ID: 949472335

View in Genome Browser
Species Human (GRCh38)
Location 3:4409383-4409405
Sequence TTTTTCTTTTCACCAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949472335 Original CRISPR TTTTTCTTTTCACCAATCCC AGG (reversed) Intronic
900731853 1:4267348-4267370 TTTTTTTTTTCACTAATTCCGGG + Intergenic
900842528 1:5066067-5066089 TTTTTCCTTCCACCAATCTTAGG + Intergenic
901661189 1:10798866-10798888 TTTAGCTTCTCAACAATCCCAGG - Intergenic
901840302 1:11950065-11950087 TTTATCTTTTCACCAAGCCTGGG - Intronic
901985196 1:13069981-13070003 TTTTTCTTTTCTCTAATGTCAGG + Intronic
901996613 1:13156789-13156811 TTTTTCTTTTCTCTAATGTCAGG - Intergenic
902164779 1:14561379-14561401 TTTATCTTTTCGCCAGTCTCGGG - Intergenic
902593205 1:17489778-17489800 TTTTTCTTTAAATCAACCCCAGG - Intergenic
903121384 1:21218894-21218916 TTTCTCTTTTCTCCTTTCCCTGG + Intronic
903607697 1:24586901-24586923 TATTTCTTTTTATCAATCCAGGG + Intronic
903670471 1:25032417-25032439 TTTTTCTATTAACCAACCACTGG - Intergenic
905560445 1:38922652-38922674 TTTATCTTATCTCCAATACCTGG + Intronic
905615299 1:39393170-39393192 TTTTTTTTTTTACCCTTCCCAGG - Intronic
906758129 1:48341709-48341731 TTTTTCTTCTTTACAATCCCAGG - Intronic
906860853 1:49357586-49357608 TTTTTCTTCTCAACTATCCTAGG + Intronic
906899343 1:49816479-49816501 TTTTCATTTTTACCAATCGCTGG - Intronic
907384096 1:54114640-54114662 TTATTCTTTGCAACAATCCCAGG - Intergenic
907782999 1:57584367-57584389 TTTTTCTTTTATCAAATCACAGG + Intronic
908594257 1:65669445-65669467 TTTATCTTATTACCAATCACAGG + Intergenic
909185162 1:72478364-72478386 TCTTTTTTTTCTTCAATCCCTGG - Intergenic
909215120 1:72877279-72877301 TTTTTCTCTTTATCAGTCCCAGG - Intergenic
909245770 1:73281093-73281115 CGTTTCTTTTCCCCAACCCCTGG + Intergenic
909255254 1:73412343-73412365 TTTTTATTTTAACCAGTCCATGG - Intergenic
910365795 1:86463735-86463757 TTTTTCTTGTTCCCAATCTCAGG - Intergenic
911638498 1:100262657-100262679 TTTTTTTTTCAACCAATCTCTGG + Intergenic
914201724 1:145491131-145491153 TTTTTCCCTTCACCATGCCCTGG - Intergenic
914480849 1:148064255-148064277 TTTTTCCCTTCACCATGCCCTGG - Intergenic
916006948 1:160671014-160671036 TTTTAATTTTCTCCAGTCCCTGG + Intergenic
916176006 1:162039196-162039218 TTTTTCTTTTCAGCCATTTCAGG - Intergenic
917291969 1:173479432-173479454 TTTTTCTTCTCAAAAATACCTGG - Intronic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
917774928 1:178322864-178322886 TTTTTCTTTTTACCCACCACAGG + Intronic
918487359 1:185044312-185044334 TTTTTCTTTCCACCCATCCAAGG + Intergenic
919544717 1:198900790-198900812 TTTATCTTTTCACTAATCTCTGG - Intergenic
920908770 1:210194697-210194719 TTTATCTGTTCTCCAAGCCCAGG + Intergenic
920935259 1:210427250-210427272 TTTTTTTTTAAACCAATTCCTGG + Intronic
924144777 1:241062637-241062659 TTTTTCTTTTCAGAAATAGCCGG - Intronic
924555718 1:245116970-245116992 TCATTCTTTTCACCAATACTGGG + Intronic
924707168 1:246510438-246510460 TTTTTCTTTCAGCCAAACCCAGG - Intergenic
924722672 1:246637963-246637985 TTTTTCTAACCACCAAGCCCAGG - Intronic
924907789 1:248474551-248474573 TTTATCTTATCTCCCATCCCAGG + Intergenic
924916320 1:248573535-248573557 TTTATCTTATCTCCCATCCCAGG - Intergenic
1063021182 10:2128759-2128781 TTTTTTTTTTCACATATTCCAGG - Intergenic
1063900620 10:10728699-10728721 TGTTTCTTTTCACCTGTCTCTGG + Intergenic
1065597517 10:27329728-27329750 TTTTTTTTGTCACCAATCTGTGG - Intergenic
1065634424 10:27715978-27716000 TTTTACTTTTTCCCAATCCTGGG - Intronic
1066604263 10:37143924-37143946 TTTTTTTTGTCACCAATCTGTGG + Intronic
1067723997 10:48752540-48752562 TCATTCTTTTCCCCAGTCCCTGG + Intronic
1068574880 10:58673933-58673955 TTTTTCTTTTAATCTATCTCAGG + Intronic
1068751662 10:60600616-60600638 TTTGTCTTTCCACCAAACCATGG + Intronic
1069820253 10:71223085-71223107 TTTTCCTTGTCACCAAGCCAGGG + Intronic
1069876344 10:71565496-71565518 TTCTGCCTTTCCCCAATCCCCGG - Intronic
1069969047 10:72149875-72149897 TTTTTCTTTTCCTCAATATCTGG - Intronic
1070442661 10:76462205-76462227 TTTTTTTTTTCAGGAGTCCCAGG + Intronic
1070445697 10:76499058-76499080 TTTTTCTTTTCAACAGTGCCTGG - Intronic
1071712817 10:88066418-88066440 TCTTTCCTTTCTCCAGTCCCTGG + Intergenic
1072822827 10:98574999-98575021 TTTTTATTTTTACCATTTCCTGG + Intronic
1073131793 10:101194041-101194063 TTTTTCTTTTGACCAGATCCAGG - Intergenic
1073241241 10:102059723-102059745 TTTTTCTTTTTACTGCTCCCAGG - Intergenic
1073421000 10:103423628-103423650 CTTTTCTATTCACCAAGTCCTGG - Exonic
