ID: 949477737

View in Genome Browser
Species Human (GRCh38)
Location 3:4465174-4465196
Sequence CCAGTCTGTCCCTCTTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949477737_949477744 21 Left 949477737 3:4465174-4465196 CCTTAGAAAGAGGGACAGACTGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 949477744 3:4465218-4465240 TGTAATCCCAGCACGCTGGGAGG 0: 79
1: 9616
2: 306293
3: 267125
4: 207534
949477737_949477743 18 Left 949477737 3:4465174-4465196 CCTTAGAAAGAGGGACAGACTGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 949477743 3:4465215-4465237 GTTTGTAATCCCAGCACGCTGGG 0: 1
1: 18
2: 1106
3: 27223
4: 265321
949477737_949477742 17 Left 949477737 3:4465174-4465196 CCTTAGAAAGAGGGACAGACTGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 949477742 3:4465214-4465236 CGTTTGTAATCCCAGCACGCTGG 0: 1
1: 10
2: 522
3: 14963
4: 164704
949477737_949477741 -10 Left 949477737 3:4465174-4465196 CCTTAGAAAGAGGGACAGACTGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 949477741 3:4465187-4465209 GACAGACTGGCTTGGCGCGGTGG 0: 1
1: 1
2: 11
3: 120
4: 1036
949477737_949477746 27 Left 949477737 3:4465174-4465196 CCTTAGAAAGAGGGACAGACTGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 949477746 3:4465224-4465246 CCCAGCACGCTGGGAGGCCAAGG 0: 21
1: 2716
2: 88765
3: 210930
4: 235152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949477737 Original CRISPR CCAGTCTGTCCCTCTTTCTA AGG (reversed) Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900811617 1:4806202-4806224 CCAGTCTGTCACTCATTGTCTGG - Intergenic
901424275 1:9171496-9171518 CCAGTCTCTGCCTCTTTCAGTGG - Intergenic
903421953 1:23224488-23224510 CCAGTCGGTCCCTCTGTTTGGGG + Intergenic
903507347 1:23847059-23847081 CGAGTCTGTCACTGTTACTAGGG + Intronic
904356554 1:29943987-29944009 AAAGTTTGTCCCTCTTTTTAGGG + Intergenic
904732012 1:32600469-32600491 CCTGTATCTCTCTCTTTCTATGG + Exonic
905039533 1:34944105-34944127 CCATTCTCTCCCTCTTTTTTGGG - Intergenic
905278561 1:36834638-36834660 CCAGCCTGTGCCTATTTCTTAGG + Intronic
906672422 1:47666047-47666069 CCAGACACTCCCTCTTCCTATGG + Intergenic
908057628 1:60306830-60306852 CCCTTATTTCCCTCTTTCTAAGG - Intergenic
909335953 1:74474281-74474303 CCAGTCTGACCTGGTTTCTATGG + Intronic
910737606 1:90478088-90478110 CCACTCTGTCCCTCTGTTTCGGG + Intergenic
910921711 1:92355572-92355594 CTAGTCAGTCACTCTTTCTATGG + Intronic
910983400 1:92980922-92980944 CCTGTCTGTCTCTCTCTCTTAGG + Intergenic
911171063 1:94771625-94771647 CCGGTCTGTCCCCATCTCTATGG + Intergenic
912999925 1:114569835-114569857 CCCGTCTCTGCCTCTTTATAAGG - Intronic
915625593 1:157112178-157112200 CCAGTTCTTCCTTCTTTCTAGGG + Intergenic
922975418 1:229779768-229779790 TCAGTCTGTCCCCACTTCTAAGG + Intergenic
922982767 1:229842063-229842085 CCAGTCTGTCCCTGGATCTAAGG - Intergenic
923053292 1:230403864-230403886 CCAGTAGCTCCCTCTTTCTGGGG - Intronic
923303733 1:232668686-232668708 CCATTCTGTTCCTATTTCTCTGG - Intergenic
