ID: 949473552

View in Genome Browser
Species Human (GRCh38)
Location 3:4420913-4420935
Sequence CAGGGTCACCCAGCTAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949473552_949473562 28 Left 949473552 3:4420913-4420935 CCAACATTAGCTGGGTGACCCTG 0: 1
1: 0
2: 6
3: 43
4: 304
Right 949473562 3:4420964-4420986 CTAGTCCTTGTCTGTGAAATGGG 0: 1
1: 0
2: 6
3: 29
4: 394
949473552_949473561 27 Left 949473552 3:4420913-4420935 CCAACATTAGCTGGGTGACCCTG 0: 1
1: 0
2: 6
3: 43
4: 304
Right 949473561 3:4420963-4420985 CCTAGTCCTTGTCTGTGAAATGG 0: 1
1: 0
2: 2
3: 31
4: 312
949473552_949473557 -1 Left 949473552 3:4420913-4420935 CCAACATTAGCTGGGTGACCCTG 0: 1
1: 0
2: 6
3: 43
4: 304
Right 949473557 3:4420935-4420957 GGGCAAGTTCACTACTTGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949473552 Original CRISPR CAGGGTCACCCAGCTAATGT TGG (reversed) Intronic
900227193 1:1538871-1538893 CAAGGTCACACAGCTAGTGAAGG - Intronic
900712243 1:4121830-4121852 CAAGGCCATCCAGCTAATTTGGG - Intergenic
901701259 1:11045785-11045807 CGAGGTCACCCAGCTAATGAGGG + Intronic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902560815 1:17276531-17276553 CAGGGTCACCCAGGTGGTGCGGG + Exonic
902932791 1:19743180-19743202 CAGGGTCACCCAGCTAGTCAGGG - Intronic
903179934 1:21600072-21600094 CAGGGTCACTCAGCACAGGTGGG + Intronic
903806922 1:26012250-26012272 TAGGGTCACCCAACCAGTGTGGG - Intergenic
904475221 1:30760467-30760489 CAGGGCCATCCAGATAATGCAGG - Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904662075 1:32092846-32092868 CAAGGTCACCCAGCCAATGAGGG + Intronic
904976448 1:34460568-34460590 CAAGGTCACGCAGCTAATGAGGG + Intergenic
905804996 1:40869935-40869957 CAGGGCCACACAGCTAGTGATGG + Intergenic
905895281 1:41541722-41541744 CAAGGTCACACAGCTAATAAGGG - Intronic
906082707 1:43104004-43104026 CAAGGTTACACAGCTAATATGGG + Intergenic
907483934 1:54764087-54764109 CAGGGTCACCGAGCGAGTGAAGG - Intronic
907516882 1:54998456-54998478 CAAGGTCACACAGCTAAAGATGG - Intergenic
909939824 1:81598242-81598264 CAGAGTTACACAGCTAATATTGG + Intronic
910052849 1:82996388-82996410 CATGGTCATCCAGATACTGTAGG + Intergenic
911164752 1:94714566-94714588 CTAGTTCACCCAGCTAAAGTTGG - Intergenic
911354483 1:96799159-96799181 CTGGGTGACCCAGCTGATGAGGG + Intronic
912569909 1:110613765-110613787 CAGGGTCACCCAGCCAGTCCAGG + Intronic
913538435 1:119796190-119796212 CAGGGTCACACAGCTCAGCTAGG + Intronic
914759772 1:150589146-150589168 CAGGGTCACTCAGCTAGTAAGGG - Intergenic
914804732 1:150983677-150983699 CAAGGTCACTCAGCTCATGACGG + Intronic
914938476 1:152001335-152001357 CAAGATCACACAGCTAATGAGGG - Intergenic
915933941 1:160079079-160079101 CAGGTTCACCCAGCTAGTAGTGG + Intergenic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG + Intronic
918589120 1:186221326-186221348 CAGGGTCACACAGCTACTAAGGG + Intergenic
919591187 1:199504578-199504600 CAGGTTCACCCAGATATTATAGG - Intergenic
919958982 1:202447295-202447317 CAAGGTCACACAGCTAGTGAGGG + Intronic
920033313 1:203049913-203049935 CAGAGTCACCCAGCTTACTTGGG + Intronic
920342859 1:205286534-205286556 CAAGGTCACACAGCCAATCTGGG + Intergenic