1074091907 10:110268188-110268210 TCCTTCTTTTCTCAAATCCCTGG + Intronic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1075339711 10:121636799-121636821 TTCTCCTTTTCCCCACTCCCTGG + Intergenic
1075437277 10:122454445-122454467 TTTTTTTTTTTTCAAATCCCTGG + Intergenic
1075562262 10:123476694-123476716 TTTATCTTTTCCCCAATCAGTGG + Intergenic
1077827064 11:5822348-5822370 TATTTCTTCTCACACATCCCTGG - Intronic
1077941712 11:6849923-6849945 TTTTTTTTTTCTCCAATAGCTGG + Intergenic
1078278565 11:9875962-9875984 TTTTTTTTTTCACTAATACATGG + Intronic
1079102450 11:17550028-17550050 TTTTTATTTTCCCCCATCCATGG - Intronic
1079881572 11:25934336-25934358 TTTTTTTTTTCACCCTTCACTGG + Intergenic
1081723332 11:45306044-45306066 TTTATCTATTCACCAATCCAAGG + Intergenic
1081956040 11:47094301-47094323 TTTCTCCCTTCCCCAATCCCTGG - Intronic
1083113349 11:60434073-60434095 TTTTTCTCTTCCACAATGCCTGG - Intronic
1083383274 11:62286351-62286373 GTTTTGTTTTCAGGAATCCCAGG + Intergenic
1084223577 11:67700200-67700222 TATTTCTTTTCACGAATTGCTGG + Intergenic
1084254867 11:67933730-67933752 TTTTTCTTTTCACATACTCCTGG + Intergenic
1084818018 11:71662184-71662206 TTTTTCTTTTCACATACTCCTGG - Intergenic
1084992579 11:72941540-72941562 TTTTTCTTTTAACTCATCACTGG + Intronic
1086313508 11:85563707-85563729 TTTATCTGTTCACCAAGCCATGG + Intronic
1086594630 11:88556257-88556279 GTTTTCTTTTCACTAATCCTGGG - Intronic
1088574454 11:111256771-111256793 TTTTTCATTTCCCCAAGCCATGG + Intronic
1088761532 11:112933714-112933736 TTTTCCTTTTCACCTTTCCATGG + Intergenic
1088930147 11:114342963-114342985 CTTTTCTTTTCTCCAAAACCTGG - Intergenic
1089762139 11:120735677-120735699 TTTTTTTTCACTCCAATCCCTGG - Intronic
1089809972 11:121123737-121123759 TTTTTGTTTTAAACACTCCCTGG + Intronic
1090109602 11:123891918-123891940 GTTTTCTCTTCACCAATCCTGGG - Intergenic
1092123539 12:6060573-6060595 TTTTTCTTTACACAGATTCCTGG - Intronic
1092144033 12:6202352-6202374 TTCTTTCTTTCACCAATCCCTGG + Intronic
1092235868 12:6809139-6809161 TTTTTCTCTGCTTCAATCCCTGG + Intronic
1092424923 12:8367184-8367206 TTTTTCTTTTCACATACTCCTGG + Intergenic
1092996925 12:13959423-13959445 TTTCTCTACTCACCAATCCACGG - Intronic
1093532580 12:20185380-20185402 TTTTTTGTTTAACCAATCCTTGG - Intergenic
1095348705 12:41184648-41184670 TTTTTCTTTTCTCAATTCCCTGG - Intergenic
1095406947 12:41877153-41877175 TTTATCTTTTCACCCATCAATGG - Intergenic
1095446938 12:42291733-42291755 TTTTTCTTCTTATTAATCCCCGG - Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096022528 12:48334038-48334060 TTTATCTTATCTCCAATACCTGG - Intergenic
1096759520 12:53828944-53828966 TTTTTCTTTTTGCCTCTCCCTGG + Intergenic
1096905456 12:54931481-54931503 TTTATCTGTTCTCCAAGCCCAGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097230081 12:57505500-57505522 TTTTTTTTTTCTCCAAGCCCAGG - Intronic
1097508694 12:60508090-60508112 TTTTTTTTTACTCCAATTCCTGG + Intergenic
1098785913 12:74755460-74755482 TCTTTCTTCTCTCCAGTCCCTGG + Intergenic
1099113931 12:78599857-78599879 TTTTTCTCTTCACAATTCCTTGG + Intergenic
1099143617 12:79011646-79011668 TTTTTTTTTTTACAAATCTCTGG - Intronic
1099182853 12:79487336-79487358 TATTTCTTTTCCTCAAACCCTGG + Intergenic
1099573262 12:84352609-84352631 TTTTTTTTTTTAGCAATCACAGG + Intergenic
1099581473 12:84452289-84452311 TTTTTCTTTTCCCCTAGCCTTGG - Intergenic
1099642270 12:85306221-85306243 TCTTTATTTTCACTAATACCTGG + Intergenic
1099904769 12:88759384-88759406 TTTTTTTTTGCACCAGTCCCTGG + Intergenic
1100016777 12:90020792-90020814 ATTTTTTTTTAACAAATCCCAGG - Intergenic
1100039182 12:90291661-90291683 TTTTTCTTTTGTCCAATCATTGG - Intergenic
1100349934 12:93770727-93770749 TTCTTCTTTTCACCAGTTCCTGG + Intronic
1100367340 12:93933818-93933840 TTTTTCTTTTCTCAAATACATGG - Intergenic
1100954881 12:99895815-99895837 CTTTTCTATTCATCAATCTCAGG - Intronic
1102316431 12:111891483-111891505 TTTTTCTTTAAAAAAATCCCAGG - Intronic
1102427620 12:112856825-112856847 TTTATCTTTGCAACAATCCTAGG + Intronic
1102556112 12:113727628-113727650 TTCATCTTTGCACCAATTCCTGG - Intergenic
1102680685 12:114688397-114688419 ATTTTCTTATCACGGATCCCAGG + Intergenic
1103004597 12:117410605-117410627 TTTTTCTTATCACCATGCACTGG + Intronic
1103086354 12:118063716-118063738 TTTTTCTTTGCAGCAGTTCCTGG + Exonic
1103295641 12:119884306-119884328 TCTTTCGTTTCTCCAATCCCTGG + Intergenic
1104863517 12:131938676-131938698 TTTCTCTTTTCCCCAATCTTTGG + Intronic
1105619798 13:22055846-22055868 TTTTTTTTTTGTCCAATCTCAGG - Intergenic
1107284162 13:38771320-38771342 TTTCTCTTTTAAACAAGCCCAGG + Intronic
1108589015 13:51895705-51895727 TTTATTTTTTCCCCCATCCCAGG - Intergenic
