ID: 949462646

View in Genome Browser
Species Human (GRCh38)
Location 3:4309614-4309636
Sequence GTGTGAAGGGGGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 712}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949462646_949462661 18 Left 949462646 3:4309614-4309636 CCCACCACCTTCCCCCTTCACAC 0: 1
1: 0
2: 4
3: 70
4: 712
Right 949462661 3:4309655-4309677 TGGTAGGCTACACACTCAGTAGG 0: 1
1: 0
2: 1
3: 5
4: 78
949462646_949462658 2 Left 949462646 3:4309614-4309636 CCCACCACCTTCCCCCTTCACAC 0: 1
1: 0
2: 4
3: 70
4: 712
Right 949462658 3:4309639-4309661 CTGCTTCCCATTTCTGTGGTAGG 0: 1
1: 0
2: 7
3: 25
4: 234
949462646_949462654 -2 Left 949462646 3:4309614-4309636 CCCACCACCTTCCCCCTTCACAC 0: 1
1: 0
2: 4
3: 70
4: 712
Right 949462654 3:4309635-4309657 ACCCCTGCTTCCCATTTCTGTGG 0: 1
1: 0
2: 5
3: 33
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949462646 Original CRISPR GTGTGAAGGGGGAAGGTGGT GGG (reversed) Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900991236 1:6099340-6099362 GTGTGTAGGAGGAAGACGGTGGG - Exonic
901735649 1:11310553-11310575 GTGGGAAGGGGCAGGGAGGTGGG - Intergenic
901735657 1:11310571-11310593 GTGGGAAGGGGCAGGGAGGTGGG - Intergenic
901756227 1:11443186-11443208 GTGGTATGTGGGAAGGTGGTTGG - Intergenic
901771357 1:11531940-11531962 GAGGGAAGGGGAAAGGTGGGTGG - Intronic
902583897 1:17426317-17426339 GTGAGAAGGGAGCAGGAGGTGGG - Intronic
903163735 1:21507103-21507125 GTTTGAGGGTGGAAGGTGGCAGG + Intergenic
903168454 1:21537568-21537590 GGGTGTAGGGGGATGGCGGTGGG - Intronic
903854843 1:26331040-26331062 GTGAGAAGGGGCAAGGCAGTGGG - Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904419812 1:30384366-30384388 GTGGGGAGGGGGAAGGTGCCAGG + Intergenic
904703789 1:32375405-32375427 GTGTGAAGTGTACAGGTGGTGGG + Intronic
906146741 1:43565048-43565070 CTGTTGTGGGGGAAGGTGGTGGG - Intronic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907015600 1:51009666-51009688 GAGTGAAGCAGGAAGCTGGTGGG + Intergenic
907255258 1:53174044-53174066 GGGTGAAGAGGGAATGTGGAAGG - Intergenic
907617881 1:55943145-55943167 GTGTGGAGGGGGGTGGTGGCTGG + Intergenic
908718580 1:67097707-67097729 GGGAGAAGGGGGAATGTGGGTGG + Intronic
909528823 1:76658504-76658526 GTGTGAAGGGAGAAAGTGTAAGG - Intergenic
909573305 1:77142772-77142794 GAGAGAAGGAGGAAGGTGATTGG - Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910202544 1:84714205-84714227 GTATGAAGGAGAAAAGTGGTGGG + Intergenic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910654637 1:89607271-89607293 GTGTGATGGGGTGAGGTGGTGGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913551646 1:119922600-119922622 GTGTAAAGGGGAAAGGTGGCGGG - Intronic
913963675 1:143357556-143357578 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914058034 1:144183145-144183167 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914121111 1:144783220-144783242 GTGGGAAGGGGGAAGGGAGGGGG + Intergenic
914747872 1:150512694-150512716 GTGTGAAAGGGGCAGGGGTTAGG - Intronic
914807632 1:151003167-151003189 GTGTGAAGGGGCAGGGTGTGGGG - Intronic
915024964 1:152818950-152818972 GTGTGAGGGAGGAAGGATGTTGG - Intergenic
915816940 1:158977495-158977517 GTGAGAAGAGGGAATATGGTGGG - Intergenic
915982276 1:160427786-160427808 GTGTCAAGGGGGTAAGAGGTGGG - Exonic
916028400 1:160855379-160855401 GTGGGAAGGAGGAAGATGGTTGG + Intronic
916238967 1:162619997-162620019 GTTGGAAGGGGGAAGGTGTTGGG + Intergenic
916955955 1:169835020-169835042 GGATGAATGTGGAAGGTGGTGGG + Intronic
917750858 1:178052141-178052163 GTGAGAAGGTGAGAGGTGGTCGG - Intergenic
918123120 1:181557131-181557153 GTGACAGGGAGGAAGGTGGTGGG - Intronic
918321786 1:183371555-183371577 GTGTGAAGGGGGGAGTCTGTGGG + Intronic
919417985 1:197335186-197335208 GAGTGAAGGAGGAAGGAGATAGG + Intronic
919790643 1:201288731-201288753 GCGTGAGGGGGCAGGGTGGTGGG - Intronic
919848119 1:201654405-201654427 TTGTGATGGGGGTGGGTGGTAGG - Intronic
919856264 1:201708406-201708428 GTTTGAGGGGGGAAGGGGGCAGG - Intronic
920037329 1:203074847-203074869 GGGTGAGGGGGGCAGGTGGCAGG + Intronic
920080650 1:203370455-203370477 GTGTGGAGGGGATTGGTGGTAGG + Intergenic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920924806 1:210330773-210330795 GGGGGAAGGGGGATGGTGTTGGG + Intronic
922465623 1:225844248-225844270 GTGTGTAGAGGCAAGGTGGGTGG + Intronic
922618722 1:226978064-226978086 GTGTGCAGGGGTAAGGTGTGCGG - Intronic
922769940 1:228176307-228176329 GTGGGAAGGGGGAAGCCAGTGGG - Exonic
922850824 1:228732477-228732499 CTGTAAAGGGGTAAAGTGGTAGG + Intergenic
924632738 1:245757137-245757159 GTGTGAAGGGAGGAGGGGATGGG - Intronic
924645962 1:245877483-245877505 GACTGAAGGCGGAAGGTGTTAGG + Intronic
1063880814 10:10530025-10530047 GTGTGAAGGGGAATGGTGAGTGG - Intergenic
1064154325 10:12891083-12891105 GTAGGAAGGGGGAAGCTGGCAGG + Intergenic
1064205417 10:13319893-13319915 CTGTGTAGGGGTAAGGTGTTTGG + Intronic
1064313227 10:14230778-14230800 GCTTGAAGGTGGAAGGTGGAAGG - Intronic
1065177375 10:23092065-23092087 GTGTAAAGGAGAATGGTGGTAGG + Intergenic
1065178806 10:23104727-23104749 GTGTCAAGAGGGAAGATGGCTGG - Intronic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1068206727 10:53864406-53864428 GGGGGAAGGGGGAAGGTTTTAGG - Intronic
1068963698 10:62890834-62890856 GTGTGAAGGAGGATTGTGGTGGG - Intronic
1069720265 10:70545174-70545196 GGGTGGTGGGGGTAGGTGGTGGG + Intronic
1069781248 10:70957107-70957129 CTGAGAAGGGGGCAGGGGGTGGG - Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1070920981 10:80186284-80186306 GACTGAAGGGGGAAGGAGGGGGG + Intronic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1071711498 10:88054203-88054225 GAGTGAGGGTGTAAGGTGGTTGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072306730 10:94114909-94114931 GTGGGATGGGGGAAGGGGGGAGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072522492 10:96240723-96240745 GTGTGGAGGTGAATGGTGGTGGG + Intronic
1072746219 10:97941045-97941067 GTGGGAAGGTGGATGGGGGTGGG - Intronic
1073047784 10:100651006-100651028 GTGGGAGTGGTGAAGGTGGTGGG - Intergenic
1073047801 10:100651060-100651082 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047814 10:100651096-100651118 GTGGGAATGGTGGAGGTGGTGGG - Intergenic
1073047820 10:100651114-100651136 GTGGGAATGGTGGAGGTGGTGGG - Intergenic
1073047838 10:100651168-100651190 GTGGGAGTGGTGAAGGTGGTGGG - Intergenic
