ID: 949460070

View in Genome Browser
Species Human (GRCh38)
Location 3:4282136-4282158
Sequence GTTAAATCCAGTAACAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949460070 Original CRISPR GTTAAATCCAGTAACAATGT AGG Intronic
901490717 1:9595077-9595099 CGGAAATCCAGGAACAATGTGGG - Intronic
904056587 1:27674723-27674745 GATACATCCAGCAACATTGTAGG + Intergenic
904067308 1:27763717-27763739 TTTAAATCAAGGAACAATGGTGG - Intergenic
908053132 1:60254820-60254842 GATAAAACCAGTAATAAAGTTGG + Intergenic
909239435 1:73193484-73193506 GTCCAATCCAGTAACACGGTGGG - Intergenic
909511714 1:76460865-76460887 TGTAAATCCAGTGACTATGTGGG + Intronic
910148445 1:84111263-84111285 GTTGAAGTCAGTAGCAATGTTGG - Intronic
911562900 1:99428476-99428498 GTTAAATGCAGTCATAAAGTTGG + Intergenic
911988171 1:104657901-104657923 GTTAAAACCAGTTACCATGAGGG + Intergenic
913270549 1:117088763-117088785 GTGAAATCCAGCCACAATATGGG - Intronic
913499343 1:119456663-119456685 ATAAAATCCTGTAACATTGTAGG - Intergenic
924512596 1:244740119-244740141 GTTATCTCCAGGAACAATTTGGG - Intergenic
1066492891 10:35911504-35911526 GTTAAGTCTACTAACAATGAAGG - Intergenic
1068216248 10:53986058-53986080 GTTAACTACAGTCACAATTTTGG + Intronic
1068330531 10:55560326-55560348 GATAAGTCCATTCACAATGTTGG - Intronic
1069186311 10:65428119-65428141 GATAAATAAAGTAATAATGTTGG + Intergenic
1071584704 10:86808661-86808683 TTGAAATTCAGTTACAATGTGGG + Intronic
1071741390 10:88362508-88362530 CTTAAATACAGCAACAATGGTGG - Intronic
1075536333 10:123275135-123275157 GTTAAAACCAGTAAAAAGGCAGG - Intergenic
1079440159 11:20505518-20505540 GTTAAACCCAATAACCAAGTTGG + Intronic
1079872098 11:25811216-25811238 GTTAAATGCAGAAACAATTTGGG + Intergenic
1079969795 11:27022308-27022330 GATAATTACAGTAACAATTTGGG - Intergenic
1086100638 11:83095965-83095987 GTCAAATATAGAAACAATGTGGG + Intergenic
1086835650 11:91618668-91618690 GATAAATCCAGTAAAATTGCAGG - Intergenic
1088273012 11:108055051-108055073 CTAAAATCAATTAACAATGTTGG - Intronic
1090592364 11:128286049-128286071 ATTAAATACAGTAACTATGGAGG - Intergenic
1090938516 11:131366737-131366759 GTTAAACCCAATAACAAAGGAGG + Intergenic
1091576410 12:1740500-1740522 GTTAAATGAAGTTACAAGGTGGG - Intronic
1091826791 12:3518835-3518857 GTTAAATCCAGAAACCCAGTAGG + Intronic
1093208236 12:16277198-16277220 GATAAATGAAGTAAGAATGTGGG - Intronic
1094705077 12:32906753-32906775 GTTCAATCCAGTGAAAATATTGG - Intergenic
1101460851 12:104891827-104891849 GATAAATTCAGTAAAATTGTAGG + Intronic
1101649674 12:106665094-106665116 GATGAATCCAGTATCACTGTTGG - Intronic
1106686600 13:32066852-32066874 CTTAAGTCCTGTAAAAATGTAGG - Intronic
1106880119 13:34120073-34120095 GTAGAATGCAGTAACATTGTTGG - Intergenic
1108222951 13:48256358-48256380 GTTAAAGTCATGAACAATGTTGG - Exonic
1109601912 13:64642593-64642615 GTTATTCCCAGTAGCAATGTGGG + Intergenic
1113545317 13:111144492-111144514 GTTAAATGGAGTGAAAATGTAGG - Intronic