1109671080 13:65608615-65608637 TGTTTCTGTTCTCCAGTCCCTGG - Intergenic
1110680853 13:78310095-78310117 TTTTTTTTTTCCTGAATCCCAGG - Intergenic
1111079697 13:83287141-83287163 TTTTTCTTTTTACCCATCAAAGG + Intergenic
1111189400 13:84788990-84789012 TTTTTCTATTAATCAAACCCTGG - Intergenic
1112037699 13:95512830-95512852 CTTTTGTTTTCACCAATACCTGG + Intronic
1112480731 13:99772915-99772937 ATTTTCTTTTCATCATTTCCAGG - Exonic
1112790027 13:102993138-102993160 TTCTCCTTTTCCCCATTCCCTGG + Intergenic
1114803052 14:25800164-25800186 GTTTTATTTTCACAAATCCTTGG + Intergenic
1115073863 14:29362065-29362087 TTTTTTTTTTCACCAAAGGCAGG - Intergenic
1115175585 14:30558654-30558676 TTTTTGTTTTCCCTAAACCCAGG + Intergenic
1115356968 14:32458989-32459011 TCTATCTTTTCACCAATCGATGG - Intronic
1115569576 14:34653987-34654009 TTTATCTGTTCTCCAAGCCCAGG + Intergenic
1115890354 14:38019750-38019772 ACTTTCTTGTCACTAATCCCTGG + Intronic
1115962243 14:38848373-38848395 GTTTTCTTTTCACCTCTCCCAGG - Intergenic
1116002168 14:39255551-39255573 TTTTTCTTTTCTCCTAACCTGGG - Intronic
1116104928 14:40490133-40490155 TCTTTCTTTTCATCAATCAATGG + Intergenic
1116368232 14:44096622-44096644 TTTTTCTACTCACCAATTTCTGG + Intergenic
1117541119 14:56747466-56747488 CTAGTCTTTTCACTAATCCCAGG - Intergenic
1120026124 14:79586069-79586091 GTTTTCTTTTCCCCAGGCCCTGG + Intronic
1120399974 14:84018550-84018572 ATTTTCATTTCACAAAACCCAGG - Intergenic
1120466286 14:84861847-84861869 ATTTTCTTTCTATCAATCCCAGG + Intergenic
1121849548 14:97207561-97207583 AATTTCATTTCACCTATCCCAGG + Intergenic
1122698158 14:103568145-103568167 TTTTTCTCTTCATTATTCCCTGG + Intronic
1123172178 14:106384317-106384339 TTTTTTTTTTTACCATTCACAGG + Intergenic
1124085338 15:26544586-26544608 TATTCCTGTTCACCAACCCCGGG - Exonic
1124614413 15:31231216-31231238 TTCTTCTTCACAGCAATCCCAGG + Intergenic
1125101513 15:35918462-35918484 TTCTTCCTTCCCCCAATCCCTGG - Intergenic
1126703181 15:51385387-51385409 TTTTTCTTTTCTGCACTCCCTGG - Intronic
1127621414 15:60738355-60738377 TTTATCTTTTCCCAGATCCCCGG + Intronic
1127757264 15:62104702-62104724 TTTCACCTTTCACCAATGCCTGG - Intergenic
1128592423 15:68912456-68912478 TTTTTATTGTCACTACTCCCTGG - Intronic
1129766610 15:78173564-78173586 TTTTCCTTTTCACCATTGCAAGG - Intronic
1133386570 16:5374966-5374988 TCTTCCCTTTCACCTATCCCAGG - Intergenic
1133760169 16:8792223-8792245 TTTTTATTTTCACGGTTCCCTGG - Intronic
1136392753 16:29975622-29975644 TTCATCTTTACCCCAATCCCAGG + Intronic
1136596472 16:31253611-31253633 TTTTTCTTTTTTCCAACTCCTGG - Intergenic
1137048271 16:35687869-35687891 TTTTTTTTTTTGCCAACCCCAGG - Intergenic
1138217297 16:55215388-55215410 TTTTCCTCTTCCCCAACCCCAGG - Intergenic
1138471255 16:57239016-57239038 TTTTTCTTTTCAACATTGGCTGG - Exonic
1138741718 16:59318375-59318397 TTTATCATTTCACCAATCTTTGG + Intergenic
1138763310 16:59569893-59569915 TTTTTCTTTTTAGAAATGCCTGG - Intergenic
1138942924 16:61811881-61811903 TTTTCTTTTTCCCCAGTCCCTGG - Intronic
1139205079 16:65020982-65021004 TTTTTTTTTTTACCAAATCCTGG + Intronic
1139789796 16:69424513-69424535 GTTTTCTTTTCACCAATGAAGGG - Intronic
1140035806 16:71370471-71370493 TTTTTTTTTTTAACACTCCCAGG - Intronic
1140323899 16:73981356-73981378 TTTTTCTTTTCTCCATTCCAGGG - Intergenic
1141295755 16:82767622-82767644 TCTTTCTTTCCATCACTCCCTGG + Intronic
1141708190 16:85681322-85681344 TTTTCCTTTTCTCCACTTCCCGG - Intronic
1141928272 16:87183508-87183530 TATTTCTTTACAGCAATCCAAGG + Intronic
1142946367 17:3432647-3432669 TTTTCCTTTTTGCTAATCCCAGG - Intergenic
1144126652 17:12208975-12208997 TTTTTTTTTTCCCCAAGGCCTGG - Intergenic
1144196194 17:12897438-12897460 TTTTTTTTTTTTCCAAGCCCTGG + Intronic
1146090835 17:29875778-29875800 TTTTTCTTTTACCCCATGCCTGG + Intronic
1146233773 17:31137958-31137980 TTTTTCTTTTCTAGAATCCTTGG + Intronic
1146606895 17:34268299-34268321 CTTTTATTTTTACCATTCCCAGG + Intergenic
1149514786 17:57272439-57272461 GTTTTCTTTTCCCCTCTCCCTGG - Intronic
1149568130 17:57653602-57653624 TTTATCTTTTCCCCAACCCCAGG - Intronic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1151821245 17:76498088-76498110 TTTTTCCTTACACCCATCCTAGG + Intronic
1152454697 17:80407180-80407202 TTTATCTGTTCTCCAAGCCCAGG + Intergenic
1152837160 17:82540865-82540887 CTTTTCTGTTCAACAAGCCCAGG - Intronic
1154409220 18:14127499-14127521 CTTTTCTTCTCTCAAATCCCAGG + Intronic
1154476593 18:14765749-14765771 TTTTTTTTGTCACCAATCTGTGG + Intronic
1154940256 18:21105899-21105921 TTTTTCTTTTCCTCAATCTTTGG - Intronic
