic
1157872747 18:51245699-51245721 ATAAATTTCCCGAGGGCAGATGG + Intergenic
1157949053 18:52013919-52013941 ATAAAGTTCCAGAGGAAAGAAGG - Intergenic
1158895607 18:61909960-61909982 AGAAATTTCTCCAAAGAAGAGGG - Intergenic
1159572997 18:70141855-70141877 ATTAATTTCCCTAAGCAAGATGG + Intronic
1159862323 18:73663618-73663640 ATAGAATCCCCCTGGGAAGAAGG - Intergenic
1162719904 19:12656210-12656232 ATAAATTTTCCTGGGGAAGCGGG + Intronic
1164423836 19:28121946-28121968 GGAAATTTCCCCAGGGTAAAAGG + Intergenic
1164695258 19:30239173-30239195 TCAAATTTCCCCGGGGAAGATGG - Intronic
1167387159 19:49170720-49170742 CTTAACTTCCCCAGGGAGGAGGG - Intronic
1202703096 1_KI270713v1_random:2966-2988 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
927583314 2:24275140-24275162 ATAGATTTACCAAGGAAAGATGG + Intronic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
928033723 2:27802473-27802495 AAAAATTTCACGGGGGAAGAGGG + Intronic
928089220 2:28363829-28363851 AGAAACTTCCCCAGCCAAGAGGG - Intergenic
928472709 2:31589998-31590020 ATACATGTCACCAGGGAAGCGGG - Intergenic
929420379 2:41784301-41784323 ATTAATTTCCCTAGAGATGAAGG + Intergenic
930465731 2:51747071-51747093 AAAAATTTTCCCAATGAAGAAGG + Intergenic
931116312 2:59170464-59170486 ATAGATGTTCCCAAGGAAGAGGG - Intergenic
932374577 2:71224346-71224368 ATATATTTTCCCTGGGAACAAGG + Intronic
932502536 2:72196347-72196369 CTAAATTTACCCAGGGTATAAGG - Intronic
932943098 2:76193141-76193163 ATAAATTCCTCCAGGGCTGAAGG - Intergenic
933516963 2:83316525-83316547 ATCAATTACCCTAGGGGAGATGG + Intergenic
934628249 2:95883713-95883735 ATTACTTTCCTCAAGGAAGAGGG - Intronic
934628370 2:95885587-95885609 ATTATTTTCCACAAGGAAGAGGG - Intronic
934628498 2:95887463-95887485 ATGATTTTTCCCAAGGAAGAGGG - Intronic
934631069 2:95923034-95923056 ATGATTTTCCTCAAGGAAGAGGG - Intronic
934633519 2:95958127-95958149 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934633645 2:95960009-95960031 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934707950 2:96497836-96497858 ATAAAGTTCCACATGGAAGCTGG - Exonic
934799981 2:97145151-97145173 ATTATTTTCCTCAGGGAAGAGGG + Intronic
934802590 2:97180375-97180397 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934802977 2:97185949-97185971 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934805029 2:97214054-97214076 ATGATTTTTCCCAAGGAAGAGGG + Intronic
934805154 2:97215936-97215958 ATTATTTTCCGCAAGGAAGAGGG + Intronic
934832203 2:97539572-97539594 ATTACTTTCCTCAAGGAAGAGGG - Intronic
934832329 2:97541450-97541472 ATTATTTTCCACAAGGAAGAGGG - Intronic
934832454 2:97543326-97543348 ATGATTTTTCCCAAGGAAGAGGG - Intronic
934833223 2:97554598-97554620 ATTATTTTCCTCAAGGAAGAGGG - Intronic
934833606 2:97560201-97560223 ATTATTTTCCTCAAGGAAGAGGG - Intronic