924136079 1:240968256-240968278 CCAGACACTCCCTCTTCCTACGG + Intronic
924937256 1:248782623-248782645 CCACTCTGACTCTCTTTCTTGGG - Intergenic
1063962620 10:11319394-11319416 CCCCTCTGTCCCTGTTACTATGG - Intronic
1064536287 10:16360967-16360989 CAAATCTCTCCCTCCTTCTAAGG - Intergenic
1064939466 10:20716815-20716837 CCAGTGTCTCCTTTTTTCTAGGG + Intergenic
1065075816 10:22078645-22078667 CCAGTCTCTTCTTGTTTCTAGGG + Intergenic
1066028033 10:31384779-31384801 CTAGTCAGTTCCTCTGTCTAGGG + Intronic
1068544035 10:58326851-58326873 CAAATCTGCCCCTCTTTCTCTGG + Intergenic
1068583441 10:58768956-58768978 GCAGTATGTCCTTTTTTCTAAGG - Intronic
1069434691 10:68370309-68370331 CCAGTCTATCCCTGGATCTAAGG + Intronic
1069659022 10:70111366-70111388 CCAGGCTGTCCCTTTGGCTAGGG + Intronic
1071956020 10:90760177-90760199 ACAGGCTTTCCCTCTTTTTATGG - Intronic
1072262852 10:93697713-93697735 CCAGTCTGTCCCTGGATCTAAGG - Intronic
1074160488 10:110832906-110832928 CCAGTCTGACCCTCCTGCTCTGG - Intronic
1077601888 11:3580343-3580365 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1078713711 11:13819268-13819290 CAAGTCTCTCCCTCTCACTAGGG - Intergenic
1079325622 11:19488909-19488931 CCTGTCTGTCCTGCTTTCTTTGG + Intronic
1079823700 11:25163762-25163784 CCAGTCTGTCTTTCAGTCTAAGG - Intergenic
1080100566 11:28454973-28454995 CCAGTCTCTGCCTCGTTTTAAGG - Intergenic
1081737970 11:45417601-45417623 CCAGTCTCTACCTCTTCCTGTGG - Intergenic
1083076596 11:60045957-60045979 CTGGTCTGTCCCTGTTTCTCTGG + Intronic
1084257802 11:67954889-67954911 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1084407095 11:68980375-68980397 CCAGCCTGACCCTCTTTGTCTGG - Exonic
1084814962 11:71640348-71640370 CCTCTCTGTCCCTCTCTGTAGGG - Intergenic
1090212913 11:124935595-124935617 CCAGTCTGGCATTCTTTCCAAGG - Intronic
1090883426 11:130854797-130854819 CCAGTCTCTGTCTCTTTCTTCGG + Intergenic
1091200689 11:133778270-133778292 CCAGTCTGTCGATCTCTCCACGG - Intergenic
1091880263 12:3971458-3971480 TCAGTCTGTCATTCTTTCAAAGG + Intergenic
1092244202 12:6854138-6854160 CCCGTCTGTCCCTGTTTTCACGG + Intronic
1092269306 12:7010249-7010271 CCTGTCTGTCCCTGAATCTAAGG - Intronic
1092428033 12:8389686-8389708 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1092893230 12:12989063-12989085 CCAGTCTGTCCCTCACTTGAAGG - Intronic
1093392297 12:18637277-18637299 CCAGTCTCTCCTTCATTCAAGGG + Intronic
1094173297 12:27517304-27517326 CCAGTATGTCCGTCTTTTAAAGG - Intergenic
1095233444 12:39769577-39769599 CAAGTCTGTCACCCTTTCTGAGG + Intronic
1096220000 12:49823198-49823220 CCAGACTGTCCCCCTTCCCAGGG - Intronic
1096364884 12:51020592-51020614 CCAGTCTCTCTCTCTCTCTCTGG + Intronic
1096815175 12:54197393-54197415 CCAGTCACTCCCTCTGTCTCAGG + Intergenic
1097323171 12:58247422-58247444 CCATTCATTCCCACTTTCTAGGG + Intergenic
1097488655 12:60236828-60236850 CCAGTCTGTGCCTCTTAATTGGG - Intergenic