1155083861 18:22436442-22436464 TTCTCCTTTTCATCTATCCCAGG + Intergenic
1156494184 18:37515288-37515310 TTTTGCTTTTCATCCCTCCCTGG + Intronic
1156620597 18:38846817-38846839 TTTTTTTTTTTACCAGTACCTGG + Intergenic
1156850443 18:41719618-41719640 TTTCTCTTTCCCCCAACCCCTGG - Intergenic
1156883120 18:42104114-42104136 TGTTCCTTATCACCACTCCCAGG + Intergenic
1157019032 18:43756842-43756864 TTTGTCCTTACAGCAATCCCAGG - Intergenic
1157050110 18:44153572-44153594 TTTTAATTTTCACTAAGCCCTGG + Intergenic
1157198385 18:45638740-45638762 TAGTTCTTTTCACCATTGCCAGG - Intronic
1157896548 18:51474292-51474314 TTTGTCTTTTCACTAATTTCTGG + Intergenic
1158007852 18:52693714-52693736 TTTTTGTTTTGAGCAGTCCCTGG - Intronic
1158305052 18:56096053-56096075 ATTTGCCTTTCTCCAATCCCAGG + Intergenic
1158990057 18:62859086-62859108 TTTTTCTTTTACCAAACCCCAGG - Intronic
1159072987 18:63646784-63646806 TTTTTCTTCCCTCCATTCCCAGG - Intronic
1159257493 18:65966091-65966113 TTAAACTTTTCACCTATCCCTGG + Intergenic
1159397959 18:67888429-67888451 TTTTTTTTTTTACGAATGCCTGG + Intergenic
1159500364 18:69261409-69261431 TTTTTGTTTTCAGCAATTACAGG - Intergenic
1159600278 18:70422729-70422751 TTTTTCTTATCAGCAATCTAAGG - Intergenic
1160295718 18:77634863-77634885 TCTTTCTTATCACAAAACCCAGG + Intergenic
1160411735 18:78679675-78679697 TTTTCCTCTTCACAAAACCCAGG - Intergenic
1161131719 19:2593790-2593812 TTTTTTTTTTAAACAATCCTTGG + Intronic
1162886407 19:13700835-13700857 TTTTGCTTTTCAAACATCCCTGG - Intergenic
1162961928 19:14133267-14133289 TTTATCTTTGCTCCAATCCAGGG - Intronic
1163243650 19:16078818-16078840 TTTTTTTTTTAACCCACCCCTGG - Intronic
1163746958 19:19054434-19054456 TTTTTCTTTTCACGGACCCAAGG + Intronic
1164833904 19:31344705-31344727 TTTCTCTTTCCAGAAATCCCAGG + Intronic
1164912155 19:32021703-32021725 TTTTTTTTTCCACTAATCCCAGG + Intergenic
1165554468 19:36618028-36618050 GTTTTGTTTTCACCTAGCCCAGG + Intronic
1165765758 19:38350015-38350037 TTTCTCTCTTCACCATCCCCTGG + Intronic
1167809664 19:51817753-51817775 TTTGTCTTTTGACAAATCCTTGG + Intronic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
927466519 2:23340709-23340731 TTTATCTCTTCACCTTTCCCTGG - Intergenic
927480594 2:23450901-23450923 TTTTTCCTTCCCCCAATCACTGG + Intronic
927628839 2:24752882-24752904 TTTTTTTTTTCTCCAAATCCTGG + Intronic
927799283 2:26082867-26082889 TTATTCTTTTCATAAATTCCTGG - Intronic
928090323 2:28369901-28369923 ACTTTGTTTTCCCCAATCCCTGG + Intergenic
928552890 2:32391018-32391040 TTTTTCTTTTTTCCCATCTCAGG - Intronic
929357433 2:41042686-41042708 TTTTTCTTTTAACCAATGGATGG - Intergenic
929455239 2:42060581-42060603 TTTTTCTGTTCACTACACCCGGG - Intergenic
931062758 2:58549361-58549383 TGTTTCTTTTCCCTATTCCCAGG - Intergenic
931800352 2:65751918-65751940 TTTCTCCTTTCCCCAGTCCCTGG + Intergenic
932173427 2:69577894-69577916 TATTTATTTTCACCATTCCTGGG + Intronic
933217399 2:79645982-79646004 TTTTTTTCTTCACCAATACTGGG - Intronic
933280841 2:80331109-80331131 TTCTTCTTTGCACCATTCACTGG - Intronic
933627538 2:84618598-84618620 TTTTTTTTTTTTCCAATCACGGG - Intronic
934092592 2:88565835-88565857 TTTTTCCTTTCACCACCCCTTGG + Intronic
934138603 2:89022099-89022121 TTTTTTTTTTATCCAATCCACGG - Intergenic
934230642 2:90178464-90178486 TTTTTTTTTTATCCAATCCACGG + Intergenic
935130793 2:100259443-100259465 TATTTCATTTGACCAATCCCTGG - Intergenic
936682129 2:114786001-114786023 TTTTCATTTTCACCTATCTCTGG + Intronic
936766965 2:115862981-115863003 TTTTTCTTTTGCCTAATCCTTGG + Intergenic
936877312 2:117206416-117206438 TATTTCTTTGCAACAATCCACGG - Intergenic
938254527 2:129845844-129845866 TCTTTCTTGTCATCAATCCCAGG + Intergenic
938419218 2:131130705-131130727 TTTTTCTTTTCTCCAGGGCCTGG + Exonic
938739924 2:134221370-134221392 TATTTCTTTCCATTAATCCCAGG - Intronic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
940613341 2:156019104-156019126 TTCTTCTATTCCCCAAGCCCTGG - Intergenic
940971078 2:159897457-159897479 GTTTCCTTTTCATCATTCCCTGG - Intronic
941569506 2:167152559-167152581 TTTTTCTTTCTACCTATCCCAGG - Intronic
941737696 2:168997483-168997505 TTTTTTTTTCCTCCACTCCCTGG - Intronic
942403701 2:175630435-175630457 TTTTCCTTTTCCCCAGCCCCAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944277252 2:197853022-197853044 TTTCTCCTTTCTCCACTCCCTGG + Intronic
944317264 2:198296271-198296293 TTTTTTTTTTCACTAATTCATGG - Intronic
944625601 2:201565716-201565738 TTTTTTTTTTTACCTTTCCCGGG + Exonic
945111544 2:206364938-206364960 TTTTTCTCTTCCCCAACCCAAGG - Intergenic
