ID: 949463254

View in Genome Browser
Species Human (GRCh38)
Location 3:4317052-4317074
Sequence TTAAAGACGTGGTAGTTGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 2, 2: 31, 3: 74, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949463254_949463258 1 Left 949463254 3:4317052-4317074 CCAACCAACTACCACGTCTTTAA 0: 1
1: 2
2: 31
3: 74
4: 169
Right 949463258 3:4317076-4317098 CATCTCAACAACTTTTTGCAGGG 0: 27
1: 71
2: 70
3: 73
4: 211
949463254_949463259 24 Left 949463254 3:4317052-4317074 CCAACCAACTACCACGTCTTTAA 0: 1
1: 2
2: 31
3: 74
4: 169
Right 949463259 3:4317099-4317121 AAAACGCTTCCACAACCAGCAGG 0: 18
1: 87
2: 83
3: 50
4: 95
949463254_949463257 0 Left 949463254 3:4317052-4317074 CCAACCAACTACCACGTCTTTAA 0: 1
1: 2
2: 31
3: 74
4: 169
Right 949463257 3:4317075-4317097 GCATCTCAACAACTTTTTGCAGG 0: 27
1: 62
2: 81
3: 72
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949463254 Original CRISPR TTAAAGACGTGGTAGTTGGT TGG (reversed) Exonic
902061045 1:13643110-13643132 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
904639652 1:31915513-31915535 TTAAAAACTTGGTATTAGGTGGG - Intronic
905094067 1:35454016-35454038 TCAAGGACGTGGTATTGGGTTGG + Intronic
905854861 1:41303105-41303127 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
906438454 1:45818029-45818051 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
906512990 1:46422122-46422144 CAAAAGACGTGGTAGTAGTTAGG + Intergenic
906827865 1:49001010-49001032 TTAAAGATGATATAGTTGGTAGG - Intronic
908778668 1:67668016-67668038 CTAAAGAAGTGGTATTTGCTGGG + Intergenic
909299387 1:73992480-73992502 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
909611791 1:77558768-77558790 TTTAGGAGGTGGTGGTTGGTGGG - Exonic
909902345 1:81153561-81153583 TTGAAGAAGTGGTAGTCTGTTGG - Intergenic
910051040 1:82974242-82974264 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
912019516 1:105089452-105089474 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
912152588 1:106878635-106878657 TTGAAGAAGTGGTAGTTCGTTGG - Intergenic
912640930 1:111345881-111345903 TTCAGAACGTGGTACTTGGTGGG - Intergenic
914452846 1:147808113-147808135 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
915032786 1:152898010-152898032 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
915781723 1:158559243-158559265 TTGAAGAAGTGATAGTTGTTTGG - Intergenic
916091870 1:161313997-161314019 CTAAAAACGTGGTGGTTGGCCGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916870545 1:168910012-168910034 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
918490983 1:185081318-185081340 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
918914537 1:190617591-190617613 TTGAAAAAGTGGTAGTTGGTTGG + Intergenic
919374118 1:196770769-196770791 TTACAGACATGATATTTGGTGGG - Intergenic
921679831 1:218018004-218018026 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
924208224 1:241736650-241736672 TTAGAGAAGTGGCAGTTGCTGGG - Intronic
924773170 1:247094463-247094485 TTAAAGAAGTGGTAGTTGGTTGG - Intergenic
1063338611 10:5241832-5241854 TTCAAAAAGTGGTAGGTGGTTGG - Intergenic
1064126828 10:12669249-12669271 TTAACGACGTGGTTTTTTGTGGG - Intronic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1064749548 10:18512808-18512830 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1064900311 10:20288845-20288867 TTAAAGGTGTGGAAGCTGGTGGG + Exonic
1066084280 10:31961395-31961417 TTAGAGTCGTGGAAGCTGGTAGG + Intergenic
1067180366 10:43980855-43980877 TTAGACACGTGTTAGTTGGCTGG - Intergenic
1067574402 10:47400005-47400027 TCGAATAAGTGGTAGTTGGTTGG - Intergenic