1073047843 10:100651186-100651208 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047856 10:100651222-100651244 GTGGGAATGGTGGAGGTGGTGGG - Intergenic
1073047903 10:100651366-100651388 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047915 10:100651402-100651424 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047938 10:100651474-100651496 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047957 10:100651528-100651550 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047964 10:100651546-100651568 GTGGGAATGGTGGAGGTGGTGGG - Intergenic
1073048005 10:100651675-100651697 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048022 10:100651720-100651742 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048039 10:100651765-100651787 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048056 10:100651810-100651832 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048073 10:100651855-100651877 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048090 10:100651900-100651922 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048107 10:100651945-100651967 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048124 10:100651990-100652012 GTTGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048154 10:100652080-100652102 GTGAGACTGGTGAAGGTGGTGGG - Intergenic
1073614260 10:104976908-104976930 GTGGGGTGGGGGAAGGTGGGAGG + Intronic
1074326389 10:112455339-112455361 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074585309 10:114762614-114762636 GGGTGAGGAGGGAAGGTGGTTGG - Intergenic
1075122677 10:119675820-119675842 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1075585439 10:123653796-123653818 GGGAGAAGGGGGAAGGGGGGAGG + Intergenic
1075656241 10:124163001-124163023 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1075806047 10:125189548-125189570 GAGTGAAGGAGGAAGGAGTTTGG - Intergenic
1076364787 10:129914799-129914821 GGGTGCAGGGAGAAGGTGGGGGG - Intronic
1076521787 10:131085762-131085784 GTGTGCAGGGGGACTGTGGGAGG - Intergenic
1077466374 11:2735543-2735565 GTGAGGAGGGAGAGGGTGGTGGG - Intronic
1077779262 11:5307648-5307670 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1077779267 11:5307655-5307677 GAGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806579 11:5596526-5596548 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806583 11:5596533-5596555 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077887022 11:6394082-6394104 GTGGGATAGGGGAAGGAGGTTGG + Intronic
1077964307 11:7111498-7111520 CTGTGAAGAGGGAGGGTCGTAGG - Intergenic
1078590965 11:12640847-12640869 GTATGGTGGGGGGAGGTGGTGGG - Intergenic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1079045692 11:17100665-17100687 GTAGGAAGGGGGATGGTGGATGG - Intronic
1079078522 11:17398000-17398022 GTGTGCAGGGGCTAGGGGGTAGG - Intronic
1079547143 11:21646151-21646173 GTGTTGGGGGGGAAGGTTGTGGG + Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080194517 11:29593195-29593217 AAGTAAAGGGGGAAGGTGCTAGG + Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081441690 11:43087780-43087802 GAGTTAAAGGGGAAGGGGGTGGG + Intergenic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1082244431 11:49905189-49905211 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082244481 11:49905299-49905321 GGGGGAAGGGGGAAGGGGGAGGG + Intergenic
1083024389 11:59537646-59537668 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083722427 11:64609958-64609980 ATGTGAAGGTGGAATGTGGCTGG - Intronic
1084090734 11:66878129-66878151 GTGAGGAGGGGGAGGGTGCTAGG - Intronic
1084180348 11:67442906-67442928 GTGTGTCGGGGGCAGGAGGTGGG + Intronic
1084444654 11:69196616-69196638 GGCTGAAGGGGGAGGTTGGTGGG + Intergenic
1084555840 11:69875392-69875414 GTGTGAGTGGGGAGGGGGGTTGG - Intergenic
1084608964 11:70188701-70188723 GTGTGATGGGGGCAGGTGTGTGG - Exonic
1084618221 11:70250809-70250831 GTCTGATGGGGGAGGGCGGTGGG - Intergenic
1084622665 11:70283764-70283786 GGGAGAAGGGGGACGGGGGTGGG + Intronic
1085122282 11:73974849-73974871 GTAGAAAGAGGGAAGGTGGTAGG + Exonic
1085323993 11:75592819-75592841 GGGTGAAGGGGTAAGGAAGTGGG - Intronic
1085397472 11:76213897-76213919 GTGTGAAGGGGGGATGTGGTGGG + Intergenic
1085446897 11:76606748-76606770 GTCTGGAGAGGGAAGGTGGCAGG - Intergenic
1085501726 11:77030626-77030648 GAATGAAGGGGGAAAGAGGTGGG - Intergenic
1085639028 11:78179658-78179680 GAGGGAAAGAGGAAGGTGGTTGG - Intronic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087774318 11:102243557-102243579 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1087982356 11:104631649-104631671 GGGTCATGGGGTAAGGTGGTGGG - Intergenic
1088339288 11:108745038-108745060 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339292 11:108745045-108745067 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339296 11:108745052-108745074 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088469412 11:110177257-110177279 GTGGGAAGTGGTGAGGTGGTGGG + Intronic
1088577497 11:111285877-111285899 GGGTGAAGGGGTAAGGAGGCGGG - Exonic
1088813464 11:113406653-113406675 GTGGGAAGGGGGTACCTGGTAGG - Intergenic
1089518347 11:119047870-119047892 GTGGGGAGTGGGAAGCTGGTAGG + Intronic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1090537194 11:127656168-127656190 GTGTGTAGGTGGAAGTTTGTGGG + Intergenic
1091440897 12:511347-511369 GGTTGAAGGTGGAAGGTGGAAGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092120783 12:6042306-6042328 TTGTGAAGGGGCAGGGTTGTGGG - Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1093112669 12:15170338-15170360 GTGTGTAGGGGGAAGGGAGTGGG + Intronic
1094449531 12:30570007-30570029 GTGGGAGGGGGGCAGGTAGTGGG - Intergenic
1095883852 12:47167927-47167949 TTTTGATGAGGGAAGGTGGTCGG + Intronic
1095886427 12:47193404-47193426 GTGGAAAGGGGGAAGGGGGCAGG - Intronic
1096110655 12:49027199-49027221 GTGCCAAGGGGGAAGGGGGCGGG + Exonic
1096791724 12:54049098-54049120 GGATGAGGGAGGAAGGTGGTGGG + Intronic
1097021063 12:56021139-56021161 CAGTGAAGGGGGTGGGTGGTGGG - Intronic
1097465209 12:59914497-59914519 GTGTGATGGAGGAAGGTAGAAGG - Intergenic
1098359801 12:69643240-69643262 GTCTGCAGTGGGAAGGTGGCTGG - Intergenic
1099509276 12:83513229-83513251 CTGTGATGGGGGAGCGTGGTGGG + Intergenic
1099666758 12:85640611-85640633 GTATGAAGGGGAAAGGGAGTTGG + Intergenic
1099900750 12:88708997-88709019 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1100175732 12:92028970-92028992 GTGTGAGAGGGAAAAGTGGTGGG - Intronic