1097707438 12:62882540-62882562 CCACTCTGCCCCTGTTTCCAAGG - Intronic
1098874864 12:75856448-75856470 ACAGTCTGTCTCTCTTTTTCTGG - Intergenic
1099581047 12:84447216-84447238 CCAGTCGGTCCCTCTCTTTGGGG + Intergenic
1101090547 12:101280450-101280472 CCAGTGTCTCCCTCTTTCGCCGG - Intronic
1101190004 12:102322840-102322862 CAACTCTATCACTCTTTCTATGG + Intergenic
1101215823 12:102581192-102581214 CCCATCTGTCCCTCATTTTATGG - Intergenic
1102454099 12:113060927-113060949 GGAGTCTGTCCCTGCTTCTAAGG - Intronic
1103450893 12:121028180-121028202 CCATTTTTTCCCTCTATCTAAGG - Intronic
1104536074 12:129619500-129619522 CCAAGCTGTCCCTATTCCTAAGG + Intronic
1106719795 13:32426581-32426603 CCAGGCTGTCCCTCCTCCTAAGG + Intronic
1108696674 13:52907893-52907915 ACAGTCTGTCCCCCTACCTAAGG - Intergenic
1109011864 13:56959367-56959389 TCAGGATGTCCCTCATTCTATGG + Intergenic
1109293922 13:60506886-60506908 CCAGTCTGTGCCTTTTAATAGGG - Intronic
1112220449 13:97484427-97484449 CAAGACTGTCCCTCTGTCCAGGG - Intergenic
1112758995 13:102672099-102672121 CAAGTCTGTCCCTCAGACTATGG + Intronic
1114360749 14:21969480-21969502 CCAGTCTGTGACTCTTACTTGGG - Intergenic
1116164596 14:41318465-41318487 GCAGTCTCTCCCTCTTCCCAGGG + Intergenic
1117983053 14:61360879-61360901 CCAGTCTCTCCCACCATCTAGGG - Intronic
1120449828 14:84653477-84653499 CCAGTCTGTGCCTTTTTATTGGG + Intergenic
1121020747 14:90578668-90578690 TCATTCTGGCCCTTTTTCTATGG - Intronic
1121842456 14:97145643-97145665 CCCCTCTGCCCCTCTATCTATGG - Intergenic
1122776782 14:104120532-104120554 CCAGCCTGTCTCTCTTCCTGAGG - Intergenic
1123504477 15:20926154-20926176 CCTGTCTGTCCCTGGATCTAAGG + Intergenic
1123561723 15:21499855-21499877 CCTGTCTGTCCCTGGATCTAAGG + Intergenic
1123597967 15:21937136-21937158 CCTGTCTGTCCCTGGATCTAAGG + Intergenic
1124239030 15:28014865-28014887 CCAGGCTGTCCCTCTTTTGATGG - Exonic
1125550156 15:40538983-40539005 CCAGCCTGTCCCTCTTCCCATGG + Intronic
1126982561 15:54260993-54261015 CCAGTTTGCCCCTCTGTCTAAGG + Intronic
1128761098 15:70216461-70216483 CCCCTCTGCCCCTCTTCCTAAGG + Intergenic
1128762948 15:70230331-70230353 CCAGTCTTTGTCTCTTTCTGGGG - Intergenic
1129485100 15:75863131-75863153 CCTATCTGTCCCACTTTCTGGGG + Intronic
1202970068 15_KI270727v1_random:226980-227002 CCTGTCTGTCCCTGGATCTAAGG + Intergenic
1133370205 16:5240681-5240703 CCTCTCTGTCCCTCTCTGTAGGG - Intergenic
1136282798 16:29223698-29223720 CCAGCCTGTGCCTTTTTCTATGG - Intergenic
1137770541 16:51012779-51012801 CCAGGCTGTCTCTCTTTCCCTGG + Intergenic
1139212922 16:65098401-65098423 CCAGACTGACCCTCCTTCTCTGG + Intronic
1139289046 16:65840684-65840706 CAAGTCTCACCCTCTTTCTAGGG - Intergenic
1141392516 16:83676559-83676581 CCATTCTATCCTTCTTTCTATGG - Intronic
1142087176 16:88189621-88189643 CCAGCCTGTGCCTTTTTCTGTGG - Intergenic
1144323773 17:14157168-14157190 CCAGCCTGTACCTGTTTTTAAGG - Intronic
1146042974 17:29474546-29474568 CCAGTCTGTCTCCCTTTCCTTGG - Intronic