945751604 2:213792847-213792869 GTGTTCTTTTCTTCAATCCCAGG + Intronic
946169241 2:217884691-217884713 TTTTTTTTTTCAACATTCACTGG - Intronic
946176651 2:217926404-217926426 TTTTTCTATTCATCCATCCATGG + Intronic
946944099 2:224801758-224801780 ATTTTTTTTTAACCACTCCCTGG + Intronic
947020747 2:225673001-225673023 TTTTTTTTTTCCCCAGTCTCAGG - Intergenic
947945654 2:234099769-234099791 TTTTTCTTGTCATTATTCCCTGG - Intergenic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1169614795 20:7428493-7428515 TATTTCTTTTTCCCAGTCCCTGG + Intergenic
1169939079 20:10917614-10917636 TTTTTCCTCTCTCCAGTCCCTGG - Intergenic
1170476624 20:16721454-16721476 TTCTTCTCTTCTCCTATCCCTGG + Intergenic
1171566339 20:26193825-26193847 TTTTTTTTGTCACCAATCTGTGG + Intergenic
1172987247 20:39001717-39001739 TTTTTCTTTTTAGAAATTCCGGG + Exonic
1173173713 20:40748136-40748158 TTTTTCCTTCCTCCAGTCCCCGG + Intergenic
1174121290 20:48267706-48267728 CTTTTCTTTTCTCAAAACCCTGG - Intergenic
1174429496 20:50457686-50457708 TCTTTCTTTTCCCCAAGCCAGGG - Intergenic
1174859653 20:54078712-54078734 TTTTTTTTTTCAACAATATCTGG - Intergenic
1175356752 20:58374917-58374939 TTTTTCTGCTCCCCACTCCCAGG - Intergenic
1175849946 20:62084732-62084754 TTTTCCCTCTCCCCAATCCCTGG - Intergenic
1176864001 21:14032390-14032412 CTTTTCTTCTCTCAAATCCCAGG - Intergenic
1176952921 21:15066031-15066053 TTTCTCGTTTCACCAATCTGTGG - Intergenic
1176965075 21:15203886-15203908 TTTTTCTTATCAGCAGTGCCTGG + Intergenic
1177247987 21:18555131-18555153 TTTTTCTTTTTACTAATATCAGG + Intergenic
1177253315 21:18625266-18625288 TTTATCCTTTCATCAATCTCAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178087733 21:29129343-29129365 TTTTTCTCTTCCTGAATCCCTGG + Intronic
1179135039 21:38671908-38671930 TTTTTTTTTTTAACAATCCTTGG + Intergenic
1179312236 21:40206674-40206696 TTTTTTTTTTGGCAAATCCCAGG - Intronic
1181447002 22:22984838-22984860 GGTTCCTTTTCACCCATCCCTGG - Intergenic
1184850960 22:47120201-47120223 TTTTTCTTTTCATTAAACTCAGG - Intronic
1184982857 22:48106604-48106626 TATTTCTTTACAGCAATGCCAGG - Intergenic
949244680 3:1912945-1912967 TTTTTTTTTTCCCCAGTTCCAGG + Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
949528706 3:4932303-4932325 TTTTTTTTCTCACCAAGACCAGG - Intergenic
950134466 3:10571007-10571029 TCATTCTTTTCACATATCCCAGG + Intronic
950751672 3:15134019-15134041 TTTTTCTTTTCACATACTCCTGG - Intergenic
950815141 3:15693085-15693107 TTTCTCCTTTCCCCAGTCCCTGG - Intronic
950968071 3:17160380-17160402 TTTTTTTTTTCCCCCAGCCCTGG + Intronic
951099135 3:18666626-18666648 TTCTACTTTTCCCCAATCCCTGG + Intergenic
951315032 3:21179476-21179498 CTCTTCTTTGCACCAATCCTAGG + Intergenic
951669794 3:25167863-25167885 TTTTTCTTTCCACCCTACCCTGG + Intergenic
951745005 3:25968449-25968471 TTATTCTTCACACCAAACCCAGG - Intergenic
953416674 3:42724511-42724533 ATTCTCTTTTGACCAATCTCTGG + Intronic
953507623 3:43501755-43501777 CATTTCTTTCCACCAATCCCTGG - Intronic
953984255 3:47429209-47429231 CTTTTCTTTTCCCCAAATCCTGG + Intronic
954247995 3:49346719-49346741 TTTTTCTTTTCACAGTCCCCTGG - Intergenic
954854257 3:53629204-53629226 TTGTTCTTTTCACTAAACCAGGG - Intronic
955778977 3:62463436-62463458 TGTTTCTTTTCACCATTTCCAGG + Intronic
955817350 3:62859659-62859681 CTTTTCTTTTCTCCACTGCCAGG + Intronic
955999338 3:64712077-64712099 ATTTTCATTTCAGCAATGCCAGG + Intergenic
956109487 3:65856229-65856251 TTTTTCTTCTCCCCAACCCGAGG - Intronic
956372568 3:68579401-68579423 GTCATCTTTTCCCCAATCCCAGG - Intergenic
956607148 3:71084203-71084225 ATCTTCTATTCACCAAGCCCTGG + Intronic
957068937 3:75550289-75550311 TTTTTCTTTTCACATACTCCTGG + Intergenic
957163841 3:76645083-76645105 TTTTTCTTTTCACCTATTCATGG - Intronic
957320870 3:78628506-78628528 TTTCTCTTTTCTCTTATCCCAGG + Intronic
957637122 3:82800753-82800775 TTTTTTTTTTCAAAAATCCATGG - Intergenic
958152786 3:89712978-89713000 TTTTTCTTATGACAAATGCCAGG + Intergenic
958492115 3:94789507-94789529 ATTTTATTTTCTCCTATCCCAGG - Intergenic
958620672 3:96555295-96555317 TCTTTCTTGTCAACAATCTCTGG + Intergenic
961053436 3:123766822-123766844 CTTTTCTTTTCTGCAACCCCTGG - Intronic
961284473 3:125790047-125790069 TTTTTCTTTTCACATACTCCTGG - Intergenic
961610055 3:128129846-128129868 TTTTTCCTTTCCCCAGCCCCTGG - Intronic
963400679 3:144793544-144793566 TTTTTCTTTTGCCCAATCATGGG - Intergenic
963739848 3:149066536-149066558 TTTTTTTTTTAATAAATCCCTGG + Intronic
963988973 3:151631075-151631097 TTATTCTCTTCACCTATCTCTGG + Intergenic
964066042 3:152580833-152580855 TTTTTCTCTACTCCTATCCCTGG + Intergenic