1101823539 12:108202698-108202720 GTTTGAAGGTGCAGGGTGGTAGG + Intronic
1101980277 12:109399953-109399975 GTGGGAAGGGGGAGTGTGTTGGG - Intronic
1102454654 12:113064023-113064045 GGGAGAAGGGGGAAGGGGGAAGG - Intronic
1103173090 12:118838778-118838800 GGGAAAAGGGGGAAGGTGGAAGG - Intergenic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103836941 12:123829178-123829200 AAGTTGAGGGGGAAGGTGGTTGG + Intronic
1104172507 12:126295849-126295871 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1104687485 12:130797185-130797207 TTACAAAGGGGGAAGGTGGTGGG - Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1106555793 13:30807451-30807473 GTGTTAAGGTGGAAAGTGGCTGG + Intergenic
1106620917 13:31369873-31369895 GTGTGCTGGTGGTAGGTGGTAGG + Intergenic
1106666370 13:31855188-31855210 GTGTGAGGGGGCAGGGAGGTGGG + Intergenic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1107192105 13:37601541-37601563 GTGTGAAGAGAGACGGTGGGGGG - Intergenic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1109181585 13:59220086-59220108 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1109257169 13:60097402-60097424 GAGGCAAGGGAGAAGGTGGTGGG - Intronic
1109954000 13:69541541-69541563 GTGTGAGTGGGTTAGGTGGTAGG + Intergenic
1110540818 13:76704987-76705009 CTGTGAGGGGGGTAGGGGGTAGG + Intergenic
1110998228 13:82140597-82140619 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1113634867 13:111912656-111912678 TTGTGAAGGGGCAAGGAGGCTGG - Intergenic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1114663552 14:24366198-24366220 GGGTGAGAGGGGAAGGCGGTTGG + Intronic
1116579061 14:46615496-46615518 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1116715326 14:48418643-48418665 TTGTGAAGGTGGAAGGAGCTGGG + Intergenic
1117079072 14:52132817-52132839 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1117143113 14:52810009-52810031 GTCTGAAGTGGGGAGGTGGGGGG - Intergenic
1117516024 14:56502134-56502156 GTGTGGAGGGTGGAGGGGGTGGG - Intronic
1117627102 14:57651372-57651394 GAGTGAAGTGGGTCGGTGGTGGG + Intronic
1117794518 14:59378240-59378262 TTGGGAAGGGGAAAGGTGGAAGG + Intergenic
1118008910 14:61590240-61590262 GCGTGGAGGCGGGAGGTGGTGGG + Intronic
1118506809 14:66422564-66422586 ATGTTAAGGGAGAAGGAGGTTGG - Intergenic
1118780795 14:69006355-69006377 GGGTGGAGGGCGGAGGTGGTGGG - Intergenic
1118884972 14:69859015-69859037 AGGTGAAGGGGGCAGGTGGGAGG + Intronic
1119432038 14:74574855-74574877 GGGAGAAGGGGGAAGGTAGGAGG + Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1120919747 14:89744093-89744115 GTCTGATGGGGGAAGCTGCTAGG - Intergenic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1121835429 14:97087973-97087995 GAGTGGTGGGGGAGGGTGGTGGG + Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1202843877 14_GL000009v2_random:149001-149023 GTGTGAAGTGGGAAAATGGGGGG + Intergenic
1202894261 14_KI270722v1_random:189116-189138 GTGTGAGGGGGGATGGTTTTGGG - Intergenic
1123429283 15:20201226-20201248 GCGTGAAGGTGGAAGGTGCTAGG - Intergenic
1123503624 15:20915485-20915507 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123560871 15:21489159-21489181 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123597110 15:21926450-21926472 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1125530075 15:40407287-40407309 GTGGGAGGTGGGAAGGTGCTGGG + Intronic
1125745110 15:41992560-41992582 CTATGACGGAGGAAGGTGGTGGG - Intronic
1126589416 15:50324333-50324355 GTGTGTAGGGAGATGGTGCTTGG - Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127340098 15:58032354-58032376 GTGGGGTGGGGGAAGGGGGTAGG + Intronic
1127383792 15:58451432-58451454 TTATGAAGGGAGAAGGGGGTGGG - Intronic
1127394053 15:58529430-58529452 GTTTGAAGGGTGAAGGTCATGGG + Intronic
1127486178 15:59419977-59419999 GTGTGAAGGGGAAAGGGGCTGGG - Intronic
1127868566 15:63051258-63051280 GTGTAAAGAGGGAAAGTGCTGGG - Intronic
1127980768 15:64033271-64033293 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1129056209 15:72822193-72822215 GTCTGAAGGGGAAATGAGGTGGG + Intergenic
1129109380 15:73328783-73328805 TGGGGACGGGGGAAGGTGGTTGG + Intronic
1129913253 15:79245426-79245448 GTGTGAAGGGTGAGGGAGATGGG - Intergenic
1130664620 15:85859399-85859421 GTGTGATGGGTGCAGGGGGTAGG + Intergenic
1130926561 15:88389918-88389940 GTGCAAAGTGGGAAGGTGTTTGG - Intergenic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1131995179 15:98126291-98126313 GTGTGAGGGGGGGCAGTGGTGGG - Intergenic
1132066111 15:98732558-98732580 GTGAGCATGGGGAAGGGGGTCGG + Intronic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1202969216 15_KI270727v1_random:216323-216345 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1132712095 16:1273479-1273501 GTGTGAGGGAGGAAGGTGATAGG + Intergenic
1132868179 16:2104063-2104085 GGGGGGAGGGGGAAGGTGATGGG + Intronic
1133774055 16:8884292-8884314 GTGGGAAGCGGGAAGCAGGTGGG - Intergenic
1133869672 16:9675457-9675479 GTGTGAGGAGGGGAGGTGGTAGG + Intronic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1134291709 16:12907034-12907056 GAGGGAAGGGGGAAGGGGGATGG - Intronic
1135047609 16:19168198-19168220 ATGGGAATGGGGAAGGGGGTGGG - Intronic
1135222475 16:20624854-20624876 GTGTGGTGGGGGCAGGTGGGTGG - Intronic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1136855032 16:33648506-33648528 GCGTGAAGGCGGAAGGTGCTAGG + Intergenic
1136995709 16:35186998-35187020 GGGTGAATGGGCAAGGAGGTGGG + Intergenic
1137251581 16:46744985-46745007 ATCTGAAGGGGGAAGTGGGTGGG + Intronic
1137401896 16:48160568-48160590 ATGTGAGGGGAGAAGGAGGTGGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137758361 16:50920283-50920305 GTGTGAAGAGGGCAGCTGGCAGG + Intergenic
1138028691 16:53542103-53542125 GTGTGAAGGTGGAAGGGGCAGGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139228486 16:65256806-65256828 GAGTGAATGGGGATGGAGGTTGG + Intergenic
1139251611 16:65501900-65501922 GTGTCATGGTTGAAGGTGGTTGG - Intergenic
1139340401 16:66264558-66264580 GAGTGAGCGGGGAAGGTGGGGGG - Intergenic
1139573688 16:67828451-67828473 GTGAGAAGGCGGAAGGTGTGGGG - Intronic
1139847882 16:69933353-69933375 GTGGGAACGGGGATGGTGTTGGG + Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1141218490 16:82047015-82047037 GTCTGAATGCGGAAGGTGCTTGG - Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141545399 16:84764319-84764341 TGGTGAAGGGGGAAGGTGTGAGG + Intronic