1115155939 14:30339189-30339211 TTTAAATCAAGTAACTAAGTTGG - Intergenic
1115592374 14:34876293-34876315 GATAATTACAGAAACAATGTGGG + Intergenic
1116480132 14:45387175-45387197 GTTAAAGGCAGTAAGAATGGAGG - Intergenic
1117963004 14:61180846-61180868 ATTAAAGCCAGTAACAACTTTGG + Intergenic
1119297453 14:73544634-73544656 GTGAAATTCAATAACAATTTAGG + Intronic
1120372847 14:83660020-83660042 TTTAAATCCAGTTATAATGTTGG - Intergenic
1123678077 15:22732834-22732856 ATTTAATCAAGTAAAAATGTGGG - Intergenic
1124330276 15:28807101-28807123 ATTTAATCAAGTAAAAATGTGGG - Intergenic
1127887124 15:63211637-63211659 GTTAAATCCAGTCATAGTTTTGG + Intronic
1137534865 16:49312393-49312415 GTGAAATGATGTAACAATGTGGG + Intergenic
1141918548 16:87119060-87119082 TTTAAAACCAATAACAATTTGGG + Intronic
1143429551 17:6870888-6870910 GTTAAATACATTCACATTGTTGG + Intergenic
1146262499 17:31431172-31431194 GTTACAGCCACTAACAACGTGGG + Intronic
1150940539 17:69688295-69688317 GTTCATACCAGTGACAATGTTGG + Intergenic
1155423949 18:25686335-25686357 GTTAAATCTTGTAAAAGTGTAGG - Intergenic
1155657045 18:28204638-28204660 GTGAAAGCCAGAAACAAGGTGGG - Intergenic
1155932233 18:31719915-31719937 GTTATCTCCAGGAGCAATGTGGG + Intergenic
1156727341 18:40145292-40145314 TTTAAATCAAATAACAATGCTGG + Intergenic
1158916210 18:62133569-62133591 GTTCAATACTGTAAAAATGTCGG - Intronic
1159114403 18:64097129-64097151 GTTATATCCAGTTATAATGATGG - Intergenic
1163854975 19:19694445-19694467 GTTAAATCTATTCACACTGTTGG + Intergenic
1164863139 19:31579124-31579146 ATTAAATTCAGCAAAAATGTTGG + Intergenic
1166968794 19:46548106-46548128 GTTAAATAAAGTCACAAGGTAGG + Intronic
925228745 2:2211080-2211102 GATAAATTCAGTAAAATTGTGGG - Intronic
925726064 2:6873192-6873214 GTAAAATCAAGTTACAATGAAGG - Intronic
925875065 2:8304334-8304356 TCTAAATACAGTAACAATTTGGG - Intergenic
925899931 2:8501780-8501802 GAAAAATACAGTAAAAATGTGGG + Intergenic
926636304 2:15183430-15183452 GTTAAATCCCGTTGCAAAGTAGG - Intronic
927883200 2:26703330-26703352 GTTCAATCCAATACCAATCTAGG - Intronic
928572810 2:32626118-32626140 GTGAATTCCAGTAATAAAGTAGG - Intergenic
929010830 2:37442495-37442517 TTTAAATCCAGTAATTATTTTGG + Intergenic
934611168 2:95737648-95737670 GTAAAAACCAATAACCATGTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937667066 2:124499769-124499791 ATTAATACCAATAACAATGTGGG - Intronic
942550526 2:177111335-177111357 ATTAATTACAGTCACAATGTTGG - Intergenic
942560122 2:177210991-177211013 GTTAAATCGCGAAACAATGTGGG - Intergenic
943218886 2:185077515-185077537 GTTAATTACAGTAACAGTTTAGG + Intergenic
945268991 2:207919855-207919877 GTTAAATCAAGTGACATTGATGG + Intronic
945621989 2:212151406-212151428 GATAAATACAGTAACATTGATGG - Intronic
947619628 2:231581330-231581352 GTTATTCCCAGTAGCAATGTGGG - Intergenic
948626337 2:239271081-239271103 TTTAAAACCAGTAAAAAGGTTGG + Intronic
1170103213 20:12725315-12725337 GTGGAATTCAGTGACAATGTAGG - Intergenic
1178766402 21:35456268-35456290 TTTAAATCCAGTAAGATTTTTGG + Intronic