966009648 3:175058865-175058887 TTTTTCTTTTCACCAATGGCAGG - Intronic
966820631 3:183921548-183921570 TTTTTATTTTCAACTATCCAGGG + Intronic
967421137 3:189274113-189274135 TTTTTTTTTTCACTGATCCATGG + Intronic
967424369 3:189309388-189309410 TTTTTCATTCCAGAAATCCCAGG + Intronic
969013273 4:4084832-4084854 TTTTTCTTTTCACATACTCCTGG + Intergenic
969515749 4:7647336-7647358 TCTTTCTCTTCAGCAATCCTGGG - Intronic
969799922 4:9555805-9555827 TTTTTCTTTTCACATACTCCTGG - Intergenic
969961018 4:10944925-10944947 ATTTTCTTTCTATCAATCCCAGG - Intergenic
971026993 4:22598720-22598742 TTTTTCTTTTCCCCACACACAGG + Intergenic
971397260 4:26240303-26240325 TTTTACTTTTTGCCATTCCCTGG + Intronic
971397730 4:26245167-26245189 TCTTTCTTCTCTCCAGTCCCTGG + Intronic
971675444 4:29621256-29621278 TTTTTATTTTCACCTAGCTCAGG - Intergenic
971692036 4:29849306-29849328 TTTCTATTTGCCCCAATCCCTGG + Intergenic
972022320 4:34331150-34331172 GTTTTCTTTTCTCCACACCCTGG - Intergenic
972289975 4:37682837-37682859 TTTTTCATCTCACCAGCCCCAGG + Intronic
972903323 4:43712489-43712511 TTTTTCTATTTCCCAATTCCTGG - Intergenic
973266732 4:48218733-48218755 TTTTTTTCTTGACCAATCCTGGG - Intronic
973305259 4:48640872-48640894 TTTTTATTTTCACTCTTCCCAGG - Intronic
973944333 4:55942009-55942031 TTTTTCCTTTCCCCAATATCAGG + Intergenic
974263077 4:59549945-59549967 TTTGTCTTTTCACCCATGCATGG + Intergenic
974265047 4:59576073-59576095 TATTTCTTAACAACAATCCCAGG - Intergenic
974688242 4:65260853-65260875 TTTTTCTTTGCATAAATCACTGG + Intergenic
974822068 4:67080123-67080145 TTTTTTTTTTCAACAAATCCAGG + Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
976471952 4:85439201-85439223 TTTTTCCGTTCACCAATCAACGG + Intergenic
977039390 4:91996365-91996387 TTCTTCTTTTCCCCAGCCCCTGG - Intergenic
977372937 4:96163334-96163356 TTTTTCTTTTCAAAAATTTCTGG + Intergenic
977684596 4:99834142-99834164 TCTTTCTTTTCTCCAATAACAGG - Intronic
979028751 4:115611677-115611699 ATTTTTTTTTTACAAATCCCTGG - Intergenic
979119317 4:116875211-116875233 TTTTTCTCCACACTAATCCCTGG + Intergenic
979980338 4:127247390-127247412 CTTTTCTTTTCTCCAAATCCTGG + Intergenic
980304137 4:131034692-131034714 TTTTTGTCTTCACCCACCCCCGG - Intergenic
981045992 4:140265919-140265941 TTAGTCTTTCCACCAATCCCTGG - Intronic
981419215 4:144529975-144529997 TCTTTCTTTACCCCTATCCCTGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982483958 4:155944943-155944965 TTTTTTTTTTAATCAATCACAGG - Intronic
982516225 4:156353502-156353524 TTTTCCATTTCACCCATCTCTGG + Intergenic
982520595 4:156411893-156411915 TTTATCCTTTCAAAAATCCCAGG - Intergenic
982846125 4:160254568-160254590 TTTTTTTTTTTGCCATTCCCTGG + Intergenic
983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG + Intergenic
983567822 4:169173470-169173492 TTTTTCATTTCCTCAATCACTGG - Intronic
984154920 4:176184585-176184607 TTTGTATTTTCAACAATGCCTGG + Intergenic
985221687 4:187712973-187712995 TCTTTCTTTTCAAAATTCCCAGG + Intergenic
986115307 5:4768128-4768150 TTTTTCTTCTCACCATCACCTGG + Intergenic
986445007 5:7813833-7813855 TTTTGCTTTTTACCAAACCAAGG - Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988110367 5:26812349-26812371 ATTTCCTTTTCACCATTTCCTGG - Intergenic
988327153 5:29785171-29785193 TTTTTCTTGTCACCTACCCTTGG - Intergenic
988366323 5:30305147-30305169 TTTCTCTTTTTCCCCATCCCTGG + Intergenic
990031122 5:51261005-51261027 TTTTCCCTTTCACCAGCCCCTGG + Intergenic
991470045 5:66958244-66958266 TGTTTCTTTTCAACAAACCAGGG + Intronic
992007756 5:72495200-72495222 CCTTTCTTTTCCCCACTCCCAGG + Intronic
992517854 5:77513811-77513833 TTTTTCTTTTTACCATTCAGAGG - Intronic
994489652 5:100424689-100424711 TTTTTCATTTCTCCAACACCTGG - Intergenic
994764833 5:103902930-103902952 TTTTTTTTTTCCCCAGTCTCGGG - Intergenic
995267680 5:110182688-110182710 TTATTCTTTTTACCACTCACTGG - Intergenic
995346374 5:111123853-111123875 TTTTTCATTCCAACAATTCCTGG + Exonic
995557603 5:113345271-113345293 TTTTTTTTTACTCCAATCCCTGG + Intronic
997502609 5:134388641-134388663 TTTTTCTTTTCCACAACCCTTGG - Intronic
999339891 5:150761367-150761389 TTTTTATTTTCACCAAGGCAGGG - Intergenic
1000382488 5:160641600-160641622 GTTCTCCTTTCACCAACCCCTGG + Intronic
1001643850 5:173265434-173265456 GTTTTCTTTTAACCAAGTCCAGG - Intergenic
1002059981 5:176620382-176620404 TTTTTTTTTTAACCAAAACCAGG - Exonic
1002154903 5:177269580-177269602 TTCTCCTTTTCACCTTTCCCAGG + Exonic
1003133619 6:3416561-3416583 TTTTTCTTTTCTCCACTTGCAGG + Intronic
1003883787 6:10502473-10502495 TGTTTCTTTTCTCTAATCCTCGG + Intronic
