ID: 949477403

View in Genome Browser
Species Human (GRCh38)
Location 3:4461718-4461740
Sequence TGATCCACTCAGAGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949477403 Original CRISPR TGATCCACTCAGAGTGATCC AGG (reversed) Intronic
901784942 1:11618353-11618375 TGAGCCAATCAGTGTGATCAGGG - Intergenic
908356792 1:63330185-63330207 AAATCCCCTCAGAGTGAACCTGG + Intergenic
909519883 1:76555505-76555527 TGATCCAAACAAAGTGAACCTGG + Intronic
911732362 1:101304399-101304421 TGCTCCATTCATAGTGATGCAGG - Intergenic
913344966 1:117799545-117799567 TGAACCCCTCAAAGTCATCCAGG + Intergenic
916191466 1:162182867-162182889 TGAACCCCTCAAAGTCATCCTGG + Intronic
922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG + Intergenic
923439895 1:234007346-234007368 TGCTCCCCTCAGAGAGCTCCAGG - Intronic
924473210 1:244361613-244361635 TGATCCAATCAGGGTAATGCGGG - Intronic
1063080242 10:2760996-2761018 ACAACCAATCAGAGTGATCCTGG + Intergenic
1068658099 10:59594847-59594869 TGATCCACTCAGGGTGTTTGGGG - Intergenic
1069133968 10:64741116-64741138 TTAGCCACTCAGAGTGAATCTGG + Intergenic
1074889158 10:117720855-117720877 TGATGCACTCACAGTGACCAGGG - Intergenic
1077341216 11:2027211-2027233 AGACCCACACAGGGTGATCCTGG + Intergenic
1081997925 11:47376846-47376868 GGAGACACTCAGAGTGACCCTGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1087500390 11:98944533-98944555 TGCTCCACTCTGCGTGATTCTGG + Intergenic
1202824201 11_KI270721v1_random:82400-82422 AGACCCACACAGGGTGATCCTGG + Intergenic
1094440013 12:30464802-30464824 TGAACCCCTCAAAGTCATCCAGG + Intergenic
1099604712 12:84788775-84788797 TGTTGCACTCAAAGAGATCCTGG + Intergenic
1101106051 12:101441385-101441407 TGATCAAATCAGAGTGATTGGGG + Intergenic
1106456478 13:29931830-29931852 TGAACCCCTCAAAGTCATCCAGG + Intergenic
1106955828 13:34938022-34938044 TGATTCAAGCAGAGTGATACTGG + Intergenic
1108492470 13:50994906-50994928 TTTTCTACTCAGTGTGATCCTGG + Intergenic
1108773941 13:53740148-53740170 TTATCCCCTCACAGTGATGCAGG - Intergenic
1109325289 13:60859857-60859879 TGAGCTCCTCAGAGTGAACCAGG + Intergenic
1109469843 13:62790665-62790687 TGATCCACTCAGAGTGGGGAGGG + Intergenic
1113894386 13:113754517-113754539 TGCTCCACTCAGGGTGAGCTAGG - Intergenic
1116516195 14:45809091-45809113 TGATCAGCTCTTAGTGATCCAGG - Intergenic
1116687908 14:48065903-48065925 TGAACCTCTCAAAGTCATCCAGG + Intergenic
1117648185 14:57874609-57874631 TGATCCACTGAGAGTGAGAAGGG - Intronic
1118035350 14:61860407-61860429 TGATCAACTCAGAGTGAATAAGG + Intergenic
1119685489 14:76627719-76627741 TGGTCCAATCAGACTGATCGAGG - Intergenic
1121489394 14:94347039-94347061 TGATTAACTCAGAGGGAGCCGGG - Intergenic
1122285210 14:100647380-100647402 TGATCCACTCACAGCAATGCAGG - Intergenic
1125870512 15:43096857-43096879 TGAACCCCTCAAAGTCATCCAGG + Intronic
1127518741 15:59722136-59722158 TGATGCAGTCAGAGTGACACAGG - Intergenic
1128513271 15:68326668-68326690 TGATCCGCTCACAGAGCTCCTGG + Exonic
1132959611 16:2614534-2614556 TGTTCCATTCTGAGTGATCGTGG + Intergenic
1132972672 16:2696509-2696531 TGTTCCATTCTGAGTGATCGTGG + Intronic
1133225544 16:4338739-4338761 TGTGCCACTCAGAGGGACCCTGG + Exonic
1134433934 16:14237613-14237635 TGATCCAGTGGGAGTGATCCAGG + Intronic
1137723943 16:50644637-50644659 TGAGCCACTCAGAGTCACCCTGG - Intergenic