923497095 1:234535113-234535135 CAGGGTCACCCAGCAACCCTGGG - Intergenic
924178888 1:241421171-241421193 CAAGGTCACACAACTAATGCTGG + Intergenic
1063338145 10:5236283-5236305 CAGGTACACCAATCTAATGTAGG - Intergenic
1064733151 10:18354059-18354081 CAATGTCACCCAGCTAATTAAGG - Intronic
1064776723 10:18787091-18787113 CAAGGTGACACAGCTAATTTTGG - Intergenic
1065756877 10:28938754-28938776 CAGGTTAATACAGCTAATGTGGG + Intergenic
1066452930 10:35547891-35547913 GAGGGTCACCCAACTAATTTGGG + Intronic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1069621213 10:69838286-69838308 TAGGGTCACCCAGCCAATGCTGG + Intronic
1070388407 10:75947581-75947603 CAAGGTCACCCAGCTAAAAGGGG - Intronic
1070798295 10:79230004-79230026 CAGGGTCACACAGCTAGGGAGGG + Intronic
1072922781 10:99590624-99590646 CATGGTCATCCAGCTAAGGTGGG - Intergenic
1073221617 10:101879256-101879278 CAGGGTCACACAGCTATTAGTGG - Intronic
1074352147 10:112748087-112748109 AAAGGTCACTCAGCTAATCTTGG + Intronic
1074470170 10:113719767-113719789 CCAGGTCACCCAGCTAGTGAAGG - Intronic
1074479944 10:113810103-113810125 CAGGGTCACTCAGCTTCTATAGG + Intergenic
1074720624 10:116261902-116261924 CAAGGTCACCCAGCTAGTTACGG + Intronic
1076290425 10:129341429-129341451 CAAGGTCACACAGCTAATTACGG + Intergenic
1077632566 11:3820932-3820954 CAAGGTCACCCAGCTAATAAAGG + Intronic
1078351997 11:10602430-10602452 CAAGGTCACACAGCGAATGAAGG + Intronic
1078998504 11:16729094-16729116 CAGGTACACCCATCAAATGTAGG - Intronic
1079050932 11:17158507-17158529 CAAGGTCATACAGCTAATATAGG + Intronic
1080408780 11:32003731-32003753 CAGGGTCACACAGCCAATCAAGG + Intronic
1081598339 11:44474682-44474704 CAGGGTCACCTTGCTGATGAGGG - Intergenic
1081852914 11:46286012-46286034 CAGGGTCACACAGCAAGTGAGGG - Intronic
1082085849 11:48048948-48048970 CAGGCTCACACAGCCAATGCTGG + Intronic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083528341 11:63393925-63393947 CAGGTACACCAAGCAAATGTGGG + Intronic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084412301 11:69011936-69011958 CAGGGACACCCACATAATGGAGG - Intronic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1085011717 11:73145969-73145991 CAAGGTCACACAGCTAGTGAAGG + Intergenic
1085715252 11:78866840-78866862 TAGGGTCACCCAACCAAGGTTGG + Intronic
1085786599 11:79457079-79457101 CAAGGTCACACAGCTAAGTTGGG - Intergenic
1087086312 11:94222099-94222121 CAGGCTCACCCAGGTTATCTAGG - Intergenic
1087705314 11:101483796-101483818 CATTGTCACTCAGCTAATGAGGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089351819 11:117825606-117825628 CAGGGTCACACAGCCAGTGTGGG + Intronic
1090170164 11:124594876-124594898 CAAGGTCACAGAGCTAATGGAGG - Intergenic
1090298965 11:125617356-125617378 CAAGGTCACCCAGCTAGAATTGG + Intronic
1091615946 12:2051921-2051943 TAGGGTCACCCAGGGAATGAGGG + Intronic
1091624987 12:2115015-2115037 CAAGGTCACCCAGCTAAACCAGG + Intronic
1094005217 12:25741890-25741912 AAAAGTCACCCAGCTAATGGTGG - Intergenic
1094363753 12:29658582-29658604 CAGTGTTACCCAGCTGCTGTTGG - Intronic
1094629356 12:32157901-32157923 CAGGGTCTCACAGCTAATAGTGG - Intronic
1096851215 12:54438869-54438891 CAAGGTCATACAGCTGATGTGGG + Intergenic