1068316671 10:55353107-55353129 TTGAAGAAGTGGTAGTCGGATGG - Intronic
1071389491 10:85157159-85157181 CTGAAGAAGTGGTGGTTGGTTGG - Intergenic
1075224918 10:120620173-120620195 TTTAAGAAGTGATATTTGGTTGG - Intergenic
1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG + Intergenic
1081109200 11:39112024-39112046 TTGAAGAAGTGATAGTCGGTTGG - Intergenic
1082732606 11:56818471-56818493 TCGAAGAAGTGGTAGTTGATTGG - Intergenic
1086436754 11:86788996-86789018 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1087242368 11:95793576-95793598 TAAAATACGTGGTAGTGGGTGGG - Intronic
1087564071 11:99831326-99831348 TTAACGAAGTGGTAGTTGGTTGG + Intronic
1088356194 11:108946275-108946297 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1089947962 11:122496960-122496982 TTAAATTTGTGGTAGTTTGTAGG + Intergenic
1090214478 11:124949384-124949406 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1091683587 12:2544742-2544764 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
1092239815 12:6829618-6829640 CTAAAGACGTCGGAGTTGGGTGG - Intronic
1092794058 12:12093099-12093121 TTAAAGGCGTGGTAGTTCAAAGG + Intronic
1093356127 12:18170201-18170223 TTGAAGAAGTGGTAGTCAGTTGG + Intronic
1093649742 12:21629308-21629330 TTAAGGGGGTGGTGGTTGGTGGG - Intergenic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1094245815 12:28291264-28291286 TTGAAAAAGCGGTAGTTGGTTGG + Intronic
1094463116 12:30719620-30719642 TTAAAGACTTATTAGTTAGTAGG + Intronic
1095936082 12:47683061-47683083 TCAAAGACGTGGGAGTAGGCAGG - Intronic
1097064408 12:56310206-56310228 CTAAAGACGTGGTATTGAGTGGG + Intronic
1097846911 12:64376226-64376248 TTGAAGAAGTGGTAGTCAGTTGG - Intronic
1098736043 12:74106845-74106867 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1099672215 12:85708930-85708952 ATAAAAAAGTGGTAGTTGGTTGG - Intergenic
1099785510 12:87257287-87257309 TTGAAGAAGTGCTAGTCGGTTGG + Intergenic
1099915416 12:88886389-88886411 TTGAAGAAGTAGTAGTTGATTGG + Intergenic
1101275913 12:103201026-103201048 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1101804895 12:108055233-108055255 CTAAAGAGGAGGGAGTTGGTGGG + Intergenic
1103978273 12:124718360-124718382 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1104905473 12:132211166-132211188 TTGCAGAAGCGGTAGTTGGTTGG - Intronic
1106961422 13:35002855-35002877 TTGAAGAAGTGGTAGTCAGTTGG + Intronic
1107103154 13:36615716-36615738 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1107187641 13:37543399-37543421 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1112770256 13:102787341-102787363 TTAAAAATGTGGTAGTAGGCCGG - Intronic
1112940578 13:104856185-104856207 TCGAAGAAGTGGTAGTCGGTTGG + Intergenic
1113307950 13:109098435-109098457 TTAAAGAGGTGGTAGATGGTTGG + Intronic
1113478641 13:110603999-110604021 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1113557004 13:111244971-111244993 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1114565505 14:23629488-23629510 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1115385142 14:32788681-32788703 CCAAAGACCTGGTAGTTAGTGGG - Intronic
1120275333 14:82366370-82366392 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1121999085 14:98631269-98631291 TTAAAGAAGTGGTAGTCGGTTGG + Intergenic
1123889330 15:24759980-24760002 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1125052375 15:35315220-35315242 TTAAAGAAGTGGGAGCTGGTTGG - Intronic
1125096249 15:35855707-35855729 TTAAAATCATGGTAGTTGCTGGG + Intergenic