1004988652 6:21112076-21112098 TTTTTCTTTTGATAAATCACGGG + Intronic
1005573435 6:27169453-27169475 TTGTTCTTTTCCCCAAATCCTGG + Intergenic
1008128632 6:47695759-47695781 TATTTCCTCTCTCCAATCCCAGG - Intronic
1009335775 6:62489617-62489639 TTATTTTTTTCCCCAATCCTAGG + Intergenic
1009932225 6:70189927-70189949 TTTAACTTTTAACCAATCCCTGG - Intronic
1010929785 6:81787644-81787666 TTTTTATTTTCTTCAATCTCAGG + Intergenic
1011095859 6:83661240-83661262 TTTTTCTTCTCTCTAATCCCAGG - Intronic
1011252906 6:85392016-85392038 TTTTTCTTTTTAAAAATCACTGG - Intergenic
1011484118 6:87824469-87824491 TTTTCCTTTTCACAAATGCTTGG - Intergenic
1011924050 6:92619045-92619067 TTTTTCTTTTCTCTAGTTCCTGG - Intergenic
1012010520 6:93778610-93778632 TTTTTCTCTTGACCACTCTCTGG + Intergenic
1012374187 6:98541161-98541183 CTGTTCTTTTCACCTAGCCCTGG + Intergenic
1013438269 6:110135736-110135758 TTTTTTTTTTTACCAATTACTGG + Intronic
1013799942 6:113931267-113931289 TTTTGCTTGTCACCAAGCACAGG - Intergenic
1015088990 6:129331310-129331332 TTTTTCTTTTCCACATTCCTAGG + Intronic
1015243534 6:131052534-131052556 GTTTTCTTTGCACCCATCCTTGG - Intronic
1015314453 6:131802701-131802723 TTTATCTTTTCACCAGTTGCTGG - Intergenic
1015733028 6:136367611-136367633 TTTTTCTGTTTAGAAATCCCAGG - Intronic
1017219296 6:151947618-151947640 TTTTCCTTTTCATTAACCCCTGG + Intronic
1017646270 6:156542513-156542535 TTTTTCTTTTGACAAAGGCCTGG - Intergenic
1018109599 6:160522431-160522453 TTTAACTTTTCCCCAGTCCCTGG + Intergenic
1018150611 6:160933885-160933907 TTTAACTTTTCCCCAGTCCCTGG + Intergenic
1018496501 6:164352152-164352174 TTTTTCTATTTAACAATCCTGGG + Intergenic
1020727099 7:11829856-11829878 TTTTTTTTTTTACCAAACCAAGG + Intronic
1021578898 7:22131491-22131513 GTTTGCTTTTTACAAATCCCTGG + Intronic
1022446029 7:30471529-30471551 ATTTTGTTTTTACCAAACCCTGG + Intronic
1022639155 7:32165060-32165082 TTCTTCTTTTCAAAAATCTCAGG + Intronic
1023230747 7:38025629-38025651 ACTTTCTTTTCACCATTCTCTGG - Intronic
1023504461 7:40885600-40885622 CATTTCCTTTCACCAGTCCCTGG + Intergenic
1024903147 7:54345453-54345475 TTATTCTTTTCAACAATTCCAGG - Intergenic
1025238531 7:57251981-57252003 CTCTTCTTTTCTCAAATCCCAGG + Intergenic
1026033417 7:66814781-66814803 TTTTTCTTTTAACCATCCCACGG - Intergenic
1027364907 7:77447303-77447325 TTCTTCTTTTCACAATTTCCTGG - Intergenic
1027696002 7:81411477-81411499 TTTTTCTCTTCTCCAGCCCCTGG - Intergenic
1028323264 7:89489390-89489412 TTCTTCTCTTCACTAAACCCAGG + Intergenic
1028329690 7:89574472-89574494 AATTTCTTTTCACCAACACCTGG - Intergenic
1028603996 7:92635027-92635049 TATTTCTTTTTACTAATCCTCGG - Intronic
1030275951 7:107721926-107721948 TTTTTTTTTTAACCATTCCCTGG - Intergenic
1030937429 7:115602421-115602443 TTTTTCTATTCACCAAGCACTGG - Intergenic
1031009975 7:116515819-116515841 TTTGTTTTTTCACTAATTCCAGG - Intergenic
1031280468 7:119794101-119794123 TTTTTTTTTTAACCAATGTCAGG - Intergenic
1032500157 7:132394082-132394104 TTCTTTTTTTCTCCAAGCCCTGG + Intronic
1032555063 7:132824270-132824292 TTTTTTCTTTCACCTATCCCTGG - Intronic
1032683390 7:134208210-134208232 TATGTCTGTTCACCAATACCTGG - Intronic
1032938051 7:136756867-136756889 TTTTTCCTTTCTCCCATCCCAGG + Intergenic
1035101919 7:156404781-156404803 TTTATCTTTTCACCCATCGATGG + Intergenic
1035405769 7:158596176-158596198 TTTTTCTTATGACCAATGGCTGG - Intergenic
1036245777 8:7115536-7115558 TTTTTCTTTTCACATACTCCTGG - Intergenic
1036247725 8:7133796-7133818 TTTTTCTTTTTCCCCATCCTTGG + Intergenic
1036255013 8:7198932-7198954 TTTTTCTTTTCACATACTCCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036362476 8:8088575-8088597 TTTTTCTTTTCACATACTCCTGG - Intergenic
1036888488 8:12578490-12578512 TTTTTCTTTTCACATACTCCTGG + Intergenic
1036896087 8:12636596-12636618 TTTTTCTTTTCACATACTCCTGG + Intergenic
1037061524 8:14516555-14516577 TGTTTCTTTTCACAAACACCTGG + Intronic
1037131245 8:15410498-15410520 TTTTTTTTTTAACCGAGCCCAGG - Intergenic
1037302874 8:17471283-17471305 TCTTTCATTTCACCAATATCAGG - Intergenic
1037545598 8:19917136-19917158 TTTTTCTTTTTACCTGTTCCTGG + Intronic
1038555407 8:28509596-28509618 TTTTTCTTCTCCCTAGTCCCTGG + Intronic
1038627820 8:29211039-29211061 TTTTTCTTTGCACCCCTCCTAGG - Intronic
1039762421 8:40591709-40591731 TTATTCTTCTCATCAAACCCTGG + Intronic
1039925756 8:41930744-41930766 TTTTTTTTTTTACCTATCCCTGG + Exonic
1041740228 8:61150232-61150254 TTTTGCTCTTCTCCAAGCCCAGG + Intronic
1042042670 8:64609799-64609821 TTATTTTTTTAAGCAATCCCAGG - Intronic