1096872389 12:54601532-54601554 CAGGCCCACCCAGATAATCTAGG - Intergenic
1099934852 12:89112517-89112539 CAAGGTCACTCAGCTAGTATTGG - Intergenic
1100131104 12:91494629-91494651 CAGGATCACACAGCTAATTAGGG + Intergenic
1100174386 12:92012751-92012773 CAGGCTCAAGCAGCTAATTTGGG - Intronic
1101570722 12:105951313-105951335 CAAGGTCACACAGCTAATATTGG + Intergenic
1101599983 12:106200915-106200937 CAAGGTCACCCAGCTACTAGTGG + Intergenic
1101748005 12:107558854-107558876 CAAGGTCACACAGCTAAGTTAGG + Intronic
1102004707 12:109581710-109581732 CAGGGCCACACAGCTAGTGCTGG + Intronic
1102435618 12:112920903-112920925 CAGGGTCACCCAGCTGGTCAGGG + Intronic
1102458200 12:113084090-113084112 TAGGGTCACCCAGCCAGTGGGGG + Intronic
1102638778 12:114347788-114347810 CAGTGTTACCCAGCTCATGGTGG - Intergenic
1102929442 12:116851149-116851171 CAGGGTCACCCAGCCAGCATGGG + Exonic
1103119223 12:118366935-118366957 CCACGTCACCCAGCTAATTTTGG - Intronic
1103198231 12:119065138-119065160 CAAGGCCACCCAGCTAATAAGGG + Intronic
1103331101 12:120154633-120154655 CACGGTCACGCAGCTAGTGCAGG + Intronic
1103487727 12:121294629-121294651 CAGGGTCACACAGCCAGTGCAGG - Intronic
1104037429 12:125107321-125107343 CAGGGCCTCCCAGCTGATGATGG + Intronic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1104808847 12:131607616-131607638 CAGAATCCCCCAGGTAATGTCGG - Intergenic
1104895249 12:132160808-132160830 CAGGTTCCCCCAGCTGGTGTCGG + Intergenic
1106485479 13:30168527-30168549 CAAGGTCACACAGCTAAAATGGG - Intergenic
1108520742 13:51244859-51244881 CAGGCTCTCCCACCTAAGGTGGG + Intronic
1112749180 13:102564836-102564858 CAAGGACACCCAACTAAGGTGGG + Intergenic
1117092595 14:52266191-52266213 CAGGGTCACACAGCCAGTGGTGG + Intergenic
1118911493 14:70065536-70065558 CAAGGTCACCCAGCTAGTGAGGG - Intronic
1119253337 14:73176786-73176808 AGGGGTCACACAGCTAGTGTGGG + Intronic
1119485953 14:74986714-74986736 CAAGGTCACCCAGCTTGTGAGGG + Intergenic
1119647985 14:76362278-76362300 CAGGGTCACATTGCTAATGAAGG + Intronic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1119779238 14:77267079-77267101 CAAGGTCACCCAGCTGATGAAGG - Intronic
1121173309 14:91872183-91872205 TAGGGTTACCCAGCTAGTCTTGG + Intronic
1121337700 14:93087302-93087324 CAGGCCCACCCAGGTAATGCAGG + Intronic
1122164860 14:99814972-99814994 CAGGGTCACACAGCTAGGGAGGG + Intronic
1122825796 14:104369806-104369828 CAGGGTCACCCTGCAGATTTTGG - Intergenic
1122877135 14:104673280-104673302 CCAGGTCACCCAGCTAGTGATGG - Intergenic
1124890434 15:33727094-33727116 CTGGGTCCCCCAGCTTGTGTAGG + Intronic
1127255484 15:57288626-57288648 AAGGGTTTCCCAGATAATGTCGG - Intronic
1127256880 15:57300197-57300219 CAGGGTTACCCAGGTAGTGGAGG - Intergenic
1128136363 15:65266530-65266552 AAGGGACACCCTGCTGATGTGGG - Intronic
1128254513 15:66186861-66186883 CAGGGTCACAGAGCTACTGATGG + Intronic
1128891789 15:71338179-71338201 CAAGGTCACACAGCTAATTAGGG - Intronic
1129059311 15:72848216-72848238 CAGGGTCACCCAGCAAGAGCTGG + Intergenic
1129779331 15:78259866-78259888 CAGGGTCACACAGCCAGTGAGGG + Intergenic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1129976147 15:79823471-79823493 CAAGGTCACGCAGCTGGTGTTGG - Intergenic