1126641963 15:50836751-50836773 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1128194389 15:65738375-65738397 TTATAGACATGATAGTTGGAAGG - Intronic
1128625419 15:69197248-69197270 TTGAAGAAGTGGTAGTCAGTTGG - Intronic
1130221671 15:82024719-82024741 TTAGAGAAGTGGTTGTTGGTTGG - Intergenic
1130849019 15:87775921-87775943 TTGAAGAAGTGTTAGTCGGTTGG - Intergenic
1130854396 15:87828545-87828567 TTGAAGAAGTGGTACTAGGTTGG - Intergenic
1131329926 15:91487513-91487535 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1136528691 16:30851164-30851186 TTGAAGAAGTGGTAGTCAGTTGG + Intronic
1138644501 16:58414237-58414259 TTAAATTAGTGGAAGTTGGTGGG - Intergenic
1138834497 16:60417309-60417331 TTGAAAAAGTGGTAGCTGGTTGG + Intergenic
1141378405 16:83552783-83552805 TCAAAGACGTGGTTATTGGCTGG + Intronic
1144275589 17:13665388-13665410 TTGAAGAAGTGGTAATCGGTTGG - Intergenic
1144510268 17:15868802-15868824 TTAAAAACGTGCTATTTGGTGGG - Intergenic
1145174425 17:20686527-20686549 TTAAAAATGTGCTATTTGGTGGG - Intergenic
1149167266 17:53767424-53767446 TTGAAGAAGTGGTAGTTAGTTGG + Intergenic
1149218306 17:54385028-54385050 TTAAAGAAGTGGTAGTCAGTTGG + Intergenic
1149480774 17:57001436-57001458 TTAAACAGGTGGTAGGTGATAGG - Intronic
1150695159 17:67398396-67398418 TTGAAGAAGTGGTAATCGGTTGG + Intronic
1154509953 18:15087767-15087789 TTGAAGAAGTGGTAGTTGGCTGG - Intergenic
1155659721 18:28233745-28233767 TTGAAGAAGTGGTAGTTAGTTGG + Intergenic
1155777994 18:29792714-29792736 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1158696005 18:59704617-59704639 TTAAAGATGTGGAAACTGGTGGG + Intergenic
1159324459 18:66896327-66896349 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1163619171 19:18348019-18348041 TTCAGGAGGTGGGAGTTGGTGGG + Intronic
1165195558 19:34100081-34100103 TCAAAGAGGTGGTATTTGGAGGG - Intergenic
1165919082 19:39281516-39281538 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
926405924 2:12552601-12552623 TTGAAGAAGTGGTAGTTGATTGG + Intergenic
926487574 2:13481349-13481371 TTTAAGACGTGGTAGTCGGTTGG + Intergenic
932563855 2:72893630-72893652 TTCATGACGTGGTGGGTGGTGGG + Intergenic
933450754 2:82447268-82447290 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
933542648 2:83667124-83667146 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
935440360 2:103087578-103087600 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
935541801 2:104357034-104357056 TTAAAGAAATGGTAGTTGTTTGG - Intergenic
936774453 2:115955963-115955985 TTGAAGAAGTGGTCGTTGGTTGG + Intergenic
937707679 2:124940158-124940180 TTGAAGAAGTGGTTGTTGGTTGG - Intergenic
938038341 2:128054823-128054845 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
939682264 2:145152289-145152311 TTGAAGATGTGGTAGTCAGTTGG - Intergenic
940346532 2:152634634-152634656 TTGAAAAAGTGGTAGTCGGTTGG + Intronic
942048981 2:172121182-172121204 TCAAAGAGGTGGTATTTGGAGGG - Intergenic
942490074 2:176481076-176481098 TCAAATAGGTGGAAGTTGGTAGG + Intergenic
944535714 2:200707567-200707589 CTAATGAGGTGGTGGTTGGTGGG - Intergenic
944631182 2:201626417-201626439 TTAATGTCATGGTAGTTGGAAGG - Intronic
944860538 2:203811786-203811808 TTAAAGAGCTGTGAGTTGGTGGG + Intergenic
945029233 2:205648421-205648443 TTAAAGACGGGGTGGGTGGGGGG - Intergenic
945821122 2:214666871-214666893 TTAAAGAAGTGGTAGTTGGTTGG - Intergenic
947611701 2:231528719-231528741 CTGAAGAGGTAGTAGTTGGTAGG + Exonic
948022467 2:234747060-234747082 TTGAAGAAGTAGTAGTTGGTTGG - Intergenic
1169526083 20:6427334-6427356 TTGAAGAACTGGTAGTTGGTTGG + Intergenic
1169882644 20:10364265-10364287 TGGAAGAAGTGGTAGCTGGTTGG - Intergenic
1170222873 20:13959611-13959633 TTGAAGAAGTGGTAGTCGGTTGG - Intronic