1141745362 16:85922167-85922189 TTGAGAAGGTGGAAGGTGTTAGG + Exonic
1141935803 16:87237040-87237062 GTGTTAAGCGGGAGGGTGGCAGG - Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1203116614 16_KI270728v1_random:1496991-1497013 GCGTGAAGGCGGAAGGTGCTAGG + Intergenic
1143432971 17:6900356-6900378 GTGTGGTGGTGGAAGGTGGGAGG + Intronic
1143485244 17:7250750-7250772 GTGTCAAGGGTGGAGGTGGGTGG - Intronic
1143738074 17:8927892-8927914 GGGTGCAGGGGGAAGGTGCCAGG - Intronic
1143896095 17:10137350-10137372 GGGTGAGGGGGGCAGGTTGTGGG - Intronic
1145046329 17:19619801-19619823 CAGTGATGGTGGAAGGTGGTAGG - Intergenic
1145239003 17:21228618-21228640 GAGTTAAGGAGGAAGGTGGCTGG + Intergenic
1145786220 17:27595616-27595638 GGGTGAAGGGAGAAAGTGGGGGG - Intronic
1145795201 17:27651410-27651432 GTGTGGCGGGGGAGGGGGGTTGG - Intergenic
1146352996 17:32111510-32111532 GCCTGAAGGCGGCAGGTGGTGGG + Intergenic
1146827977 17:36040626-36040648 GACTGAAGGGGAAAGGTGGAGGG + Intergenic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147500211 17:40955809-40955831 GTGTGATGGGGGCAGGTGATGGG + Intergenic
1147914831 17:43879981-43880003 GTGTCTAGGGGGATGGGGGTAGG + Exonic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148747966 17:49928964-49928986 GTGTGGAGGGGGAAGGCTGTGGG - Intergenic
1149080837 17:52655306-52655328 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1149126856 17:53245126-53245148 GTGTGCGGGGGGAGGGAGGTGGG - Intergenic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151529475 17:74695372-74695394 GAGTGAAGGGGGAAGCTGGAGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151849980 17:76684495-76684517 GTGTGGAGGGAAAAGGTGGCGGG + Intronic
1152120721 17:78416681-78416703 GTGGGAGGGTGGAGGGTGGTAGG + Intronic
1152223934 17:79083978-79084000 GTGTGATGGGAGAAGCTGGTGGG - Intronic
1152409678 17:80117158-80117180 GGGTGGAGGGGGCAGGTGGGAGG - Intergenic
1152525280 17:80884835-80884857 GTGGCAACGGGGAAGGAGGTGGG - Intronic
1152784098 17:82239118-82239140 GTTTTGAGGGGGAAGGTGGCGGG + Exonic
1152848277 17:82615873-82615895 GTCTGAAGGCGGCAGGTGGTGGG + Exonic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154177432 18:12094405-12094427 ATGTGATGGGGGACTGTGGTGGG + Intronic
1154177487 18:12094551-12094573 ATGTGATGGGGGACTGTGGTGGG + Intronic
1154466178 18:14643924-14643946 GTCTGCAGGGGCCAGGTGGTAGG + Intergenic
1155530968 18:26765906-26765928 GTGGGGTGGGGGAAGGGGGTAGG + Intergenic
1155530972 18:26765913-26765935 GGGGGAAGGGGGTAGGGGGTAGG + Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156141358 18:34115480-34115502 GTGCTAAGGGGGAGGGGGGTGGG - Intronic
1156457278 18:37301907-37301929 GGGGGAAGGGGAAAGGTGGGTGG - Intronic
1157122641 18:44925982-44926004 CTGGGAAGGGGGAAGTTGTTGGG + Intronic
1157198683 18:45640947-45640969 GTGAGAAGAGGCAAGGAGGTGGG - Intronic
1157564429 18:48670348-48670370 GTGTAATGGGGCAAGGTGGATGG + Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157716929 18:49894279-49894301 GTGGGAGGGGGGGCGGTGGTGGG + Intronic
1158208517 18:55021161-55021183 ATGTGAAGTGGGAGGGAGGTAGG - Intergenic
1158408234 18:57179400-57179422 GTGTGTAGGTGGGAGGTGGCAGG + Intergenic
1158546793 18:58404194-58404216 GGCTGATGGGCGAAGGTGGTTGG + Intergenic
1159183576 18:64942758-64942780 CTCTGAAGGGGGAATGAGGTGGG - Intergenic
1160492497 18:79349900-79349922 GTGTGAAGGTGCATGGTGGGGGG - Intronic
1160686814 19:440711-440733 GCGTGAAGTGGGAGGGAGGTGGG + Intronic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160866247 19:1257483-1257505 GAGTGAAGGGTGAAGGAGGTAGG - Exonic
1160872128 19:1282365-1282387 GTATGAAGGGGGAAGGAAGGAGG + Intergenic
1160886402 19:1351011-1351033 GTGTGAAGGGGGCTGGTAATTGG + Intergenic
1160951324 19:1668986-1669008 GTGTGACGGGGGAGTGTGGCTGG - Intergenic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161366080 19:3880624-3880646 GTGTGCAGGGAGGAGGGGGTGGG - Exonic
1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG + Intergenic
1161794410 19:6378189-6378211 GGGAGAAGGGGGAGGGAGGTTGG + Intronic
1162059506 19:8086094-8086116 GAGTGAAGGGGGCAGGCAGTGGG + Intronic
1162934395 19:13974191-13974213 GAGTGAAGCAGGAAGGGGGTGGG + Intronic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1165674067 19:37706282-37706304 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166178406 19:41090375-41090397 GTGTGGCGGGAGAAGGGGGTTGG - Intronic
1166251038 19:41570917-41570939 GGGTGAAGTGGGGAAGTGGTGGG + Intronic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1166385621 19:42378916-42378938 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167444563 19:49529700-49529722 GTGTGGAGGGGAGAGGTTGTTGG + Intronic
1167452999 19:49583400-49583422 GTCTGAAGGAGGAAGGGGCTGGG - Intronic
1167494262 19:49808729-49808751 GTGTGAAGGGGGAAGCCACTGGG + Exonic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167690727 19:50982737-50982759 GTCTGAGGGAGGAAGGTGCTAGG - Intronic
1167798590 19:51726530-51726552 GTCTGAAGGAGGAGGGTGCTGGG - Intergenic
1168172314 19:54596892-54596914 GAGTGAAGGGGGAAGGTCTGCGG + Intronic
1168296654 19:55380322-55380344 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1202697518 1_KI270712v1_random:135813-135835 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
925055425 2:853518-853540 AAGAGAAGGGTGAAGGTGGTGGG - Intergenic
925248970 2:2413044-2413066 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
925947224 2:8876712-8876734 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
927168692 2:20350717-20350739 GGGTGGGGGGGGAGGGTGGTAGG - Intronic
927207038 2:20617308-20617330 GTGTGAAGGGGGAAGGCAAATGG + Intronic
927670656 2:25066110-25066132 GTGTGACGTGGGGAGGTGGGGGG - Intronic
927854655 2:26520437-26520459 GTGTGAGGGGAGGAAGTGGTAGG + Intronic
928106739 2:28475414-28475436 TGGAGAAGGAGGAAGGTGGTGGG - Intronic
928239135 2:29571355-29571377 GTGTCAAGGGAGGAGGTGATTGG + Intronic
928406494 2:31018972-31018994 GCGTGAAGGGGGCCGGTGATGGG + Intronic
928516639 2:32050472-32050494 GGGGGCAGGGGGAGGGTGGTCGG - Intergenic
928559840 2:32469522-32469544 GTGTGGTGGTGAAAGGTGGTGGG + Exonic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929057173 2:37888411-37888433 ATGTGATGGGGGAAGATGGCGGG + Intergenic
929687496 2:44047231-44047253 GAGTGAAGGGGGAGGATGGATGG + Intergenic
929821264 2:45275764-45275786 GGGTGAAGGGGGTAGGAGGTGGG - Intergenic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
