ID: 949460472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:4287572-4287594 |
| Sequence | AAACACAGCTTCACAAAGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 416 | |||
| Summary | {0: 1, 1: 2, 2: 26, 3: 65, 4: 322} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949460470_949460472 | 25 | Left | 949460470 | 3:4287524-4287546 | CCACATTGATTTTCACTGGTATT | 0: 1 1: 1 2: 1 3: 22 4: 272 |
||
| Right | 949460472 | 3:4287572-4287594 | AAACACAGCTTCACAAAGATAGG | 0: 1 1: 2 2: 26 3: 65 4: 322 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949460472 | Original CRISPR | AAACACAGCTTCACAAAGAT AGG | Intronic | ||