ID: 949460472

View in Genome Browser
Species Human (GRCh38)
Location 3:4287572-4287594
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 2, 2: 26, 3: 65, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949460470_949460472 25 Left 949460470 3:4287524-4287546 CCACATTGATTTTCACTGGTATT 0: 1
1: 1
2: 1
3: 22
4: 272
Right 949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG 0: 1
1: 2
2: 26
3: 65
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type