1179160834 21:38896730-38896752 GTTAAAACCAGAAACAAGGCAGG + Intergenic
1182163039 22:28142744-28142766 TTTGAAACCAGTAACAATGGTGG - Intronic
949460070 3:4282136-4282158 GTTAAATCCAGTAACAATGTAGG + Intronic
958780379 3:98533539-98533561 GAGAAATGCAGTAACAATGCAGG + Intronic
959601718 3:108194137-108194159 GATAAATTCAGTAACATTATAGG + Intronic
963462737 3:145637631-145637653 GTTTAATTCAGTTACGATGTGGG + Intergenic
964858939 3:161179301-161179323 CTTAAAGCCAGTAAAAGTGTGGG - Intronic
965223490 3:165957684-165957706 GTTAAAGCAAATAACAATGTTGG - Intergenic
966022289 3:175229803-175229825 TGTAATTCCAGTCACAATGTTGG + Intronic
966284240 3:178274419-178274441 GTGAATTTCAGTCACAATGTAGG - Intergenic
970159970 4:13178417-13178439 TTTAAATCTAAGAACAATGTGGG + Intergenic
971819427 4:31531702-31531724 GATAAATTCAGTAACATTATGGG - Intergenic
972169137 4:36323742-36323764 GTTAATTCCAGTAACATGTTTGG + Intronic
974185810 4:58444507-58444529 TTTAAAGCAAGTAACATTGTAGG - Intergenic
975603733 4:76130727-76130749 GTTAATTCCTGTACCAATGGTGG - Exonic
976452010 4:85200581-85200603 GTTAAATCCAGGTACTATGAGGG + Intergenic
979913508 4:126401762-126401784 ATAAAATACAGTATCAATGTTGG - Intergenic
983053124 4:163071466-163071488 GTTCAATTTGGTAACAATGTTGG + Intergenic
983139286 4:164128686-164128708 GGTAAATCCATTAATAATTTTGG - Intronic
983269127 4:165540197-165540219 TTCAAATACAGTATCAATGTAGG + Intergenic
985154844 4:186976253-186976275 GCTTAATCCTGTAACAATTTTGG - Intergenic
986831390 5:11582948-11582970 GTTAAATACACTAAGAATTTTGG + Intronic
987700952 5:21397735-21397757 GTTAACTGCAGTCACAATGATGG + Intergenic
987926393 5:24347613-24347635 GTTAGCTGCAATAACAATGTAGG - Intergenic
990089967 5:52031569-52031591 ATTAAATCAACTAAAAATGTGGG + Intronic
990230361 5:53706353-53706375 GTTAAATGCAGTAATGAAGTTGG + Intergenic
991744792 5:69726239-69726261 GTTAAATCCACCCACAATGGGGG - Intergenic
991752913 5:69828988-69829010 GTTAAATCCACCCACAATGGGGG + Intergenic
991796362 5:70305969-70305991 GTTAAATCCACCCACAATGGGGG - Intergenic
991802531 5:70385721-70385743 GTTAAATCCACCCACAATGGGGG + Intergenic
991824172 5:70601553-70601575 GTTAAATCCACCCACAATGGGGG - Intergenic
991832232 5:70704113-70704135 GTTAAATCCACCCACAATGGGGG + Intergenic
991888740 5:71305523-71305545 GTTAAATCCACCCACAATGGGGG - Intergenic
995435049 5:112126306-112126328 TCTAAATCCAATAACAATATAGG + Intergenic
995922321 5:117329151-117329173 GTTAAATCCTGTGAAAATTTAGG + Intergenic
997752111 5:136356608-136356630 CTTAAATTCAGTCTCAATGTTGG + Exonic
999405260 5:151301351-151301373 GTTATCCCCAGGAACAATGTGGG - Intronic
1000136601 5:158358745-158358767 GTTCCCTCCAGCAACAATGTTGG - Intergenic
1004321091 6:14632116-14632138 ATTAAATCCATTCACAATGCTGG - Intergenic
1004796187 6:19088168-19088190 GCTAAATGCAGTAAGAAAGTTGG + Intergenic
1005034408 6:21542544-21542566 GTTATATCCAGGAGCAATTTGGG + Intergenic
1005555172 6:26972213-26972235 GTTAAATCCACCCACAATGGGGG - Intergenic