1042342843 8:67698332-67698354 TTTTTCTTTTAAACAACTCCTGG + Intronic
1042538363 8:69882305-69882327 TATTTCTATTCAACACTCCCTGG + Intergenic
1042743496 8:72076985-72077007 TTATTCTTTTTACCCAACCCTGG - Intronic
1043045733 8:75321828-75321850 TTTTTTTTGCCTCCAATCCCAGG - Intergenic
1043250536 8:78067350-78067372 TGATCCTTTTCACCAATCCATGG + Intergenic
1043755318 8:83996295-83996317 TTTCTCTTTTCAGCAATACTAGG - Intergenic
1043821579 8:84872674-84872696 TTTTCCTTTCCATCAAGCCCAGG + Intronic
1044564151 8:93645599-93645621 TTTTTCTTCTCACCAGGGCCAGG - Intergenic
1045850087 8:106685684-106685706 TTTTTTTTTTAATCTATCCCAGG - Intronic
1046882168 8:119321015-119321037 TTGTTCCTTTCACCAATTACAGG + Intergenic
1047056801 8:121174062-121174084 TTTTTCTTTTCTCCAATTTCAGG - Intergenic
1047908471 8:129499425-129499447 TTTTTCTTTTACCCAGTCTCAGG - Intergenic
1047987895 8:130255213-130255235 TTTTTCTTTTTGCCAGTACCAGG - Intronic
1048476652 8:134748740-134748762 TTTTAATTTTTACCAATCGCAGG + Intergenic
1048564077 8:135575897-135575919 TTTTTCTGTTCCAGAATCCCTGG + Intronic
1048622469 8:136148935-136148957 TTTTTCCTTTCTCCATTCACAGG + Intergenic
1049614754 8:143571257-143571279 TTTTTCTTTTTAATAATGCCAGG - Intronic
1049701358 8:144014747-144014769 TTTCTCATTCCAGCAATCCCTGG - Intronic
1050911075 9:11071804-11071826 TTTAACGTTTCTCCAATCCCTGG - Intergenic
1051142694 9:13994905-13994927 CTTTTCTGTTGACCAATGCCAGG + Intergenic
1052461937 9:28775983-28776005 ATTTTCATGTCACCAGTCCCTGG + Intergenic
1052980765 9:34447504-34447526 TTTTTCCTTTTACCATTTCCCGG - Intronic
1053087446 9:35237976-35237998 TTCTACTTTGCACCATTCCCTGG - Intronic
1054572414 9:66825210-66825232 GTTTTCTTTTTATTAATCCCAGG + Intergenic
1055735252 9:79321702-79321724 TATTTCTTTCCACCATTCCTTGG + Intergenic
1056129795 9:83573010-83573032 TTTTATTTTTCTGCAATCCCAGG - Intergenic
1056224322 9:84480611-84480633 TTCCTCTTTTCACCAAGCCTGGG - Intergenic
1056479255 9:86984394-86984416 TTTTTTTTTTCACCCAGCCTTGG - Intergenic
1056671262 9:88629306-88629328 TTTTTGTTTTCATCAAGCCGTGG + Intergenic
1056878945 9:90369814-90369836 TTTTTTTTTTGACAATTCCCTGG - Intergenic
1057549747 9:96043727-96043749 AATTTCTCTTCACCACTCCCTGG - Intergenic
1058749276 9:108023283-108023305 TTCCTCTTTTTACCAAGCCCTGG + Intergenic
1058774674 9:108271963-108271985 CTTTTCTTTTCAGCATTCTCAGG + Intergenic
1058942345 9:109824639-109824661 TTTTAGTTTTCATCAATCTCTGG + Intronic
1059763435 9:117361178-117361200 TTTGTCTTTTCACAAATGCTCGG - Intronic
1186159557 X:6762513-6762535 TTTCTCTTTTCTCCACTCCCTGG - Intergenic
1187080132 X:15977257-15977279 TTTTTTTTTTCACCAGTTCCCGG + Intergenic
1187801585 X:23069611-23069633 TCTTTCTTTTCCCCTATCGCAGG - Intergenic
1188457424 X:30382416-30382438 GTTGGTTTTTCACCAATCCCTGG + Intergenic
1188572630 X:31606668-31606690 TTTATTTTTTCACCAAACCAAGG + Intronic
1190439376 X:50462434-50462456 TTTTTCTTTTAAAAAATCTCAGG + Intronic
1191841857 X:65518993-65519015 TTTTTCTTTTCCTCCATTCCAGG - Intronic
1192083818 X:68074163-68074185 TTTCTCTTTACACTAATCACTGG - Intronic
1192206812 X:69101835-69101857 ATTTGCTGTTCACCAGTCCCCGG + Intergenic
1193187729 X:78532836-78532858 TGTTTCTTTTTACCAATTCCTGG - Intergenic
1194029869 X:88799518-88799540 TTTTTTGTTTCACATATCCCAGG + Intergenic
1194192226 X:90851412-90851434 TTTTTCTTTACACTAATCCTTGG + Intergenic
1194782432 X:98041112-98041134 TTTTTTTTTTCACGTATCTCAGG + Intergenic
1195676847 X:107513126-107513148 TCTTTCCTTTCACAAATACCTGG - Intergenic
1195728194 X:107938622-107938644 TTTCTCTATTTACCAATCCTTGG - Intergenic
1196242976 X:113365580-113365602 GTTTTTTTTACTCCAATCCCTGG - Intergenic
1196819041 X:119688406-119688428 TTTTTATTTTGAAAAATCCCAGG + Intronic
1197331782 X:125161621-125161643 ATTTTCCCTTCCCCAATCCCTGG - Intergenic
1197383237 X:125771076-125771098 TGATTCTTTTCATCCATCCCAGG - Intergenic
1198966606 X:142233896-142233918 TTTTACTTTTCAGTATTCCCTGG + Intergenic
1200410880 Y:2860374-2860396 TTTCCCTTCTTACCAATCCCAGG + Intronic
1200538861 Y:4433859-4433881 TTTTTCTTTACACTAATCCTTGG + Intergenic
1200801491 Y:7391279-7391301 ATTTCCTTTCCATCAATCCCAGG + Intergenic
1201292307 Y:12432952-12432974 TTGTTTTTTTCCCCAACCCCTGG + Intergenic
1201369439 Y:13245682-13245704 TTGTTCTTTACACATATCCCAGG - Intergenic
1201560182 Y:15307574-15307596 TTTTTTTTTTTGCCAATCTCAGG + Intergenic
1201601037 Y:15728706-15728728 ATTTCCTTTCCATCAATCCCAGG + Intergenic
1201887637 Y:18902994-18903016 TTTTTCTTTTTCCCCCTCCCTGG - Intergenic
1202063121 Y:20909076-20909098 ATTTCCTTTTTATCAATCCCAGG - Intergenic