1170617285 20:17964158-17964180 TTAGATACTTGGTAGCTGGTGGG - Intronic
1172988701 20:39015264-39015286 TTAAGGATGTGGTTGTTGGGTGG - Intronic
1173760645 20:45557210-45557232 TTGAAGAAGTGGTAGTCGGTTGG - Intronic
1174096033 20:48090203-48090225 TCAAAGATGTTGTATTTGGTTGG - Intergenic
1174438718 20:50531346-50531368 TTCAAGGCGGGGTTGTTGGTGGG + Intronic
1176788117 21:13284012-13284034 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1177072332 21:16526276-16526298 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1177361590 21:20079013-20079035 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1177987258 21:27992216-27992238 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1178133770 21:29603039-29603061 TTAAAGGTGTGCCAGTTGGTGGG - Intronic
1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG + Intergenic
1180030818 21:45205887-45205909 TTAAAGGCGTGCTAGTTGCCAGG - Intronic
1182335229 22:29579722-29579744 TTAAAGATGCTGTGGTTGGTCGG - Intronic
1183013524 22:34967328-34967350 TCAATGAAGTGGTTGTTGGTGGG - Intergenic
949337568 3:2992524-2992546 TTAAAGGGGTGGTGGTGGGTGGG + Intronic
949463254 3:4317052-4317074 TTAAAGACGTGGTAGTTGGTTGG - Exonic
949694090 3:6674162-6674184 TTGAAGGAGTGGTAGTTGGTTGG - Intergenic
952985801 3:38781542-38781564 TTGAAGAAGTGGTAGTTGGTTGG - Intronic
953149546 3:40311690-40311712 ATAAAGACATGGTAGTTATTTGG + Intronic
953942569 3:47113366-47113388 GTAAACACTTGGTAGTTGCTTGG + Intronic
956699441 3:71945928-71945950 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
957200547 3:77129541-77129563 TTGAAGAAGTGATAGTCGGTTGG + Intronic
958069927 3:88597123-88597145 TTAAATATGTGGAAGTTGCTTGG + Intergenic
958110272 3:89133563-89133585 TTGAAGAAGTGGTAGTCGGTTGG + Intronic
958491095 3:94774583-94774605 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
958534183 3:95375597-95375619 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
959490984 3:106988310-106988332 TTGCAGTCCTGGTAGTTGGTGGG - Intergenic
959567787 3:107850077-107850099 TACAAGAAGTGGTAGGTGGTGGG - Intergenic
962916272 3:139906697-139906719 TTAAAGACAAGGTCTTTGGTGGG - Intergenic
963306051 3:143654473-143654495 TTTTAGACGTTGCAGTTGGTGGG + Intronic
963953099 3:151223908-151223930 TAAAACACGAGGTATTTGGTTGG - Intronic
966235638 3:177698853-177698875 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
970264154 4:14262741-14262763 TTGAAGAAGTGGTAGTTGATTGG + Intergenic
972226840 4:37023268-37023290 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
973324627 4:48846450-48846472 TTAAAGTGTTGGTAGTTGGCCGG + Intronic
973688792 4:53403621-53403643 TTGAAAAAGTGGTAGTTGGGAGG + Intronic
974215164 4:58836755-58836777 ATAAAGAAGTGGTAGTCTGTAGG - Intergenic
974248467 4:59354434-59354456 TTGAAGAAGTGATAGTCGGTTGG - Intergenic
975511330 4:75196434-75196456 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
977226527 4:94398483-94398505 TAAAAGACTTGGTAGTTACTGGG - Intergenic
977362313 4:96021895-96021917 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
977537538 4:98272412-98272434 TTGAAGAAGTGGTAGTCAGTTGG + Intronic
977920222 4:102634831-102634853 GACAAGAAGTGGTAGTTGGTCGG + Exonic
978595275 4:110370768-110370790 TTGAAGAAGTGGTAGCTGGTTGG - Intronic
978714615 4:111826366-111826388 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
979809275 4:125014997-125015019 TTGAAGAAGTGCTAGTTGGTTGG + Intergenic
980764865 4:137288671-137288693 TTGAAGAAGTGGTAGTCAGTCGG - Intergenic
981075831 4:140590635-140590657 TTGAAGAAGTGGTAGTCCGTTGG - Intergenic