1139018371 16:62717825-62717847 TGGTCCACTGAGAGTGATCAGGG + Intergenic
1144334987 17:14260639-14260661 TGTCCCACTCAAAGTGAGCCAGG + Intergenic
1144885575 17:18456763-18456785 TGAACCCCTCAAAGTCATCCAGG + Intergenic
1145146640 17:20487609-20487631 TGAACCCCTCAAAGTCATCCAGG - Intergenic
1148338283 17:46856338-46856360 GCATCCACTGAGAGTGAGCCTGG - Intronic
1156379417 18:36544299-36544321 TGGACCACTCAGAGTGGTCAAGG + Intronic
1156924490 18:42559211-42559233 TAAACCACTCAGACTGGTCCTGG - Intergenic
1157483307 18:48069742-48069764 TGCTCCACTCAGAGTGTAGCGGG - Intronic
1163797576 19:19346252-19346274 TGCTGCAGTCAGAGTGAGCCAGG - Intronic
1166605754 19:44141502-44141524 TGACCCACGCAGGGGGATCCGGG + Intergenic
1167224490 19:48228533-48228555 TCATCCACACAGAGAGATCTGGG + Intronic
927938927 2:27091635-27091657 TGATCCCCTCACAGTGTTACTGG - Intronic
928238517 2:29566129-29566151 TGATCCAGGCAGGGTGACCCTGG - Intronic
933750902 2:85601777-85601799 TGAGACACCCAGAGTGACCCTGG + Intronic
933907155 2:86906211-86906233 TGATCCCCTCAGAGTGGCCAGGG - Intergenic
933908401 2:86915873-86915895 TGATCCCCTCAGAGTGGCCAGGG - Intronic
934024322 2:87987507-87987529 TGATCCCCTCAGAGTGGCCAGGG + Intergenic
936364962 2:111845202-111845224 TGATCCCCTCAGAGTGGCCAGGG + Intronic
937998003 2:127709603-127709625 TGCTGCACTCAGACTGTTCCTGG + Intronic
940083281 2:149828995-149829017 TGAGCCCTTCAGAGAGATCCAGG + Intergenic
941288317 2:163643147-163643169 TGATCAAGTCAGGGTGATGCTGG + Intronic
941702006 2:168613626-168613648 TGATACTCACAGGGTGATCCTGG - Intronic
941962406 2:171266645-171266667 TGATCCCCTCAGACTCATTCAGG + Intergenic
943663387 2:190583379-190583401 TTAGCCACTCAGAGTCACCCTGG - Intergenic
947929188 2:233949144-233949166 TGAGGCACACAGAGGGATCCCGG + Intronic
1169555090 20:6741025-6741047 TGAAACACTTAGAGTTATCCAGG + Intergenic
1170146356 20:13179666-13179688 TGACCCATGCAGAGTGAACCTGG + Intergenic
1170581783 20:17704853-17704875 GGATCCTGTCAGAGCGATCCTGG - Intronic
1170668039 20:18403744-18403766 GGATCCATTCAAAGTCATCCTGG - Intronic
1171141930 20:22750876-22750898 TGGTCCACTCATAGTTCTCCAGG - Intergenic
1171488506 20:25500447-25500469 TGATGATCTCAGAGTGAGCCCGG - Intronic
1175440292 20:58985891-58985913 ACACCCACTCAGTGTGATCCTGG + Intronic
1175635577 20:60580075-60580097 TGATCCACTCAGCCTGAACCAGG + Intergenic
1175649850 20:60710365-60710387 TGAACCCCTCAAAGTCATCCAGG - Intergenic
1175728531 20:61335881-61335903 TGATCCAATCAGAATCATCCAGG + Intronic
1180069252 21:45427907-45427929 TGACCCAGTCAGACTCATCCAGG - Intronic
1182182537 22:28364652-28364674 TGAGCCCCTCAAAGTCATCCAGG - Intronic
1182514107 22:30843175-30843197 TGAACCCCTCAAAGTCATCCTGG + Intronic
1182916657 22:34039355-34039377 TCATCCACTGAGAGTGAGCAGGG - Intergenic
1185250809 22:49800708-49800730 TCATCCACTCAGAAGGATCAAGG + Intronic
949477403 3:4461718-4461740 TGATCCACTCAGAGTGATCCAGG - Intronic
954241969 3:49300830-49300852 TGATACACTAAGAGTAGTCCTGG - Intronic
958627525 3:96645485-96645507 TTTTCCACTCAGAGTCATGCAGG + Intergenic
959454443 3:106541422-106541444 TGATCCACTCAGAGTGGGGTGGG - Intergenic
960765288 3:121121639-121121661 AGATCCACTAAGACTCATCCAGG + Exonic
961093496 3:124135800-124135822 TGCTCAACTCAGAGTCAACCAGG + Intronic
963195327 3:142521632-142521654 TGAGCCTCTCAGAGTTATCCAGG - Intronic