1130997424 15:88911770-88911792 CAGAGTCACCCATCTAAGGCTGG + Intronic
1132334723 15:101038903-101038925 AAGGTCCACCCAGATAATGTGGG + Intronic
1132604154 16:786752-786774 CAGGGCCACGAAGCTTATGTTGG - Intronic
1133222236 16:4323716-4323738 CAAGGTCACCCAGATAATTCAGG - Intronic
1133330933 16:4973444-4973466 CAGTGTCACCCAGCTGATGAAGG - Intronic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1133368504 16:5229864-5229886 CAAGGTCACCCAGCTAGTAAAGG - Intergenic
1133796487 16:9050560-9050582 CAGGCTCACCCTGGAAATGTCGG - Intergenic
1134135273 16:11673168-11673190 CAGGCTCACCCAGCCATGGTGGG + Intronic
1134238889 16:12489488-12489510 CAGGGTCACACAGCCAGTGTGGG - Intronic
1134309518 16:13062969-13062991 TAGGGTCACTCAGCTAGTGAGGG - Intronic
1134686494 16:16162347-16162369 CAGGGTCTCACAGCTAATACTGG - Intronic
1134788517 16:16966649-16966671 CAGGGTCACACAGCAAATCAGGG + Intergenic
1135689662 16:24526083-24526105 CAAGGTCACACAGCAAGTGTTGG + Intergenic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136608196 16:31350573-31350595 TCAGGTCACCCAGCTAGTGTGGG - Intergenic
1136632940 16:31499687-31499709 AAGGTTCTCCCAGCTAATGGTGG - Intronic
1137411344 16:48230760-48230782 CAGACTCACTCAGCAAATGTGGG - Intronic
1137583580 16:49650294-49650316 CATGGTCTCACAGCTAATGATGG - Intronic
1137693483 16:50446000-50446022 CATGGTCACCCAGCAAAGATGGG - Intergenic
1137931579 16:52592963-52592985 CAGGGTCAACCAGCTAATATCGG - Intergenic
1138110264 16:54318222-54318244 CAGGGTCATACAGCTAATAGAGG + Intergenic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1141165083 16:81654928-81654950 CAAGGCCACCCAGCTACTGAGGG - Intronic
1141995619 16:87634878-87634900 CAGTGTCACCCAGCTAGAGCGGG - Intronic
1143270180 17:5669507-5669529 CAGGGTCACCCAGCAAGTCAGGG + Intergenic
1145271379 17:21406641-21406663 CAAGGTCACACAGCTTATGAGGG + Intronic
1145309584 17:21694045-21694067 CAAGGTCACACAGCTTATGAGGG + Intronic
1145907747 17:28525504-28525526 CAGGGTCACGCCGCTTATGGAGG - Intronic
1145976656 17:28987839-28987861 CAAGGTCACGCAGCTAATGATGG + Intronic
1147498281 17:40938152-40938174 GAGGGTCACCCAACTCATGCAGG - Intergenic
1147849174 17:43427923-43427945 CAAGTTCCCCCAGCTAAGGTGGG - Intergenic
1147995720 17:44359487-44359509 CAAGGACACCCAGCTAATATAGG + Intronic
1148479650 17:47951692-47951714 CAAGGTCACCCAGCTACTAAGGG + Intergenic
1148772177 17:50073873-50073895 CAGGGTCACCCAGGTACTCTGGG - Intronic
1150819264 17:68421970-68421992 AATGGTCACCCAGCTTATTTAGG + Exonic
1154193765 18:12251580-12251602 CAAGGTCACCCAGCTAGAGGAGG + Intergenic
1154961463 18:21313507-21313529 CAAGGTTGCCCAGCTAATGAGGG + Intronic
1157117222 18:44873258-44873280 CAGGGTCACAAAGCTAATATTGG - Intronic
1157247831 18:46070105-46070127 CAGGGTCACCTAGCTAGTAAGGG + Intronic
1158664721 18:59422102-59422124 GAGGGTCACCCAGCTAGTAATGG + Intergenic
1159598841 18:70409534-70409556 CAGGGTCACATAGCTAGTGAGGG + Intergenic
1160265263 18:77336407-77336429 CAGGGTCCCCCAGATAATCCAGG - Intergenic