981191054 4:141863724-141863746 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
982349386 4:154398439-154398461 TTAAAGACAGGGAAGTTGGAAGG - Intronic
982956598 4:161776989-161777011 ATAAAGATGGGTTAGTTGGTTGG - Intronic
988844777 5:35116887-35116909 TTAAAGCAGTGGTTTTTGGTAGG + Intronic
988981594 5:36575122-36575144 TTAAAGATGTGGCAGGGGGTGGG + Intergenic
990232174 5:53725178-53725200 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
991624883 5:68590394-68590416 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
992307315 5:75455269-75455291 TTGAAGAAGTGGTAGTCAGTTGG - Intronic
992730416 5:79661284-79661306 TTGCAGAAGTGGTAGTTGCTGGG - Intronic
993695426 5:91056043-91056065 TTGAAGAAATGGTAGTCGGTTGG + Intronic
995380447 5:111526006-111526028 TTGAGGAAGTAGTAGTTGGTTGG + Intergenic
996447140 5:123568009-123568031 TTGAAGAAGTAGTAGTTGGTTGG + Intronic
998468827 5:142367280-142367302 TAAAAGACCTGGGAGTTGGCCGG - Intergenic
999051124 5:148524851-148524873 TTGAAGAGGTGGTAGTAGGATGG + Intronic
999525844 5:152404857-152404879 CTGAAGAGGTAGTAGTTGGTGGG + Exonic
999535249 5:152509637-152509659 TTGAAGAAGTGATAGTTTGTTGG + Intergenic
999863375 5:155673692-155673714 TTCAAGAAGTGGTAGTTGATTGG + Intergenic
1000436275 5:161213706-161213728 TTGAAGAAGTGGTAGCTGGTTGG + Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1002397304 5:178968033-178968055 TTAAAGACGGGGAAGGTGGCCGG - Intergenic
1003975110 6:11335587-11335609 TTGAAGAAGTGGTAGTCGGTTGG - Intronic
1004964371 6:20831302-20831324 TTAAAGAAGTGGCAGTTGGTTGG + Intronic
1005586617 6:27282903-27282925 TTGAAGAAGTGGTAGTCGATTGG + Intergenic
1006759126 6:36443520-36443542 TTAAAAATTAGGTAGTTGGTGGG + Intronic
1008073605 6:47122308-47122330 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1008866645 6:56219519-56219541 TTGAAGAAATGGTAGTTTGTTGG - Intronic
1009240555 6:61181082-61181104 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1010580250 6:77587665-77587687 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1010831916 6:80541438-80541460 TTTGATACATGGTAGTTGGTTGG - Intergenic
1011052264 6:83165672-83165694 CTAAAGAAGTGGTAGTTTGTTGG + Intronic
1013104209 6:107012786-107012808 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1014057310 6:117031293-117031315 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1014595785 6:123336434-123336456 TTAAAGGTGTGGTAATTGTTTGG - Intronic
1014792414 6:125688861-125688883 TTAAAGAAGTGGTAGTCAGTTGG + Intergenic
1015412067 6:132904694-132904716 TTGAAGAAGTGGTAGTCGCTTGG + Intergenic
1015966636 6:138700872-138700894 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1019683802 7:2368604-2368626 TCAAAGACGAGGTAGATGGAAGG - Intronic
1021135232 7:16957415-16957437 TTCAGGAAGTGGTAGCTGGTTGG - Intergenic
1021575938 7:22105989-22106011 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1022577352 7:31510743-31510765 TTGAAGAAGTGGTAGTCTGTTGG - Intergenic
1024383813 7:48728170-48728192 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1026240354 7:68568809-68568831 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1028199059 7:87939049-87939071 TTAAAGACGTGGAAGATGAGTGG + Intronic
1029726111 7:102405982-102406004 TTGAAGAAGTGGTAGTCGGTTGG + Intronic
1030495429 7:110293063-110293085 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1030763701 7:113382647-113382669 GTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1031649720 7:124273303-124273325 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1032315422 7:130833729-130833751 GTAAATACGTGGTAGTTTCTGGG + Intergenic