936474288 2:112826185-112826207 ATAAATTTCTTTACGGAAGATGG + Intergenic
937178328 2:119965409-119965431 ATAAAATTCATCAGGAAAGAAGG - Intronic
937418623 2:121737074-121737096 ATAAATTGCGCCAGGGGCGAGGG + Intergenic
937690251 2:124747440-124747462 ATAAAATTCCCCAAGACAGAAGG + Intronic
938550259 2:132373808-132373830 ATGAATGTTGCCAGGGAAGAAGG - Intergenic
938599400 2:132821752-132821774 ATATAGTTCACCAGGGAAGTGGG - Intronic
939474735 2:142673211-142673233 ATAACCTCCCCCAGGCAAGAGGG - Intergenic
939630369 2:144521343-144521365 AAAAAATTCCCCTGGGAAGTGGG - Intronic
940075379 2:149735706-149735728 ATGAGTATCACCAGGGAAGAAGG + Intergenic
941934061 2:170969704-170969726 AAAAACTTCCCCAGGGAGGGTGG + Intergenic
942127072 2:172837718-172837740 ATAAATTTAGCCAGGCAAGGCGG - Intronic
943301774 2:186211721-186211743 ATAAACTTCCACATGGGAGAAGG - Intergenic
943967447 2:194354689-194354711 GAAAACTTCCCCAGGAAAGACGG + Intergenic
943969748 2:194388596-194388618 ATAAATTTGGTCAGGGAAAAAGG + Intergenic
944026928 2:195181703-195181725 ATAAATTTGCCTTGGGCAGATGG - Intergenic
944290635 2:198000460-198000482 CTAAATTTCCCTGGGAAAGAAGG - Intronic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
945967236 2:216201540-216201562 ATAAAGTTCTCCAGGTAAGGAGG + Intronic
946245485 2:218384872-218384894 ATAAATTACGCCAGGCAAGGTGG - Intronic
948253674 2:236551014-236551036 AGAAACTTCCACAGGGAAGAAGG - Intergenic
1169685298 20:8264884-8264906 CTACATTTCCCCAGGGCAGTAGG - Intronic
1169699228 20:8428035-8428057 ATAAAATTAATCAGGGAAGAAGG - Intronic
1171036824 20:21719434-21719456 ATATATTTCACCAGAGAAAAAGG - Intergenic
1173264561 20:41467440-41467462 ATAATTTTCTCCAGGGATTAGGG - Intronic
1173844600 20:46179931-46179953 AGGAATTTGCCCAGGCAAGAAGG - Intronic
1174852678 20:54010284-54010306 AAAACTGTCCCCAGAGAAGATGG + Intronic
1175296374 20:57911655-57911677 AGAAAGCTACCCAGGGAAGACGG + Intergenic
1175807922 20:61841002-61841024 TTAAATTTCCCTATGAAAGAGGG + Intronic
1178600594 21:33991165-33991187 TAAAATCTGCCCAGGGAAGATGG - Intergenic
1178915390 21:36702999-36703021 CTTAATTTCCCCAGGTATGAAGG - Intronic
1178940792 21:36903404-36903426 ATCACTTTCCCCAGGGCAGCTGG + Intronic
1179046395 21:37848928-37848950 ACGAATTTCCCCAGGGGAGTTGG + Intronic
1180704084 22:17798074-17798096 CTGCATTTCCCCAGGGAACACGG + Intronic
1181328301 22:22068585-22068607 AAATATTTACCCAAGGAAGATGG - Intergenic
1182048999 22:27299087-27299109 ACAAATATCCCCAGGAGAGAAGG + Intergenic
1183178704 22:36244119-36244141 ATATAGTTCGCCAGGGAAGTGGG + Intergenic
1184684503 22:46090047-46090069 GGAAATTTCCCCAGGGAAAGGGG + Intronic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949991633 3:9584050-9584072 ATAAAATTAGCCAGGGAAGAAGG - Intergenic