930297582 2:49574302-49574324 GGGTGAAGGGAGAGGGTGGTAGG + Intergenic
930526508 2:52536881-52536903 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
932257684 2:70301618-70301640 GCGTAAGAGGGGAAGGTGGTGGG + Intronic
932585092 2:73022625-73022647 GGGGGAAGGGGGAAGGGGGAGGG + Intronic
933019059 2:77167800-77167822 ATGGGATGGGGGAAGGTGGGAGG + Intronic
933232297 2:79822904-79822926 ATCTGAATGGGGATGGTGGTAGG - Intronic
933278871 2:80310507-80310529 GTGTGAAGGGGCAACATGTTGGG - Intronic
933351108 2:81153067-81153089 GTTGGAAGGGGGAATGTAGTGGG - Intergenic
933761179 2:85673305-85673327 GTGGGAAGGGGTAGGGAGGTAGG + Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
936067006 2:109339932-109339954 GTGAGGAGGAGGCAGGTGGTTGG + Intronic
937387805 2:121452948-121452970 TTGTGAATTGGGAAGGTTGTAGG - Intronic
937860355 2:126703398-126703420 AGATGAAGAGGGAAGGTGGTGGG - Intergenic
938537905 2:132260024-132260046 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
938703324 2:133898615-133898637 GGGTGCAGGGGTAGGGTGGTGGG - Intergenic
939019280 2:136939862-136939884 GTGTGTCGGGGGGTGGTGGTAGG - Intronic
939955196 2:148521895-148521917 GGGTGAAGGGTGGGGGTGGTAGG + Intergenic
941393942 2:164951511-164951533 GTCTTAAGGGTGGAGGTGGTAGG + Intronic
941631426 2:167889359-167889381 GTGTGAAGGCAGCAGATGGTTGG + Intergenic
941998831 2:171626693-171626715 GAGTGCAGGAGGGAGGTGGTGGG + Intergenic
942509934 2:176687166-176687188 GGGTAAAGGGGGCAGGAGGTAGG - Intergenic
942803204 2:179899541-179899563 TTGTGAAGCAGGAGGGTGGTTGG + Intergenic
943030482 2:182679895-182679917 GTGGGTAGGGGGAAGATGGGAGG + Intergenic
944068710 2:195646629-195646651 GTCTGTAGGGGGTTGGTGGTGGG - Intronic
944135814 2:196398087-196398109 GAGTGTAGGGGAAAGGTGGCTGG + Intronic
944580186 2:201125579-201125601 GTGGAAAGGTGGAAGGTGGCAGG + Intronic
944674461 2:202023590-202023612 ATGGGAAGGGGCAGGGTGGTAGG - Intergenic
945267343 2:207903339-207903361 GTGTGCGGGGGTGAGGTGGTGGG + Intronic
946168483 2:217879622-217879644 GTGGGATGAGGGAGGGTGGTTGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946388655 2:219402022-219402044 GTGTGCAGGGGGTGGGTGGTGGG - Intergenic
946453940 2:219806086-219806108 GTGGGAAGTGGGAAAGAGGTGGG - Intergenic
946689140 2:222297843-222297865 GTGTGAAGGGAGTGGGTGGCGGG + Intronic
947286688 2:228524571-228524593 GTGGGAGGGTGGAAGGGGGTGGG + Intergenic
947373764 2:229474789-229474811 CTGAGAAGGAGCAAGGTGGTGGG - Intronic
947996084 2:234529087-234529109 GTGTGAAGGGGGAAAACTGTTGG + Intergenic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948444661 2:238022988-238023010 GTGTGAAGGGGACAGGAGGAAGG + Intronic
948653220 2:239462051-239462073 GAGTGAAGAGGGAGGGTGGCCGG - Intergenic
948720932 2:239899424-239899446 GTGTGATGGAGGAATGTGGAGGG + Intronic
948840214 2:240645068-240645090 GTGGGACTGGGGATGGTGGTCGG + Intergenic
1168743224 20:212898-212920 GTGTGATCAGAGAAGGTGGTAGG - Intergenic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1170765064 20:19282798-19282820 GTGTTTTGGGGGCAGGTGGTTGG + Intronic
1170957199 20:20992014-20992036 GTGGGAAGGAGGAACGTGGAAGG - Intergenic
1171749393 20:29033581-29033603 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1171913858 20:30993593-30993615 GTGGGAAGGGGGGAGGGGGGAGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172768584 20:37363988-37364010 GGATGGAGGGGGAAGGCGGTGGG - Intronic
1174053539 20:47783794-47783816 GCTTGAAAGGCGAAGGTGGTGGG - Intronic
1174157248 20:48523718-48523740 GGGTGAATGGGGAAGAGGGTGGG - Intergenic
1174210401 20:48873818-48873840 GGGAGTAGGGGGAAGATGGTGGG - Intergenic
1174385025 20:50182833-50182855 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1174390963 20:50218019-50218041 GGGTGAAGTGAGAAAGTGGTTGG + Intergenic
1174490350 20:50888868-50888890 GGGTGTCGGGGGAAGGGGGTGGG - Intergenic
1174791295 20:53480762-53480784 GAGTGAAGAGAGAAGGGGGTAGG + Intronic
1175014544 20:55775292-55775314 GTGTGTAGTGGGTAGGTGCTAGG - Intergenic
1176315784 21:5242111-5242133 GTGTTAAGGGGGATGGCGGGTGG + Intergenic
1177051259 21:16237763-16237785 GTGGGAAGGGGAAAAGTGGGAGG + Intergenic
1177348113 21:19900087-19900109 GGGGGAAGGGGGGCGGTGGTGGG - Intergenic
1178568909 21:33716399-33716421 GAGTGAAGAAGGAAGGAGGTAGG - Intronic
1179413578 21:41180321-41180343 CTCTGAAGGGGGAATGAGGTAGG - Intronic
1179438277 21:41376726-41376748 GTGTGTAGGGGGTAGGTTGTAGG + Intronic
1179805270 21:43833199-43833221 GAGTCAAGTGGGAAGGTGGCCGG - Intergenic
1179821476 21:43939738-43939760 GTGTCAAGGGGCCAGGTTGTGGG - Intronic
1180393584 22:12308056-12308078 GTGTTAAGGGGGATGGCGGGAGG + Intergenic
1180406162 22:12556696-12556718 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1181406728 22:22690228-22690250 GTGGACAGGGGGAAGCTGGTTGG + Intergenic
1181682874 22:24507964-24507986 GTGTGCAGCGGAAAAGTGGTTGG - Intronic
1181988064 22:26815457-26815479 GTGTGACGGGTGAGGGAGGTGGG + Intergenic
1182102978 22:27670721-27670743 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182857391 22:33529868-33529890 GTGAGAAGGAGGAAGATGGTTGG - Intronic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183350677 22:37333057-37333079 GTGTGCAGGGAGAAGGTCGGGGG - Intergenic
1183416933 22:37688016-37688038 GTACGCAGGGGGAAGGTGGGAGG + Intronic
1183501131 22:38180097-38180119 GTGTGCTGGGGGAAGTAGGTAGG - Intronic
1183701557 22:39454049-39454071 GTGATATGGGGGAGGGTGGTTGG - Intergenic
1183858644 22:40653257-40653279 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1184255939 22:43287038-43287060 GTGTGATGGGGGCAGCGGGTGGG + Intronic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184458236 22:44623547-44623569 GTGTGCAGGGGCATGGAGGTGGG + Intergenic
1184729711 22:46365823-46365845 GTATGTGGGGGAAAGGTGGTGGG + Intronic
1184729726 22:46365854-46365876 TTGGGTGGGGGGAAGGTGGTGGG + Intronic
1184729738 22:46365884-46365906 GTTGGGTGGGGGAAGGTGGTGGG + Intronic
1184729752 22:46365914-46365936 GTTGGGTGGGGGAAGGTGGTGGG + Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184799874 22:46752842-46752864 GTGTGAAGGGAGAGGGGTGTGGG + Intergenic
1185160979 22:49229731-49229753 GGGAGATGGGGGAAGGAGGTCGG - Intergenic
1185345711 22:50309665-50309687 GTGTGAAGGGGGAACTTGAGGGG - Exonic
1185365930 22:50436763-50436785 ATGTGCAGGGGGCAGGTTGTGGG - Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950718388 3:14865538-14865560 GAGTGAGAGGGGAAGGGGGTGGG - Intronic