1032423634 7:131802836-131802858 CTCAAGAGGTGGTAGATGGTGGG + Intergenic
1035554082 8:552354-552376 TTGAAGAAGTGGTAGTCGATTGG - Intergenic
1035968176 8:4217955-4217977 GTAATGCCATGGTAGTTGGTGGG + Intronic
1036226447 8:6962474-6962496 TGAAAGAAGTGGTAGTCGGTTGG - Intergenic
1037040020 8:14219818-14219840 TTGAAGAAGTGGTAGTCGGTTGG - Intronic
1037063485 8:14545761-14545783 TTAGAGACTTGTTAGTTGATAGG - Intronic
1039924021 8:41912740-41912762 TTGAAGTAGTGGTAGTTGGTTGG + Intergenic
1040697288 8:50015848-50015870 TTGAAGAAGTTGTAGTCGGTTGG + Intronic
1041069730 8:54115625-54115647 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1041219512 8:55634621-55634643 TTGAAGAAGTGGTAGGTGGTTGG + Intergenic
1042513616 8:69636645-69636667 TTGAAGAAGTGGTAGTCGATTGG + Intronic
1043330446 8:79110782-79110804 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1044174697 8:89105025-89105047 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1047659808 8:127020800-127020822 TTGAAGAAGTGGTAGTTAGTTGG - Intergenic
1048099805 8:131338637-131338659 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1050724033 9:8626204-8626226 TTTAAAACTAGGTAGTTGGTTGG - Intronic
1050952146 9:11611097-11611119 TTAAAAAAGTGGTAGTCAGTTGG + Intergenic
1051042567 9:12830291-12830313 TTTGAGAAGTGGTAGTCGGTTGG + Intergenic
1051142674 9:13994755-13994777 TTGAAGAAGTGGTAGATGGTTGG + Intergenic
1051811063 9:21050388-21050410 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1052139938 9:24968454-24968476 TTGAAGAAGTGGTAGTCTGTTGG + Intergenic
1052578269 9:30319032-30319054 TCAAAGAGGTGGTGGTTGGAGGG - Intergenic
1052886592 9:33655056-33655078 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1055167109 9:73210366-73210388 TTAAAGAAGTGGTAGTCGGTTGG - Intergenic
1055198233 9:73623632-73623654 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1056144217 9:83713335-83713357 TTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1056173428 9:84010614-84010636 TTGAAGAGGTGGTAGTCGGTTGG + Intergenic
1056894136 9:90525276-90525298 GTAAAGACGTGAGAGTTGGTGGG + Intergenic
1057949038 9:99355279-99355301 TTAAATACCTGGTAGTTGAATGG - Intergenic
1058110604 9:101028225-101028247 TTAAAGGAGTGGAAGTTGGGAGG + Intergenic
1059563260 9:115355877-115355899 TTGAAGAAGTGGTAATCGGTTGG - Intronic
1188055275 X:25533672-25533694 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1188177483 X:27009723-27009745 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1188294107 X:28424985-28425007 TTAAAGAAGTGGTAGTCGGTTGG - Intergenic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1188596896 X:31912395-31912417 TTGAAGAAGTGGTAGTCAGTTGG - Intronic
1193829954 X:86278356-86278378 TTGAAGAAGTGGTAGTCAGTTGG - Intronic
1194334913 X:92633655-92633677 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1194388720 X:93289488-93289510 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic
1194528906 X:95019047-95019069 TTAAAGAAGCGGTAGTCAGTTGG + Intergenic
1194667545 X:96692300-96692322 TTAAAGACGTGACAGTATGTAGG - Intronic
1195563016 X:106306497-106306519 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1197361368 X:125507623-125507645 TTGAAGAAGTGGTAGTCGGTTGG + Intergenic
1198317274 X:135480731-135480753 TTAAAGAAGTGGTAGTCAGTTGG + Intergenic
1198777702 X:140198390-140198412 TTATAGATGTGGCAGTTGGGAGG - Intergenic
1198844291 X:140893445-140893467 TTGAAGAAGTGGTAGTCAGTTGG - Intergenic
1199198727 X:145062231-145062253 TTGAAGAAGTGGTAGTCTGTTGG - Intergenic
1200643391 Y:5750706-5750728 TTGAAGAAGTGGTAGTCAGTTGG + Intergenic