950149341 3:10674196-10674218 GTAAATTTCCCAAAGGGAGAGGG - Intronic
950587915 3:13909250-13909272 ATACAGTTCACCAGGGAAGTTGG - Intergenic
951793285 3:26510253-26510275 TCAACTCTCCCCAGGGAAGAGGG + Intergenic
952250045 3:31644384-31644406 GTCAATTTCCCAAGGGAAAATGG + Intergenic
952595944 3:35017301-35017323 AAAAATATCCCCAGGGGGGATGG + Intergenic
952943550 3:38460699-38460721 ACAACATTCCCCTGGGAAGAGGG - Intronic
952984906 3:38770509-38770531 ATAGAGTTCTCCAGGGAAGTGGG + Intronic
954298730 3:49688068-49688090 AAAAATTTCCCCTGGGAAGCAGG + Intronic
954892747 3:53946273-53946295 ACAAATATTGCCAGGGAAGAAGG - Intergenic
955364766 3:58301446-58301468 ATGAATATTGCCAGGGAAGAAGG + Intergenic
956190703 3:66605304-66605326 ATAAATGACAGCAGGGAAGATGG + Intergenic
956720014 3:72109311-72109333 GTAAATTTCACTGGGGAAGAGGG + Intergenic
957196352 3:77073156-77073178 ATAAATTGCTCAAGGGAAAAGGG + Intronic
957747783 3:84366745-84366767 AAAAATTTTCCCAGGCAAGATGG - Intergenic
958061741 3:88492357-88492379 ATAAATTTCCACATGAAAGAGGG - Intergenic
959148622 3:102580611-102580633 ATAGTTTTCTCTAGGGAAGATGG + Intergenic
959776071 3:110165033-110165055 ATAAATGGCTCCAGGGGAGATGG - Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960741639 3:120840373-120840395 ATAAAGTGCCCCACTGAAGATGG - Intergenic
961755885 3:129127194-129127216 ATAAACTGCCCAAGGGCAGATGG + Intronic
962408400 3:135119797-135119819 ATAAAGTTCCAGATGGAAGAAGG - Intronic
963044090 3:141089735-141089757 ACAAATTTCCCCAAAGAATAAGG - Intronic
963311345 3:143713596-143713618 TTAAATTTCTTCAGGGAAGGAGG - Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
965615399 3:170586861-170586883 ATAAATTTCACAAGGCAAGAAGG + Intronic
967370083 3:188734660-188734682 TCAAAATTCCCCAGGGAAGGAGG - Intronic
968939097 4:3628785-3628807 ATAAAATTAACCAGAGAAGAAGG + Intergenic
971123969 4:23732232-23732254 AAACATTTCCCCAAGTAAGATGG - Intergenic
972042250 4:34617414-34617436 AGAAATTTCCTCTGGGAATATGG + Intergenic
974375894 4:61075153-61075175 ATAAATTCCACAAGGGCAGAGGG + Intergenic
974878628 4:67727081-67727103 ATAAAATTAGCCAGGGAAGAAGG + Intergenic
975427754 4:74250433-74250455 CTACATTTTCACAGGGAAGATGG - Intronic
975646467 4:76550844-76550866 AAAAATTTCCCCAGGCATGGTGG + Intronic
976662248 4:87551761-87551783 AAAAATTTGGGCAGGGAAGAAGG - Intergenic
977745343 4:100540493-100540515 ATAAAATTGCCCAGAGAAAAAGG + Intronic
977762734 4:100759076-100759098 ATATAGTTCACCAGGGAAGTGGG - Intronic
977777516 4:100938855-100938877 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
978623632 4:110659803-110659825 ATCTATTTGCCCAGGAAAGATGG - Intergenic
979584861 4:122403931-122403953 ATACATGTCACCAGGGAAGTTGG + Intronic
979746720 4:124223832-124223854 ATAAATAAGCTCAGGGAAGAAGG + Intergenic