950765751 3:15271941-15271963 GTGGGACGAGGGAGGGTGGTGGG - Intronic
952275846 3:31875905-31875927 GTGTGCAGGAGGTAGGAGGTGGG - Intronic
952925625 3:38317246-38317268 GAGGGCAGGGGGAAGATGGTAGG - Intronic
953034999 3:39203555-39203577 GGGAGAAGGGGCAGGGTGGTTGG + Intergenic
954257111 3:49414637-49414659 GTCTGCAGGGAGAAGGTGCTGGG + Intronic
954715289 3:52523807-52523829 GTGAGCCCGGGGAAGGTGGTGGG + Intronic
954981757 3:54752241-54752263 GTGTGAATGGGGAAAATGCTTGG + Intronic
955219432 3:57011556-57011578 GGGTGGCGGGGGAAGGTGGGGGG - Intronic
956493953 3:69804316-69804338 GAGTAAAGGGGAAAGGGGGTAGG - Intronic
956641733 3:71422271-71422293 GTGAAAAGGGGGAGGGTTGTTGG - Intronic
956947371 3:74238484-74238506 GGGGGAAGGGGGAAGGGGGGAGG - Intergenic
957048532 3:75394788-75394810 CTCTGAAGGGAGGAGGTGGTGGG + Intergenic
957812689 3:85246295-85246317 GTGGGGTGGGGGAAGGGGGTAGG + Intronic
958024360 3:88033312-88033334 GTGTGGAGGGAAAAGGTGATTGG - Intergenic
958204887 3:90376812-90376834 GTGTGGTGGGGGGAGGGGGTAGG + Intergenic
958564180 3:95786504-95786526 GTGGGGTGGGGGAAGGAGGTAGG + Intergenic
959682834 3:109115889-109115911 GTGAGGAGGGGCATGGTGGTAGG + Intronic
959839742 3:110960388-110960410 GTGTGGAGGGGGGTGGTGGTTGG - Intergenic
960422371 3:117462881-117462903 GATTGAAGGAGGAGGGTGGTGGG + Intergenic
960593591 3:119388610-119388632 GTGGGAAGGAGGAAAGTGGCTGG + Intronic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
961085462 3:124063505-124063527 GTGCGATGGGGGAAGATAGTTGG + Intergenic
961115101 3:124322510-124322532 GAGTGGAGGGGGCAGCTGGTAGG + Intronic
961384205 3:126515483-126515505 GAGTGGAAGGGGTAGGTGGTAGG - Intronic
961815620 3:129548685-129548707 GCGTCAAGGGGCGAGGTGGTGGG + Intronic
962063500 3:131954638-131954660 ATGGGATGGGGGAAGGTGGGAGG - Intronic
962755551 3:138463096-138463118 GTGTGAAGGGAGGTGGTGGCGGG + Intronic
962755799 3:138464705-138464727 GTTGGAAGGGGAAAGGAGGTAGG - Intronic
963630937 3:147729137-147729159 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
966200847 3:177358773-177358795 GGGTGAAGGTGGAAGTGGGTCGG + Intergenic
966941892 3:184753101-184753123 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966941954 3:184753362-184753384 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966941961 3:184753391-184753413 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966941976 3:184753446-184753468 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942053 3:184753754-184753776 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942078 3:184753851-184753873 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966942085 3:184753880-184753902 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942115 3:184753990-184754012 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942140 3:184754087-184754109 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966942242 3:184754487-184754509 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
967276469 3:187780326-187780348 GTGTGTAGGGGGCAGAAGGTTGG - Intergenic
967877206 3:194275615-194275637 GGCTGAAGGGGGAAGGCTGTCGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968266955 3:197369871-197369893 GAGAGAAGGGGGAGGGGGGTGGG - Intergenic
968278225 3:197456877-197456899 GTGTGGAGGGAGACAGTGGTCGG - Intergenic
968702900 4:2065154-2065176 GTGTGATGGGGGTGGGTGGCCGG + Exonic
968950042 4:3685942-3685964 GTGTGGGGGGGGTGGGTGGTAGG - Intergenic
969362967 4:6676905-6676927 GTGGGAAGGGAGGAAGTGGTGGG + Intergenic
969410722 4:7026278-7026300 GTGGGAAGGGGAGAGGTGGGAGG - Intronic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970775836 4:19672861-19672883 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
970811090 4:20094801-20094823 GTGAGAAGGGTGATGGTGATAGG + Intergenic
970906245 4:21219715-21219737 GTTTCAAGTGGGAAGGTGTTTGG + Intronic
971367412 4:25988444-25988466 GGGTGAATGTGGAAGGTGATTGG + Intergenic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974711271 4:65598958-65598980 GTGTGAAGGGGGGAGGTTTCAGG + Intronic
974973660 4:68862757-68862779 GTATGCAGGGGGAAAGTGTTAGG - Intergenic
974992455 4:69111191-69111213 GTGTGCAGGGGAAAAGTGTTAGG + Intronic
975084025 4:70315825-70315847 ATGTGCAGGTGGAAGGTGTTGGG - Intergenic
975479190 4:74858771-74858793 GTGTGAAGGTGTAGGGAGGTTGG - Intergenic
976144737 4:82031529-82031551 GTGTGACTGGGGAAGATGGGGGG - Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976161961 4:82211136-82211158 GGGTGGAAGGGGAAGGTGCTGGG + Intergenic
976588854 4:86828969-86828991 ATGTGAAGGAGGATGGTCGTAGG + Intronic
977058778 4:92229310-92229332 GCTTGAGGGGGGAAGGTGGGAGG + Intergenic
977294075 4:95192397-95192419 GTGAGAAGGGGGGAGGAGGTGGG - Intronic
977310560 4:95381911-95381933 GTGTGTATGGGGCAGTTGGTGGG + Intronic
977919247 4:102625489-102625511 GGATGAAGGGGGAAAGAGGTGGG - Intergenic
978234701 4:106444858-106444880 GTGTGAAGGTGGTGGGAGGTGGG + Intergenic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
979082860 4:116364077-116364099 GTCTGAGGGTGGAAGGTGGGAGG - Intergenic
979903282 4:126251190-126251212 GTGGGATGGGGGAAGGAGGGAGG - Intergenic
982322590 4:154094992-154095014 GTGTGAGGGAGGGAGGTGATTGG + Intergenic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
983964393 4:173791888-173791910 GTGGGATGGGGGGAGGTGGGAGG + Intergenic
983985528 4:174055343-174055365 GCGTGAGGGTGGAAGGTGGGAGG - Intergenic
984815368 4:183831124-183831146 GCGTGAGGGGGGATGGTGGGGGG + Intergenic
984911425 4:184676908-184676930 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911429 4:184676915-184676937 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985511999 5:318329-318351 GGGTGAGGGGGGGAGGTGGAGGG - Intronic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
987965925 5:24872563-24872585 GTGTTGAGAGAGAAGGTGGTTGG - Intergenic
988465362 5:31485771-31485793 GTGTGGAGGGGGAAATTGATCGG - Intronic
990254586 5:53953618-53953640 GGGTGGAGGGCAAAGGTGGTAGG + Intronic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
991046819 5:62231663-62231685 GCGTGAAGGCGGAAGGTGCTAGG - Intergenic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
992426958 5:76667704-76667726 GTGAGAAGGGGGAGTGAGGTAGG - Intronic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
993034916 5:82746187-82746209 GTAAGAGAGGGGAAGGTGGTTGG + Intergenic