1161103606 19:2433038-2433060 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103640 19:2433143-2433165 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103675 19:2433248-2433270 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103710 19:2433353-2433375 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103743 19:2433458-2433480 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103778 19:2433563-2433585 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103813 19:2433668-2433690 CGGGGTGACCCAGCTGATGGGGG - Intronic
1161103848 19:2433773-2433795 CGGGGTGACCCAGCTGATGGGGG - Intronic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1162324236 19:9989347-9989369 CAGGGTCACCCAGGACATGAGGG - Exonic
1163034689 19:14563884-14563906 CACCGTCACCCAGCTGATCTGGG - Exonic
1163300533 19:16442882-16442904 TAGGGTCACGCAGCTAATCGGGG + Intronic
1164801083 19:31077324-31077346 CAGGGTCTCTTAGCTAATGAGGG - Intergenic
1165823767 19:38693838-38693860 CATGGTGACCCAGCTAAGGCGGG - Intronic
1166970794 19:46566080-46566102 CAGGCTCACCCAGATTATCTAGG - Intronic
925910949 2:8573423-8573445 CAGGGCCACCCAGGTAATGAGGG + Intergenic
926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG + Intergenic
928344278 2:30476297-30476319 CAGGGTCACACAGTAAGTGTTGG + Intronic
929310681 2:40420892-40420914 CTGGGTCACACAGCTAATAAAGG - Intronic
929475370 2:42241783-42241805 CAAGGTCACCAAACTAATCTAGG - Intronic
929993919 2:46813115-46813137 CAGAGTCACCCAGCTAGTGAGGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931817747 2:65921324-65921346 CAGGGTCAGCCAGCTACTCTGGG - Intergenic
931821311 2:65955049-65955071 CAGAGTCTCCCAGGTAATATGGG + Intergenic
931962093 2:67493475-67493497 CAAGGTCACACAGCTCATATTGG - Intergenic
933704923 2:85282631-85282653 CAGGGTCACACAGCCTATGTTGG + Intronic
934048761 2:88192635-88192657 CAAGGTCACACAGCTAATCAGGG + Intergenic
936958606 2:118049337-118049359 CAAGGTCACACAGCTAATAGTGG + Intergenic
937061035 2:118980685-118980707 CACGGACACCCAGCTGATGGTGG + Intronic
937247300 2:120501951-120501973 CAGGGTCACACAGCAAATCAGGG + Intergenic
937359139 2:121217146-121217168 CAGGGTCCCACAGCTACTGATGG - Exonic
937896514 2:126980291-126980313 CACGGCCACCCAGCTAAAGATGG - Intergenic
937983645 2:127628935-127628957 CAGGGTCACACAGCTCAAGGGGG + Intronic
938979885 2:136516298-136516320 CAGGGTCACACAGCTCATTGTGG - Intergenic
945039631 2:205733235-205733257 CAGCGTCACCCAGCTCCCGTGGG + Intronic
946187327 2:217988417-217988439 CAAGGTCACACAGTGAATGTTGG + Intronic
947271816 2:228344685-228344707 GAGGGTCACTCAGATAAGGTAGG + Intergenic
947595576 2:231409651-231409673 CAGGGACACCCAGAAAATGGAGG + Intergenic
947731003 2:232431623-232431645 CAGGGTCACTCAGCAGGTGTTGG - Intergenic
948021568 2:234737792-234737814 CATGGTCACCCACCTAATTAGGG + Intergenic
948229254 2:236337553-236337575 CAGGGTCACCCAGCTATGCAGGG + Intronic
1168760301 20:346316-346338 CAAGATCACACAGCAAATGTGGG + Intergenic
1169759308 20:9074140-9074162 CAGGGTCACACAGCTAAAAGAGG - Intronic
1169939634 20:10923324-10923346 CAGAGTAACCCAACTAATGGGGG + Intergenic
1170470366 20:16662586-16662608 CAGGGTCACCCCCATCATGTTGG + Intergenic
1170551545 20:17481432-17481454 CAGGCTCACACAGCCAGTGTGGG + Intronic