979915794 4:126431923-126431945 TGGCATTTCCCCAGGGAAGAAGG - Intergenic
980171500 4:129295282-129295304 ACAAATATCTCCAGGGAAGGAGG + Intergenic
980330969 4:131410646-131410668 ATGAATATTCCCAGGAAAGAAGG + Intergenic
980844859 4:138312480-138312502 AGAAATTTGCCCAGGATAGATGG + Intergenic
981417637 4:144511632-144511654 TTAAAATACCACAGGGAAGATGG + Intergenic
981953519 4:150441992-150442014 ATAAATTTCAGAAGGAAAGAAGG - Intronic
982602036 4:157463934-157463956 ATAACTTTCCTCAGGTATGAAGG - Intergenic
983007443 4:162501301-162501323 ATATATTTGCCCAGGCATGAGGG + Intergenic
983914983 4:173282253-173282275 AGAAACTTGCACAGGGAAGACGG - Intronic
984333056 4:178351589-178351611 ATCAATTTCTCCAGGAAAGCAGG - Intergenic
984984716 4:185316785-185316807 ATCAATTTGGCTAGGGAAGATGG - Intronic
985118416 4:186615504-186615526 ATAGACCTGCCCAGGGAAGAAGG - Intronic
985859308 5:2457978-2458000 TTGAATCTGCCCAGGGAAGAGGG - Intergenic
986580810 5:9263930-9263952 ATCAATTTCTGCAGGGGAGATGG - Intronic
986617906 5:9638880-9638902 ATATAGTTCACCAGGGAAGTGGG + Intronic
988042914 5:25911401-25911423 ATTCATTTGCCCAGGGAAGTGGG - Intergenic
989171905 5:38479642-38479664 ATACATTTCAACAGGGAACAAGG + Exonic
989489834 5:42037438-42037460 ATAAAGTTAATCAGGGAAGAAGG + Intergenic
990577852 5:57140575-57140597 AAAAATTTACCCAGGCATGATGG - Intergenic
993855021 5:93063673-93063695 ATAGATTTCCCCAGAGAAACTGG - Intergenic
993979026 5:94520394-94520416 ATGAATTTCACCATTGAAGATGG + Exonic
995820152 5:116220857-116220879 ATAAAATTAATCAGGGAAGAAGG + Intronic
996188568 5:120510912-120510934 ATTAGTTTCCCCAGGCAAGTAGG - Intronic
997075345 5:130668208-130668230 ATAAATTTCCCCATGAAGTAGGG - Intergenic
998036570 5:138922060-138922082 ATAAAGATACCCAGGGCAGAGGG + Intronic
998504756 5:142663510-142663532 ATAAGTTTCCATAGTGAAGAAGG - Intronic
1001994201 5:176142495-176142517 AAAAATTTGCCCAGGTAAAAAGG + Intergenic
1002905186 6:1442625-1442647 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1003309688 6:4958393-4958415 AGAACGTTCCCTAGGGAAGAGGG - Intergenic
1003752298 6:9072964-9072986 ATGAATTTCTCCAGGGATGGTGG + Intergenic
1003849540 6:10207754-10207776 ATAGATCACCTCAGGGAAGAAGG + Intronic
1004122166 6:12834355-12834377 CTCAAACTCCCCAGGGAAGAAGG - Intronic
1004158742 6:13194588-13194610 TTAAATGTACCCTGGGAAGATGG - Intronic
1004162113 6:13223557-13223579 CTAAATGTACCCAGGCAAGATGG - Intronic
1005035150 6:21549147-21549169 ATGAATTTTGCCAGGGAGGAGGG + Intergenic
1005409510 6:25528399-25528421 ATAAATATCCCCAAGGAATAAGG - Intronic
1007271322 6:40639486-40639508 ATCCATGTCCCCAGGGCAGAGGG - Intergenic
1008143751 6:47864012-47864034 TTAAATCTGTCCAGGGAAGAAGG - Intergenic
1008310201 6:49959215-49959237 ATAAATATAGCCAAGGAAGAAGG - Intergenic