1008469260 6:51864966-51864988 GATAAATCCAAGAACTATGTGGG + Intronic
1011618227 6:89217601-89217623 GTCAAATGCAGTAAAAATGTTGG + Intronic
1011846445 6:91569344-91569366 CTTAATCCCAGTAAAAATGTTGG - Intergenic
1015482462 6:133727960-133727982 CTTAAATCCAGAAATACTGTGGG + Intergenic
1015667874 6:135651618-135651640 GTTAAATCCAGTATTATTATTGG + Intergenic
1020819740 7:12952237-12952259 GTTATATCGAGTGAAAATGTTGG - Intergenic
1021326160 7:19272420-19272442 GTCAAATCCAGTAACATGTTGGG - Intergenic
1021942530 7:25692451-25692473 GTTAAGTACATTAACATTGTTGG - Intergenic
1022209640 7:28195847-28195869 GTGAAATCCAATATCAATTTGGG - Intergenic
1024316700 7:48026632-48026654 TCTAAATACAGTAACAATGATGG - Intronic
1027351840 7:77319958-77319980 GTTAAATATAGGTACAATGTTGG - Intronic
1027816963 7:82987158-82987180 GTAAAATCCAGCCAAAATGTTGG - Intronic
1028227821 7:88269615-88269637 GGTATATCCAGTGACAATTTTGG - Intergenic
1028294167 7:89106671-89106693 GAAAAATCCTGTAGCAATGTAGG + Intronic
1028345902 7:89781710-89781732 GTTAAATCCAGAAATCAGGTAGG + Intergenic
1034766622 7:153729030-153729052 GTTAAGTGCACTCACAATGTTGG - Intergenic
1035567491 8:651119-651141 CTGAAATGCAGTATCAATGTTGG - Intronic
1037136627 8:15470392-15470414 ATTAAGTCCATTAAAAATGTGGG + Intronic
1044384131 8:91567230-91567252 GTTAAATTCTGTAACCATGTTGG + Intergenic
1048110891 8:131467096-131467118 TTTAAATTGAGTAACAAAGTAGG - Intergenic
1049114460 8:140673963-140673985 TTTAAAACCAGAAACAATCTTGG + Intronic
1052404138 9:28038173-28038195 ATTAAATCCATTACAAATGTTGG - Intronic
1052557620 9:30037473-30037495 GCTAAAATCAATAACAATGTGGG + Intergenic
1053601900 9:39619419-39619441 TTTAATTCCATTAACAAAGTAGG - Intergenic
1053859554 9:42373186-42373208 TTTAATTCCATTAACAAAGTAGG - Intergenic
1054251636 9:62723008-62723030 TTTAATTCCATTAACAAAGTAGG + Intergenic
1054565747 9:66757525-66757547 TTTAATTCCATTAACAAAGTAGG + Intergenic
1054966771 9:71037368-71037390 ATTAAATCCAGTCAAACTGTTGG - Intronic
1055023854 9:71698381-71698403 GTCAAATGCAGTAACACTTTAGG + Intronic
1057709006 9:97420209-97420231 GTTAAATGCAGTAACATAGATGG + Intronic
1058900434 9:109437904-109437926 GTAAAATCCAGTAAGAGTTTAGG - Intronic
1059574129 9:115472203-115472225 TTTAAATCCAGTAACAACCTGGG - Intergenic
1059682730 9:116602119-116602141 ATTAAATCCAGTGACATTTTTGG - Intronic
1187993462 X:24900687-24900709 GGTAAATGCAGGAACAATGAAGG - Intronic
1188248328 X:27860128-27860150 GTTAAAACCAATTAGAATGTGGG - Intergenic
1188662955 X:32782513-32782535 GTTAAATCCAGAAAGAAAATAGG + Intronic
1189840413 X:45070011-45070033 GGAAAAGCCAATAACAATGTGGG + Exonic
1190975255 X:55393489-55393511 ATTATATCCAGCAAAAATGTAGG + Intergenic
1193529314 X:82637087-82637109 GATAAATTCAGTAAAATTGTAGG - Intergenic
1195819900 X:108933060-108933082 GATAAATTCAGTAACGTTGTAGG - Intergenic
1199115356 X:143985577-143985599 GTTAAAACCAGTTACTATGAGGG + Intergenic
1201355503 Y:13093072-13093094 GTTATCCCCAGTAGCAATGTGGG + Intergenic