1172324201 20:34021706-34021728 CAAGGTCACGCAGCTAATAAAGG - Intronic
1172627169 20:36353928-36353950 TAAGGTCACCCAGCAAATGAGGG + Intronic
1172659306 20:36556712-36556734 GAAGGTCACCCAGCGAATTTGGG + Intergenic
1173173391 20:40745142-40745164 CAGGGTCACACAGCTATTTGTGG + Intergenic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1173658846 20:44719328-44719350 CAAGGTCACTCAGCTAATAAGGG + Intronic
1173843128 20:46172058-46172080 CAAGGTCTCCCAGCTAGTATGGG - Intergenic
1173922233 20:46754955-46754977 CAAAGTCACCCAGCCAGTGTGGG - Intergenic
1173940457 20:46906711-46906733 CAAGGTCACCCAGCAAGTGCAGG + Intronic
1173965606 20:47110183-47110205 CAAGGTCACCCAGCTTAGGAGGG + Intronic
1174141024 20:48413704-48413726 CAAAGTCACCCAGCTAGTGGTGG + Intergenic
1178638832 21:34329730-34329752 CAGGGGCACCAAGCAGATGTAGG - Intergenic
1179402084 21:41093796-41093818 CAGTGTCACCCTGCTGATGGTGG + Intergenic
1179420611 21:41233375-41233397 CTGGGTCACACAGCTAATAAGGG + Intronic
1181745050 22:24950428-24950450 CAGGGGGAACCAGCTAAGGTGGG + Intergenic
1181998171 22:26899467-26899489 CAGGGTCACCCAGCTATTTAGGG - Intergenic
1182711234 22:32324711-32324733 CAGGGTCACACAGCTTGTGAGGG - Intergenic
1183738691 22:39658059-39658081 CAGGGTCACACAGCCAGGGTGGG + Intronic
1183948943 22:41342097-41342119 CAGGACCACACAGCTAGTGTAGG - Intronic
1184200251 22:42963679-42963701 CAAGGTCACCCAGCTAATAAGGG + Intronic
1184398760 22:44261515-44261537 CAGGGTCACACAGCTTCTGAGGG - Intronic
1185009115 22:48303264-48303286 CAGGAGCAGCCAGCAAATGTAGG - Intergenic
1185118394 22:48951102-48951124 CAGGGAGACACTGCTAATGTTGG + Intergenic
949423373 3:3890225-3890247 CAGGTACACCAAGCAAATGTAGG + Intronic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
952679348 3:36073682-36073704 GAGGGGCACCCACCTAATGCTGG + Intergenic
953162498 3:40434184-40434206 CAGGCTCACCCAGATTATCTAGG + Intergenic
954626022 3:52022293-52022315 CAGGGTCACACAGCCATAGTGGG - Intergenic
955405586 3:58623720-58623742 CAGGGTCACCCAGCTAGTAAGGG - Intronic
955405935 3:58625828-58625850 CAGGGTCATGCAGCTAGTGGGGG - Intronic
956122501 3:65980173-65980195 CAGTGTCACACAGCTAATAAGGG - Intronic
959804016 3:110529337-110529359 CAGAGGCACCCAGCTAAGCTGGG + Intergenic
961496134 3:127293168-127293190 CACAGTCACCCAGCTACTGTGGG + Intergenic
961928181 3:130505362-130505384 CAAGGTCACCCAGCCAATGGTGG - Intergenic
964529791 3:157655175-157655197 CAGGCACACCCAGCTGGTGTGGG - Intronic
965492109 3:169350290-169350312 CAAGGTCACCCAACTACTTTGGG - Intronic
965797010 3:172449710-172449732 GAGGGTCACCTTGCTAGTGTAGG - Intergenic
966705719 3:182911478-182911500 CAAGGTCACCCACTTAATCTGGG - Intronic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
967955138 3:194872147-194872169 CAAGGTCACACAGCTCATATCGG + Intergenic
969055212 4:4397404-4397426 CAAGGTCACCCAGCTAATGAGGG + Intronic
969254726 4:5994164-5994186 CAGGGTCACACAGCTGCTGCAGG - Intergenic
969712242 4:8850890-8850912 CTGGGGCACCCAGCACATGTGGG - Intronic
969813502 4:9668560-9668582 CACGGTCGCCCAGCTAAGGAAGG - Intergenic
969845806 4:9919235-9919257 CAGGATCACTCAGTTAATGTAGG + Intronic