968377724 4:57452-57474 TGATGCCCCCATAGTGATCCAGG - Intronic
972249197 4:37281294-37281316 TGAACCACGCAAAGTGTTCCTGG + Intronic
977079804 4:92510764-92510786 TGATCAATTCAGGGTAATCCGGG - Intronic
977572917 4:98648417-98648439 TGACACACGCAGAGTGGTCCAGG + Intronic
978071216 4:104472728-104472750 TGATCCACTCAAAATGATGTAGG - Intronic
982300545 4:153874348-153874370 TGAACCCCTCAAAGTCATCCAGG - Intergenic
984385963 4:179058499-179058521 TGAGCCAAAAAGAGTGATCCTGG - Intergenic
984616498 4:181904391-181904413 TGATCAAATCAGAGTGATTGGGG - Intergenic
984761116 4:183363823-183363845 TGATCCACTCTGGGAGAACCTGG + Intergenic
985320448 4:188704812-188704834 TAATCCAGGCAGAGTGATTCTGG - Intergenic
986622380 5:9689075-9689097 TCCTCCATTGAGAGTGATCCTGG - Intronic
988641950 5:33049952-33049974 TGACCCACTCCCTGTGATCCAGG + Intergenic
990267427 5:54092568-54092590 AGAACCACTCAAGGTGATCCTGG + Intronic
991042018 5:62185930-62185952 TGAACCACTGAGAGTCATGCTGG - Intergenic
997001925 5:129771698-129771720 TGATGCACACTCAGTGATCCCGG - Intergenic
997310287 5:132874054-132874076 TGATACACTCAGAATCATCCCGG - Exonic
1000549757 5:162646402-162646424 TGAACCCCTCATAGTCATCCAGG + Intergenic
1003403935 6:5812771-5812793 TGAGCCTCTCAAAGTCATCCGGG + Intergenic
1003705123 6:8519034-8519056 TGATCAAGTGAGGGTGATCCTGG + Intergenic
1008131217 6:47721594-47721616 GGATCCACGCAGAGTGATGGAGG - Exonic
1008151291 6:47955059-47955081 TGCTCCACTCAGAGTCAGCTGGG - Intronic
1009380101 6:63017015-63017037 TGAACCTCTCAAAGTCATCCAGG - Intergenic
1013634654 6:112017564-112017586 TGAGCCAATGAGAGTGAGCCTGG - Intergenic
1014262632 6:119236958-119236980 TGAACCCCTCAAAGTCATCCAGG - Intronic
1014775070 6:125499284-125499306 TGAGCCCCTCAAAGTCATCCAGG + Intergenic
1018224310 6:161613197-161613219 TGAAGCCCTCAGAGTCATCCAGG - Intronic
1024294333 7:47830709-47830731 TGAACCACACTGAGTGACCCTGG + Intronic
1025798925 7:64765903-64765925 TGATGCCCCCAGAGTGATCCAGG - Intergenic
1025899557 7:65732756-65732778 TGAGCAACTTAGAGTGAGCCTGG - Intergenic
1029798260 7:102918530-102918552 TGATCCACTCTGTGTGACCCAGG - Intronic
1032757196 7:134902404-134902426 TGAAACATTCAGTGTGATCCAGG + Intronic
1035762778 8:2081506-2081528 ACATCCACTCAGCGTGATCCGGG - Intronic
1041563636 8:59249370-59249392 TGATCAACTCAGAGTATTCAGGG + Intergenic
1043485513 8:80695292-80695314 TGCCCCACTCTGGGTGATCCTGG - Intronic
1045132860 8:99176461-99176483 GGGTCCACACAGAGTGATTCTGG + Intronic
1047914848 8:129572023-129572045 TGAGCCTCTCAGAGTGTTCTGGG + Intergenic
1052334903 9:27309168-27309190 TGCTCCACTCAGTGTGACCCTGG - Intergenic
1054945063 9:70786922-70786944 TGATCCACTCAGTGTTCTCGTGG + Intronic
1057482693 9:95458001-95458023 TAATACACTCACAATGATCCCGG + Exonic
1058638703 9:107062013-107062035 TGAACCCCTCAAAGTGATTCAGG + Intergenic
1059574175 9:115472723-115472745 TGAACCCCACAGAGAGATCCTGG + Intergenic
1203571513 Un_KI270744v1:136795-136817 TGATGCCCCCATAGTGATCCAGG + Intergenic
1189303580 X:39970133-39970155 CCATCCAATCAGAATGATCCAGG + Intergenic
1194421315 X:93676682-93676704 TTAACCACTCACACTGATCCTGG + Intronic
1196290105 X:113929930-113929952 TGCTCCACTGAGAGGAATCCAGG - Intergenic
1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG + Intergenic
1202621980 Y:56823397-56823419 TGATCCCCACAGAGTGTTCCCGG - Intergenic