993730818 5:91420519-91420541 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
994014796 5:94952786-94952808 ATGAGAAGGGTGAAGGTGATGGG - Intronic
995064120 5:107841021-107841043 GTGGTAAGGGGGAAGATGGCAGG + Intergenic
995956200 5:117779188-117779210 GTGTGGCGGGGGTGGGTGGTGGG + Intergenic
996964931 5:129297006-129297028 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
996984148 5:129537775-129537797 GTGGGATGGGGGAAGGGGGGAGG + Intronic
997199513 5:132001354-132001376 GTGTGGAGAGGGCAGGTGTTGGG - Intronic
997229094 5:132229764-132229786 GTGTGGAGGGGGAAGATGTAGGG - Intronic
997642770 5:135460369-135460391 GTGGCAAGGGGGAAGGAGGCTGG - Intergenic
997856347 5:137376285-137376307 GTCTGCAGGAGGAGGGTGGTAGG - Intronic
997896862 5:137726638-137726660 GTGTGAGGCAGGTAGGTGGTTGG - Intronic
998327561 5:141295070-141295092 GTGTAAAGGGGTAATGTGGGTGG + Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998401397 5:141850749-141850771 GTGTGTAGGGGGGTGGGGGTCGG - Intergenic
998679034 5:144444195-144444217 GTGTGGAGGGGGGAGGGGTTGGG - Intronic
999171209 5:149596863-149596885 CTGTGAAGGGGAAATGAGGTTGG + Intronic
999769132 5:154761760-154761782 ATGTGAAGGGAGAAGGTGATGGG + Intronic
999897551 5:156051848-156051870 GTGTGCTGGGGGAAAGAGGTGGG + Intronic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000166796 5:158657544-158657566 GTGTGAGTGAGGAAGGTGGTAGG - Intergenic
1000443941 5:161297152-161297174 GGCTGAAGTGGGAGGGTGGTAGG + Intronic
1000525724 5:162355170-162355192 GTGTGTGGGGGGTAGGGGGTAGG + Intergenic
1001210173 5:169803681-169803703 GTGTGGAGTAGGATGGTGGTAGG + Intronic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001503379 5:172256283-172256305 GTGTGTTGGGGGCAGGTGTTGGG - Intronic
1001780110 5:174360986-174361008 GCGGGGAGGGGGAAGGTGGGGGG + Intergenic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003381920 6:5632577-5632599 GCGGGAAGGGGGAAGGGGGAAGG - Intronic
1003507680 6:6752923-6752945 CTGTGGAGGGGAAAGGTGCTTGG + Intergenic
1004672322 6:17809257-17809279 GTGTGCTGAGGGAGGGTGGTGGG + Intronic
1004980907 6:21022603-21022625 GTGTGAGGAGGGAAGGGGGATGG + Intronic
1005109303 6:22262061-22262083 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
1006263166 6:32894154-32894176 GGGGGAAGGGGGAAGGCGGAAGG - Intergenic
1006728507 6:36217490-36217512 ATCTGAAGAGGCAAGGTGGTTGG + Intronic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984094 6:38166337-38166359 GTGCGGAGGGGGGAGGTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007289497 6:40774714-40774736 ATGTCAATGGGGAAGATGGTGGG - Intergenic
1007853485 6:44829256-44829278 GAGTGAAGGGGAAAGGAGGTGGG + Exonic
1007944891 6:45817344-45817366 GAGTGACGGGGGGAGGAGGTGGG + Intergenic
1007995353 6:46302067-46302089 GTGTCAAGAAGGAAGGTGATGGG + Intronic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008923003 6:56862366-56862388 GTTTGAGGGGGGAAGATGTTAGG + Intronic
1009211040 6:60863456-60863478 GTGGGGAGGGGGGAGGGGGTAGG + Intergenic
1009376476 6:62977024-62977046 GCATGAATGAGGAAGGTGGTTGG + Intergenic
1009840436 6:69066139-69066161 GTGTGAAGGTTGGAGGTGGGGGG - Intronic
1010091236 6:71984927-71984949 GTGTGAAGGAGGAAGAGTGTAGG - Intronic
1010251096 6:73708140-73708162 GTGGGATGGGGGAAGGGGGAAGG - Intronic
1010507570 6:76679041-76679063 GGGGGAGGGGGGAAGGGGGTAGG + Intergenic
1010768382 6:79801681-79801703 GTGTGTATGGGGAAGGCAGTAGG - Intergenic
1010983816 6:82399676-82399698 GTGGGAGGGGGGAAGTTGGGGGG + Intergenic
1011055393 6:83198552-83198574 GTGTGTAGGGGGAGGGGGTTGGG - Exonic
1011242978 6:85291892-85291914 TTGGGTAGGGGGAAGGAGGTGGG - Intergenic
1012443987 6:99290084-99290106 GTGTGGTGGGGTAGGGTGGTGGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013785204 6:113771968-113771990 GGGTGAAGGGTGTAGGGGGTTGG - Intergenic
1014946933 6:127510090-127510112 TTGAGAAGATGGAAGGTGGTGGG - Intronic
1015247623 6:131092317-131092339 GTGGGGTGGGGGGAGGTGGTAGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1017191244 6:151654907-151654929 GTGTGAAGGTGGAAAGTCTTGGG - Intergenic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018093591 6:160366005-160366027 GTGTCATGGGGGAACCTGGTGGG - Intronic
1018258591 6:161947543-161947565 GTGTGAAGGAGGGAGGTGAGTGG - Intronic
1018890191 6:167977297-167977319 GGGGGGAGGGGGAAGGGGGTAGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019359734 7:598582-598604 GTGTGGAGGGTGATGGTGTTTGG - Intronic
1019361044 7:604336-604358 GTGTGGAGGGGGAAGGCTGGAGG - Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1020011296 7:4807294-4807316 GTGTAAGGGGTGAGGGTGGTGGG - Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020755910 7:12202829-12202851 ATCTGAAGGGGGAGGCTGGTAGG - Intergenic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021717261 7:23471133-23471155 GGGTGAGGGGGGCAGGGGGTGGG + Intergenic
1021934197 7:25614169-25614191 GTGCTGAGGAGGAAGGTGGTAGG + Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022121035 7:27308271-27308293 GTGGGATGGGGGGAGGTGGGAGG - Intergenic
1022372800 7:29786595-29786617 GTGTGAGGAGGGGAGGTGATAGG - Intergenic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023778532 7:43634344-43634366 GGGTGACGGGGGCATGTGGTGGG + Intronic
1024033756 7:45488671-45488693 GTGGGGAGGGGAAAGGGGGTTGG + Intergenic
1024118279 7:46213052-46213074 GTGAGAAGGGTGAAGGCAGTTGG + Intergenic
1024334992 7:48197647-48197669 GTGTGAAGGGAGGATATGGTTGG + Intronic
1024482650 7:49880681-49880703 GTGGGATGGGGGAAGGGGGAAGG + Intronic
1024578099 7:50781357-50781379 GTGGGAACAGGGGAGGTGGTGGG - Intronic
1024743964 7:52386054-52386076 GAGGGAAGGGGGATGGGGGTGGG + Intergenic
1024920054 7:54545922-54545944 GTAAGAGGGGGGAAGGGGGTGGG + Intronic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1027252151 7:76405763-76405785 GTGTGAAGAGGGCAAATGGTGGG + Intronic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1027839668 7:83292783-83292805 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1029849582 7:103447917-103447939 ATGGGAAGGGGGTAGGGGGTGGG - Intergenic
1030395444 7:108980822-108980844 GAGAGAATGGTGAAGGTGGTGGG - Intergenic
1030865652 7:114699057-114699079 TGGTGAAGGGAGAAGGTGGAAGG - Intergenic
1031875022 7:127129958-127129980 GTGTGAGGGAGGAACCTGGTGGG + Intronic
1032120047 7:129149035-129149057 GGGTGGAGGAGGGAGGTGGTGGG - Intronic
1033026115 7:137774541-137774563 GTGTGTAGGGGGAGGGTAATGGG - Intronic