970557648 4:17250901-17250923 CATGGTCACCTAGCTCATGATGG - Intergenic
971396933 4:26237103-26237125 CAGGGCCAACCAGCTGCTGTTGG - Intronic
972378074 4:38492026-38492048 CAAGGTCACACAGCTAATGTTGG + Intergenic
972634398 4:40870452-40870474 CAGGGTCAGCCAGCTAACAGAGG + Intronic
972932419 4:44089536-44089558 CAAAATCACCCAGCTAATGAAGG - Intergenic
973045616 4:45532237-45532259 CAGGGTCAACCAACTGTTGTTGG - Intergenic
973757870 4:54093036-54093058 CAAGGTCACACAGCTAGTGATGG - Intronic
978055065 4:104253458-104253480 CAGGTACACCAAGCAAATGTAGG - Intergenic
979629606 4:122885641-122885663 CAGGTGCACCAAACTAATGTAGG - Intronic
980082304 4:128357074-128357096 CAGGGCCACCCAGATAATACAGG - Intergenic
981584778 4:146289141-146289163 CAGTGCCACCCAGCTAATGACGG - Intronic
982689155 4:158528834-158528856 CTGGGTGCCCCAGATAATGTAGG + Intronic
984684003 4:182645542-182645564 CAGAGGCACCCAGCTAAGTTGGG - Intronic
985567805 5:629190-629212 GAGGGTCACCATGCTAAGGTGGG + Intronic
985979605 5:3451617-3451639 AATGGTCACCCAGCTTCTGTTGG - Intergenic
986675341 5:10179171-10179193 CAGGTACACCCATCAAATGTAGG - Intergenic
987918179 5:24243243-24243265 CAGGCTCACCCAGTTTATCTAGG + Intergenic
988779951 5:34511482-34511504 CAGTGTCACCCAGGTGATCTGGG - Intergenic
990350340 5:54909458-54909480 CAGGGTCACACAGCCAAGCTGGG + Intergenic
990532259 5:56686170-56686192 CAAGGTCACACAGCTAGTGAAGG - Intergenic
990746266 5:58962376-58962398 TAAGGTCACCCAGCTAATTTGGG + Intergenic
991589880 5:68239585-68239607 CAAGGTCACACAGCTAGTGGAGG + Intronic
992467116 5:77017460-77017482 TAAAGTCACACAGCTAATGTGGG + Intergenic
992668595 5:79036041-79036063 CAAGGTCACCCAGCTAACAGTGG - Intronic
993698272 5:91087828-91087850 CAAGGTCACACAGCTAGTGAAGG + Intronic
995885334 5:116888186-116888208 CAGGGGCACACTTCTAATGTGGG + Intergenic
996004524 5:118404912-118404934 GAGGGGCACCGAGCTGATGTTGG + Intergenic
996410322 5:123151763-123151785 CAGGGTCCCCCAGCTCACCTTGG + Intronic
997395335 5:133555397-133555419 CCGGGTCACACAGCTAATTGAGG - Intronic
997955707 5:138277024-138277046 CAAGGTCATCCAGCTAGTGTCGG - Intergenic
998602304 5:143597504-143597526 CAAGGTCACACAGCTGGTGTGGG + Intergenic
999419639 5:151429651-151429673 CAAGGTCACACAACTAATATAGG + Intergenic
999509166 5:152229908-152229930 CAAGGTCACATAGCTAATTTTGG - Intergenic
999751263 5:154629682-154629704 CAGGGCCAGGCAGCTCATGTGGG + Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1002392268 5:178924399-178924421 CAAGGTCACACAGCTAATAGTGG + Intronic
1002837956 6:881114-881136 TAGGATCACCCAGCTCATCTGGG - Intergenic
1003156893 6:3604452-3604474 GAGGCTCACCCACATAATGTAGG - Intergenic
1004342065 6:14816679-14816701 CAAGGTCACCCAGCAGATGGAGG + Intergenic
1004589016 6:17030832-17030854 CAGGGCCAGCCAGCTACTGTGGG + Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1007475456 6:42116779-42116801 CAGGTTCCCCCAGCTACAGTGGG - Intronic
1007754792 6:44092338-44092360 CAAGGTCACACAGCCAGTGTTGG - Intergenic
1010302654 6:74280171-74280193 CAAGGTGACCCAGCAAATGAAGG + Intergenic
1013291405 6:108721760-108721782 CAGGGTCACACAGCTTGTGGAGG - Intergenic
1013957072 6:115853825-115853847 CAGGTTCACCAATCCAATGTAGG - Intergenic