1009272465 6:61631253-61631275 ATAAGTTTCCTTAGGGCAGAAGG - Intergenic
1010518487 6:76803344-76803366 ATACAGGTCCCCAGGGAAGTGGG + Intergenic
1010609888 6:77941544-77941566 AGAAAGTTGCCCAGGGCAGATGG + Intergenic
1011400777 6:86959134-86959156 CTGAGTTTCCCCAAGGAAGAGGG - Intronic
1012890190 6:104888277-104888299 ATAAGTATTGCCAGGGAAGAAGG - Intergenic
1012936417 6:105372512-105372534 CTAAATTTTCCCAGGCAGGAAGG - Intronic
1014287731 6:119520213-119520235 ATAAAATTCCCTTAGGAAGAAGG - Intergenic
1014585727 6:123195337-123195359 GTAAATTTTCCCAGGGCAAAAGG + Intergenic
1018318147 6:162577774-162577796 AAAAATTTAGCCAGGCAAGATGG + Intronic
1020153169 7:5699623-5699645 GTACAATTCCCCTGGGAAGATGG - Intronic
1022425701 7:30266842-30266864 ATAAATGTCCCCAGGGAAAAGGG + Intergenic
1022812201 7:33880705-33880727 TTACATTTCCCCAGAGAAGGGGG - Intergenic
1024169819 7:46773099-46773121 AGAAAATTGCCCAGGGCAGATGG - Intergenic
1024994775 7:55264924-55264946 AAAAATTTCACCAAGGAAGGAGG + Intergenic
1025940608 7:66074098-66074120 GGGAATTTGCCCAGGGAAGAAGG - Intergenic
1027707568 7:81553651-81553673 AAAAGTTTTCCCATGGAAGAGGG + Intergenic
1029166904 7:98598488-98598510 ATAAATGTCCCCAGAGATAAAGG - Intergenic
1029800183 7:102938657-102938679 ATACATTTCCCCAGACCAGAAGG - Intronic
1030223683 7:107125634-107125656 TTTACTTTCCCCAGTGAAGAGGG + Intronic
1031447292 7:121871067-121871089 ATAAATTTCCCTAGTAAAAAGGG - Intergenic
1032855549 7:135830580-135830602 CTTAATTTCCCCAGGAAAGAAGG + Intergenic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1033816741 7:145082885-145082907 ATACATGTCACCAGGGAAGTGGG + Intergenic
1035306604 7:157937038-157937060 AGAAATTGCCCCAGTGAAGGGGG - Intronic
1036086889 8:5622167-5622189 ATTAAGTTCCCCAAAGAAGAGGG + Intergenic
1036183790 8:6607148-6607170 ATAACCTGCCCCAGGGGAGAAGG - Intronic
1036291081 8:7491216-7491238 AGGAATTACCCCAGGGAAGTGGG + Intergenic
1036330409 8:7820320-7820342 AGGAATTACCCCAGGGAAGTGGG - Intergenic
1036396019 8:8371896-8371918 AAAAATTTCCCCAAGAAAGTGGG - Intronic
1037855107 8:22366388-22366410 CTAAATTTGCGCAGGGAAGGGGG - Intergenic
1039394738 8:37215593-37215615 AGAGATTTCCCTGGGGAAGATGG - Intergenic
1039656996 8:39421177-39421199 ATAAGTATTGCCAGGGAAGATGG + Intergenic
1039694160 8:39892688-39892710 ATACATTTCCCAAGGAAGGAAGG + Intergenic
1040946065 8:52885178-52885200 ATAAAGTTAATCAGGGAAGAAGG - Intergenic
1043482840 8:80670226-80670248 ATAAATTTCCATAGGGAACTGGG + Intronic
1044232926 8:89799841-89799863 ATAAAGATCAACAGGGAAGAGGG - Intergenic
1044325545 8:90853784-90853806 ACAAATATTGCCAGGGAAGAAGG + Intronic
1045707659 8:104944992-104945014 GCAAATTTAGCCAGGGAAGAAGG - Intronic
1045797153 8:106059671-106059693 ATAAATTCAATCAGGGAAGAAGG + Intergenic
1047657266 8:126991610-126991632 AGAGCTTTCCCGAGGGAAGAAGG - Intergenic