1034083540 7:148302560-148302582 GTGTCAAGGGGGGACCTGGTGGG + Intronic
1034561149 7:151879966-151879988 GTGCGAAGTGGGATGGGGGTGGG + Intergenic
1034952621 7:155310656-155310678 GTGAGGAGGGGTAAGGTGGCAGG - Intergenic
1035293172 7:157853027-157853049 GGGTGAATGGGGAGGGTGGATGG + Intronic
1035629181 8:1095320-1095342 GTCTGCAGAGGGCAGGTGGTGGG - Intergenic
1035905050 8:3500266-3500288 TTGTGAAGGAGGAAAGTGCTGGG + Intronic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1037169396 8:15873868-15873890 GTAGGAAGGGGGAAGGGGGAGGG - Intergenic
1037584736 8:20268691-20268713 GAGTGGAGGAGGAAGGGGGTGGG + Intronic
1037788797 8:21919278-21919300 GAGTCAAGGGGGAAGACGGTTGG + Intergenic
1038317574 8:26500893-26500915 GAGTGTTGGGGGAAGGTGTTAGG + Intronic
1038485161 8:27929927-27929949 GTGTGAGGGAGGAGAGTGGTAGG - Intronic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1039253938 8:35697967-35697989 GTTTGGAGAGGGAAGATGGTGGG - Intronic
1040771757 8:50986623-50986645 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041131060 8:54700966-54700988 GTGTGAAGAGGAAAAGTCGTTGG - Intergenic
1041205881 8:55497846-55497868 GTGTGAGGTGGGAAGGTATTAGG - Intronic
1041620304 8:59959904-59959926 GTGTGAATTGGGTAGGAGGTGGG + Intergenic
1041673152 8:60513047-60513069 GTGGAATGGGAGAAGGTGGTTGG - Intergenic
1042372764 8:68010767-68010789 GTGTAGGGGAGGAAGGTGGTGGG + Intronic
1044727231 8:95203583-95203605 GTGGGCAGGGGCCAGGTGGTGGG + Intergenic
1045593403 8:103625106-103625128 GTTTTTAGGGGGAAGGAGGTTGG + Intronic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1046538835 8:115552417-115552439 ATGTGAAGGGATAAAGTGGTAGG - Intronic
1046683463 8:117197413-117197435 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1047382082 8:124372847-124372869 GCGTGAAGGTGGAAGGAGGTAGG + Intergenic
1047475275 8:125222514-125222536 GGGGGAAGGGGGAAGGGGTTGGG - Intronic
1047907006 8:129483142-129483164 GAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1047907034 8:129483206-129483228 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1048600572 8:135915172-135915194 GTTTGAAGGTGGAGGGTGGGAGG + Intergenic
1048833675 8:138498380-138498402 AAGGGAATGGGGAAGGTGGTGGG + Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1048973275 8:139656997-139657019 GTGTGGAGGGGGCAAATGGTGGG - Intronic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049233520 8:141496391-141496413 TTGTGAAGCAGGATGGTGGTGGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049878976 8:145049079-145049101 GTGGGAAGGGGGATGGTGCAGGG - Intergenic
1050194384 9:3065657-3065679 ATGTTAAGGGGGAAGGGAGTTGG - Intergenic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052470108 9:28883131-28883153 GAGTGAAGGAGGAAGGAGTTTGG - Intergenic
1053650346 9:40162747-40162769 GTGAGAATGGGGAAGATGCTGGG - Intergenic
1053755391 9:41301179-41301201 GTGAGAATGGGGAAGATGCTGGG + Intergenic
1053914168 9:42932553-42932575 GTGTGAAGGTGGCATGTTGTGGG + Intergenic
1054330855 9:63754522-63754544 GTGAGAATGGGGAAGATGCTGGG - Intergenic
1054345489 9:63910655-63910677 GTGTTAAGGGGGATGTTGGAAGG + Intergenic
1054534235 9:66213456-66213478 GTGAGAATGGGGAAGATGCTGGG + Intergenic
1055339843 9:75269531-75269553 ATCTGAAGGGGGAAAGTGCTGGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055354162 9:75420046-75420068 ATGTGAAGGGGGAGAGTGATTGG - Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1056036657 9:82613460-82613482 GGGTGAGGGGGAAAGGCGGTGGG + Intergenic
1056812021 9:89772308-89772330 GTGGGAGCGGGGAAGGTGGTGGG + Intergenic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057437967 9:95059529-95059551 GAGTGAGGGGGTAAGGGGGTAGG + Intronic
1057825822 9:98371323-98371345 GGGTGAAGGTGGCAGGAGGTAGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058779842 9:108321924-108321946 GTGTGAGGTGGGATGGTTGTTGG - Intergenic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1061190236 9:129078627-129078649 GAAAGAAGGGGTAAGGTGGTGGG - Intergenic
1062003238 9:134227177-134227199 GTGGGCAGGGGGATGGTGCTGGG + Intergenic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1203491276 Un_GL000224v1:107777-107799 GTGTGAGGGGGGATGGTTTTGGG - Intergenic
1203503900 Un_KI270741v1:49647-49669 GTGTGAGGGGGGATGGTTTTGGG - Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1185843942 X:3419533-3419555 GCTTGAAGGGGGAGGGTGGGAGG - Intergenic
1185884719 X:3772343-3772365 GAGGGAAGGGGGAAAGGGGTGGG - Intergenic
1188370101 X:29359315-29359337 TTGGGAAGGGTGATGGTGGTTGG - Intronic
1188919815 X:35958966-35958988 CTCTGAAGGTGGAAGGGGGTGGG + Intronic
1189113564 X:38320291-38320313 AGGGGCAGGGGGAAGGTGGTAGG + Intronic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1190298185 X:49040730-49040752 GGGGGATGGGGGAAGGAGGTGGG - Intronic
1190446031 X:50525334-50525356 ATGTGAAGGGGTAAGCTGGTGGG + Intergenic
1190516939 X:51233661-51233683 GTTTGAAGAGGGTTGGTGGTAGG - Intergenic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191932369 X:66388298-66388320 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1193181713 X:78466365-78466387 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195394767 X:104398822-104398844 GTGGGAAGGGGGCAGGAGGCAGG + Intergenic
1195447441 X:104970727-104970749 CTTTGAAGGGGGAATGAGGTAGG - Intronic
1195669732 X:107459511-107459533 GTGGGGAGGGGAAAGTTGGTGGG - Intergenic
1195935026 X:110116897-110116919 GTGTGAAGGGGGGCAGGGGTGGG + Intronic
1196006947 X:110846834-110846856 GTGGGATGGTGGGAGGTGGTGGG + Intergenic
1197229513 X:123988958-123988980 GGCTGAGGGGAGAAGGTGGTGGG - Intronic
1197415340 X:126166316-126166338 GTGTGAAGGGCGGAGGCAGTGGG + Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199967905 X:152834960-152834982 TTGTAAAGGGGAAAGGTTGTCGG - Intronic
1200731558 Y:6748419-6748441 GACTCAAGGGGGAAGGTGGGAGG - Intergenic
1201075198 Y:10181445-10181467 GTGGGAAGGGGGTATGGGGTGGG + Intergenic
1201256346 Y:12111996-12112018 GAGGGAAGGGGGAAGGAGGGAGG - Intergenic
1201512221 Y:14777623-14777645 GTGTGAGGGGGGAAGAGGGAGGG + Intronic
1202187143 Y:22197375-22197397 GTGTGACGGGGGGCAGTGGTGGG + Intergenic
1202204217 Y:22389021-22389043 GTGTGACGGGGGGCAGTGGTGGG - Intronic
1202241114 Y:22770844-22770866 GTGTGACGGGGGGCAGTGGTGGG - Intergenic
1202394100 Y:24404587-24404609 GTGTGACGGGGGGCAGTGGTGGG - Intergenic
1202476685 Y:25265505-25265527 GTGTGACGGGGGGCAGTGGTGGG + Intergenic