ID: 949463027

View in Genome Browser
Species Human (GRCh38)
Location 3:4314324-4314346
Sequence GTTTAGGTATGCAGCCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949463027 Original CRISPR GTTTAGGTATGCAGCCACAA GGG (reversed) Intronic
903812584 1:26043124-26043146 CTTCAGGTATGAAGCCACCAAGG + Intronic
907494103 1:54830925-54830947 GTTAAGGCATGTACCCACAAGGG - Intronic
916300940 1:163273958-163273980 ATTAAGCTATGCAGGCACAATGG - Intronic
918058843 1:181045312-181045334 TAGAAGGTATGCAGCCACAATGG - Intronic
923076223 1:230611083-230611105 ATTAAGGAATGCAGACACAAGGG - Intergenic
1063137158 10:3227933-3227955 GATGAGTCATGCAGCCACAATGG - Intergenic
1069145349 10:64886267-64886289 GTTAAGCTATGCAGACAAAAAGG - Intergenic
1073781534 10:106843982-106844004 GTGTAAATATGCAGCCACTATGG - Intronic
1074591187 10:114814865-114814887 GATTATGTATCAAGCCACAAAGG - Intergenic
1080747725 11:35123671-35123693 GCTTAAATATGTAGCCACAAGGG - Intergenic
1087971473 11:104490363-104490385 CTATGGGTATGCAGCCACAAGGG - Intergenic
1090520166 11:127470667-127470689 GTTTAGCCATGCAGCCACCAGGG + Intergenic
1090706791 11:129344935-129344957 GATTAGGAATGCAGACACATTGG - Intergenic
1097603641 12:61725859-61725881 GCTAAGCTATGCAGACACAAAGG + Intronic
1103127521 12:118436780-118436802 GTTCAGTCATGCAGTCACAAAGG + Intergenic
1109697009 13:65974022-65974044 GTTGTGGTATGCAAACACAATGG - Intergenic
1111382724 13:87479590-87479612 GTGTAAGTATGCAGCCTCCAAGG - Intergenic
1116345009 14:43782413-43782435 GGTTTTGTATGCAGCAACAATGG + Intergenic
1123119212 14:105909148-105909170 CTCTAGGAATGCAGCCACCACGG - Intergenic
1125636125 15:41189979-41190001 GTTTAGGTAACCATCCACCAGGG + Exonic
1128980042 15:72179378-72179400 GTGGAGGTATGCAGCCAGGAGGG + Intronic
1137822884 16:51462536-51462558 GTTAAGCTATGAAGACACAAAGG + Intergenic
1139796420 16:69486502-69486524 GTTTAGGAATGCATCCAGCAAGG + Intergenic
1140141783 16:72265259-72265281 TTTTAGGTATGTAGGCACAGAGG - Intergenic
1140423337 16:74839256-74839278 GTGTAGGGATGCAACCAGAAAGG - Intergenic
1140770551 16:78199956-78199978 ATTTATGTATGGAGCCACAAAGG + Intronic
1145731361 17:27189063-27189085 GTTCAGGTAGGCAGCCAAGATGG - Intergenic
1146248065 17:31308673-31308695 ATTCAGATATGCAGCCAGAAAGG - Intronic
1146570555 17:33948908-33948930 TTTTAGGTATGCAGGCCAAAGGG + Intronic
1148976112 17:51530380-51530402 GTTAAGCTATGAAGACACAAAGG + Intergenic
1150645035 17:66972549-66972571 GTTTAGGGTTGCAGGGACAAAGG + Intronic
1150914730 17:69425071-69425093 ACTTAGGTATGCTGCCACACTGG - Intronic
1152049750 17:77963689-77963711 GTTGTGGTTTGCAGCCACAGAGG - Intergenic
1154090473 18:11355044-11355066 GCTAAGGTACGCAGACACAAAGG + Intergenic
1162019202 19:7861019-7861041 GTGTAGGGAGGCAGCCACAATGG - Intronic
1163856923 19:19709833-19709855 ATTAAGGAATGCAGACACAAGGG - Intergenic
1163965535 19:20743755-20743777 GTTTTAGTATGCTGACACAATGG + Intronic
927470698 2:23373845-23373867 GTTTAGGTATGAAGCCTCTGGGG - Intergenic
928128152 2:28630200-28630222 GTTTAGGAAACCAGCCACAATGG - Intronic