1048295981 8:133213387-133213409 ATGGCTGTCCCCAGGGAAGAGGG + Intronic
1049703028 8:144023627-144023649 AAGAAGTTCCTCAGGGAAGAGGG - Intronic
1050265055 9:3881122-3881144 ATAATTTTACTCAGGGGAGAAGG + Intronic
1052165410 9:25320248-25320270 ATAAATTTCTCAGGGGAATATGG - Intergenic
1052866199 9:33466031-33466053 AGATATGTCCCCAGGGAAGGGGG - Intronic
1053036384 9:34830349-34830371 AGAAATTTCCAGAGGGAAGGGGG + Intergenic
1054451648 9:65406535-65406557 ATAAAATTAACCAGGGAAGAAGG - Intergenic
1055118594 9:72632472-72632494 AGAAGTTTCCCCAGGGCATAGGG + Intronic
1058893162 9:109378668-109378690 ATGATTTTCCCAAGGGGAGATGG - Exonic
1059093666 9:111389321-111389343 ATAAATGTCCACTGGGAAGATGG - Intronic
1059150535 9:111945826-111945848 ATAAATTTCCAGAAGGAAAAAGG + Intergenic
1060020506 9:120126372-120126394 ATAAGTTTCCCCAGGGCAAAGGG + Intergenic
1060282307 9:122222777-122222799 GGCATTTTCCCCAGGGAAGAGGG - Intronic
1060458580 9:123825785-123825807 ATAATTTTCTCCAGGAAAGAGGG - Intronic
1203582578 Un_KI270746v1:25157-25179 ATTATTTTCCTCAAGGAAGAGGG + Intergenic
1185496248 X:556508-556530 ATGACTGTCCCCGGGGAAGACGG - Intergenic
1185537829 X:876265-876287 ATAAAATTAACCAGGGAAGAAGG + Intergenic
1185953045 X:4457694-4457716 CTAAATTTACCCAGTGAGGACGG - Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186596421 X:10986487-10986509 ATAAAGTTCCCCAGATAATAGGG - Intergenic
1187549542 X:20288162-20288184 AAAAATTTAAACAGGGAAGAAGG - Intergenic
1188440865 X:30214730-30214752 ATAAAATTAATCAGGGAAGAGGG - Intergenic
1188923426 X:36008429-36008451 AAAAATCACCCCAGGGAACAAGG - Intergenic
1189639347 X:43050994-43051016 ATATAGTTCACCAGGGAAGTGGG + Intergenic
1189661484 X:43304640-43304662 ATAAAATTCCCTAGGGAATATGG - Intergenic
1191870326 X:65740061-65740083 ATTCATTTGCCCAGGGAAGTGGG - Exonic
1192047982 X:67696661-67696683 CCAAATTCCCCCAGGCAAGAAGG - Intronic
1192325590 X:70129265-70129287 ATAAAATTAATCAGGGAAGAAGG - Intergenic
1193733052 X:85124842-85124864 ATAAATCTACCCAGGGTGGATGG + Intergenic
1194180501 X:90705806-90705828 TTAAATTTACCCTAGGAAGAAGG + Intergenic
1194510106 X:94783346-94783368 ATACATGTCACCAGGGAAGTGGG - Intergenic
1196478686 X:116120840-116120862 AAAAATTTTCCCAAGTAAGATGG - Intergenic
1197033554 X:121848009-121848031 ATAAATTTCCCCACTAAAAAAGG - Intergenic
1197097406 X:122612391-122612413 AGAAATTTCCCTAAGGTAGAAGG - Intergenic
1198227419 X:134658331-134658353 CCAAATTTCCAAAGGGAAGAAGG + Exonic
1198448183 X:136739644-136739666 AAAAATTTAAGCAGGGAAGAGGG + Intronic
1199789380 X:151137756-151137778 ATGAATTTTGCCAGGGAAGAAGG + Intergenic
1200527164 Y:4287966-4287988 TTAAATTTACCCTAGGAAGAAGG + Intergenic
1202586858 Y:26439445-26439467 ATTATTTTCCTCAGGGAAGAGGG + Intergenic