1016413158 6:143805028-143805050 AAGGGTCACACTGCTAATGAGGG + Intronic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017265296 6:152438590-152438612 AAAGGTCACTCAGCTAATGAAGG - Intronic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1018344123 6:162882839-162882861 CAGGGTAAGCCTGCTAAAGTGGG - Intronic
1018999386 6:168736003-168736025 CAGGGTCATCCAGGAAGTGTAGG - Intergenic
1022020730 7:26397821-26397843 CAGCATAACCCAGCTAAGGTGGG - Intergenic
1023032610 7:36104003-36104025 CATGGTCACACAGCAAATATTGG - Intergenic
1027238142 7:76310270-76310292 CAGGGTCACCCAGCAGGTCTGGG + Intergenic
1027540485 7:79458017-79458039 CAGGGCAACAAAGCTAATGTGGG + Intergenic
1030382771 7:108831635-108831657 CAGGGTCACATAGCTGTTGTTGG + Intergenic
1032390047 7:131549927-131549949 GAGGGTCCCCCAGCTAAGGTTGG - Intronic
1032536357 7:132667961-132667983 CAAGGTTACCCAGCTAGAGTTGG + Intronic
1034030027 7:147751125-147751147 CAAGGTCACACAGCTAATTGTGG - Intronic
1034260336 7:149751476-149751498 CAGGGTCCCACAACTAAGGTGGG - Intergenic
1036725572 8:11217839-11217861 CAGGGTCACCTAGGTGATGTGGG - Intergenic
1037780527 8:21865365-21865387 CAAGGTCACATAGCTAGTGTTGG - Intergenic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1040016294 8:42702949-42702971 CAGGGCCATCCAGCTGATGGTGG - Intronic
1040880902 8:52203284-52203306 CAAGGTCACACAGCTAATCAGGG + Intronic
1041074224 8:54154521-54154543 CAAGGTCACACAGCTAGTCTTGG - Intergenic
1045362042 8:101441862-101441884 CAAGGTCATCCAGCTAGTATAGG + Intergenic
1046514010 8:115235023-115235045 CAGAGTCACACAGCTAGTGATGG + Intergenic
1046733867 8:117755037-117755059 CAAGGTCACACAGCTAATTTGGG - Intergenic
1048140430 8:131789017-131789039 CAGGGTCACGCAGCTAGCGAAGG + Intergenic
1048826079 8:138428595-138428617 CAAGTTCACCCAGCTAATGTTGG + Intronic
1048874231 8:138824307-138824329 CAGGGCCACCCAGCTAGTATTGG - Intronic
1049992547 9:1003553-1003575 CAGGGTCACACAGTTGCTGTGGG + Intergenic
1050305810 9:4305138-4305160 CACTGTCACCCAACTCATGTGGG + Intronic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1056786730 9:89597887-89597909 CAAGGTCACACAGCCAATGGTGG - Intergenic
1057022363 9:91709423-91709445 CAGGGTCTCCCAGCCTCTGTGGG + Intronic
1057182099 9:93035769-93035791 AAGGGTCACCCAGCAAGTTTTGG + Exonic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1187698461 X:21942730-21942752 TAGGGTCACCCAGCTAGTAAGGG + Intronic
1189862465 X:45287937-45287959 CAAGGTCACAGAGCTAGTGTTGG + Intergenic
1190623632 X:52314156-52314178 CAGGGTCAGACAGCTAGTATGGG - Intergenic
1192784546 X:74323540-74323562 CAGTGTCACCCAGCTACCGAGGG - Intergenic
1192804089 X:74494779-74494801 CAGTGTCACCCAGCTACTGAGGG + Intronic
1195919439 X:109968057-109968079 CAGGGCCACCCAGATGATCTAGG - Intergenic
1197461967 X:126754095-126754117 CAGTGTCATCCATATAATGTGGG + Intergenic
1198081485 X:133244240-133244262 CAGGGTCTAACAGCTAATGAGGG - Intergenic
1198604866 X:138325937-138325959 CAAGGTCACTCAGCAAGTGTAGG - Intergenic
1201511701 Y:14771069-14771091 CAGGTACACCAAGCAAATGTAGG - Intronic
1202576368 Y:26330800-26330822 CAAGGTCACACAGCTAGTGAGGG - Intergenic