930188701 2:48436133-48436155 GCTTAGGTATGCAGAGAAAATGG + Intergenic
935337874 2:102034021-102034043 GTTTAGATGTGCAGCAGCAATGG + Intergenic
939651388 2:144766973-144766995 CTTTATGTATGCAACCTCAAGGG - Intergenic
944123376 2:196265895-196265917 GTTCAGGTTTGGAGCCAGAAAGG - Intronic
946043376 2:216801644-216801666 TTTTAGCTATGCAGCTACCAAGG - Intergenic
1169525048 20:6415405-6415427 CATTAGGTCTGCAGCAACAAAGG + Intergenic
949463027 3:4314324-4314346 GTTTAGGTATGCAGCCACAAGGG - Intronic
950208170 3:11096116-11096138 GCTTAGTTCTGCAGCCCCAACGG - Intergenic
953809821 3:46102596-46102618 GTTCATTAATGCAGCCACAAGGG + Intergenic
954435936 3:50496168-50496190 GTTTATCTCTGCAGCCAGAATGG - Intronic
961979015 3:131056821-131056843 CTATAGGGATGCAGCCACAGGGG + Intronic
962012562 3:131406804-131406826 GTTTACGTATGCAGCCATTGTGG + Intergenic
967144075 3:186591300-186591322 ATTTATGGAGGCAGCCACAAAGG + Intronic
970436205 4:16037828-16037850 GTTTAGGTAGGCAGTCGCAGAGG + Intronic
970741004 4:19237507-19237529 GTTTAGGGATGAAGGCTCAATGG + Intergenic
973194094 4:47419860-47419882 GCTTAGTTCTGCAGCCCCAAGGG - Intronic
973337062 4:48967362-48967384 GCTTAGGTATGCAACAACAATGG - Intergenic
978264369 4:106804876-106804898 GTATAGGTGTGTAGCAACAAAGG - Intergenic
979133063 4:117073020-117073042 GTTTAGGTCCGCAGCTAAAAGGG - Intergenic
979993959 4:127408734-127408756 GTTTAGATGTGCAGGCACAGTGG - Intergenic
987852226 5:23370865-23370887 GTCTAGATATGAAGCCACCATGG - Intergenic
991170567 5:63620116-63620138 GTTTTTGTTTTCAGCCACAAAGG + Intergenic
991901133 5:71461803-71461825 GTTTATGTATACAGAAACAATGG + Exonic
994885500 5:105556115-105556137 ATTTAGGTATTCAGCCAATAGGG - Intergenic
997011220 5:129880737-129880759 GTTTGAGTATGAAGCCACACAGG - Intergenic
1001048507 5:168394761-168394783 GTGAAGGGATGCAGACACAAAGG + Intronic
1018358637 6:163043588-163043610 GTTCAAGTATGAAGCCACAGGGG + Intronic
1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG + Intronic
1027827066 7:83129137-83129159 GTGTAGCTATCAAGCCACAAAGG - Intronic
1030646935 7:112072426-112072448 GTTTGGGGATGCAGACAAAAGGG + Intronic
1039786194 8:40836173-40836195 GTTTGGGAATTCAGCCACCATGG + Intronic
1045228987 8:100282110-100282132 CTTTGGATATGCAGCCAAAATGG - Intronic
1050491761 9:6195908-6195930 GATCAGGTATGCAGCCACATGGG - Intergenic
1050696916 9:8289753-8289775 GCTGAGGTATGCAGCCAAAGTGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1194212098 X:91082150-91082172 GTCCAGGTCTGCAGCCACAGCGG - Intergenic
1194289953 X:92059529-92059551 GTGTAGATATGAAGCCCCAATGG + Intronic
1194967138 X:100301272-100301294 GTATAGATATCCAGTCACAATGG + Intronic
1196586031 X:117429158-117429180 ATTTAGGCATGGTGCCACAATGG + Intergenic
1197384028 X:125781737-125781759 ATTAAGGAATGCAGACACAAAGG + Intergenic
1199886555 X:152026881-152026903 GTTTAGCCAGGCAGCCACAGTGG + Intergenic
1200393459 X:155968050-155968072 GTTAAGGAGTGCAGACACAAAGG + Intergenic
1200607468 Y:5284104-5284126 GTGTAGATATGAAGCCTCAATGG + Intronic
1201698187 Y:16851100-16851122 GTTTATCCATGCATCCACAATGG + Intergenic