1151625327 17:75272233-75272255 CCAGTGGGTGCCTCTTTCCAAGG + Intergenic
1151947577 17:77327960-77327982 CCAGTGTGTCCCTGTATCCAGGG + Intronic
1151947646 17:77328163-77328185 CCAGTGTGTCCCTGTATCCAGGG + Intronic
1152121165 17:78419524-78419546 CCTGTCTGTTCCTCTTCCTCAGG + Exonic
1154356157 18:13624505-13624527 CCATTCTCTCCATCTTCCTAGGG + Intronic
1155895529 18:31321057-31321079 CCATTTTCCCCCTCTTTCTATGG + Intronic
1156012698 18:32513010-32513032 GCAGTCTGTTCCTCCTTCTCAGG + Intergenic
1159616744 18:70589540-70589562 TCAGTCTCTCCCTCTTTTTTTGG + Intergenic
1160007689 18:75080102-75080124 CTTGTCTGTCCCTCTGCCTATGG + Intergenic
1161024915 19:2032311-2032333 CCAGTCTGCCCCTCTGTGAAGGG - Intronic
1161403015 19:4077249-4077271 CCAGTCTCTACCTCTCTCTGTGG + Intergenic
1162818684 19:13210313-13210335 CCACTCTGCACCTCTTTCTGGGG - Intronic
1164769795 19:30799733-30799755 CCAGTCTCTACCTCTCTCTAAGG - Intergenic
1166834469 19:45658790-45658812 CCTCTCTGTCCCTCTTTCTCTGG + Intergenic
1166885048 19:45955332-45955354 CCTGTCTGTCTCTCCTTCTCAGG - Intronic
1167552310 19:50169642-50169664 TCTCTCTGTCCCTCTTTCTCTGG + Intergenic
1168707521 19:58478334-58478356 CCAGTCTGTCCCTCTGCCCCAGG - Intronic
927188969 2:20503260-20503282 CCTGCCTGTCCCTCTTTTCATGG + Intergenic
927666733 2:25038078-25038100 CCAGTCTGTCCCCTTTGGTATGG - Intergenic
928026084 2:27740051-27740073 CCAGTCTCTCCCTCTCTCAAAGG - Intergenic
929510805 2:42564543-42564565 CCAGTCTGTCTCATATTCTAAGG - Intronic
929521304 2:42654185-42654207 CCATTCTGTCCCTGGTTCAAAGG - Intronic
930237334 2:48900620-48900642 CCAGCCTCTCCCTCCTTCCATGG - Intergenic
930683995 2:54288231-54288253 ACAGTCTGTTTCTGTTTCTAGGG - Intronic
930933171 2:56914460-56914482 CCAGTCTGTGCCTTTTAATAAGG + Intergenic
931244822 2:60483482-60483504 CCAGTCTGTTTCTCTGTCCAAGG + Intronic
931288447 2:60851839-60851861 CCAGTCTGTCCCTGGATCTAAGG + Intergenic
933118367 2:78502362-78502384 CCACTCTGTGCCTTTTCCTAGGG - Intergenic
933265929 2:80180219-80180241 CCAGTCTCTCCTTCATTCAAGGG + Intronic
933906316 2:86897230-86897252 ACAGTCTGACCCTCTTGTTAGGG + Intergenic
935776230 2:106474527-106474549 ACAGTCTGACCCTCTTGTTAGGG - Intergenic
936627212 2:114161282-114161304 CCATTCTGTGCATCTTTCAAAGG + Intergenic
937285494 2:120748384-120748406 CCAGTCTGGCCCTCTCTTTGAGG - Intronic
937701934 2:124872696-124872718 CCACATTTTCCCTCTTTCTAAGG - Intronic
938615803 2:132997036-132997058 CCAGCTTCTCCCTCTTACTAAGG + Intronic
940481840 2:154242185-154242207 CCAGTTTGTACCTCTTTCACTGG - Exonic
943350929 2:186795170-186795192 CCAGTCTGTGTCTTTTTCTTGGG - Intergenic
945791546 2:214311193-214311215 CCCCTCTCTCCCTCTCTCTAGGG + Intronic
945824042 2:214698554-214698576 CAAGTCTGTCTTTCTTTGTAAGG - Intergenic
947564715 2:231186350-231186372 CCAGTCTGTCCCTCCAGCTCAGG + Intergenic
948118372 2:235510835-235510857 TCAGTCTGCACCTCTTTCTGAGG - Intronic
948143829 2:235693498-235693520 CCAGCCTGTCCCTCTGTTCAGGG - Intronic
948470781 2:238176663-238176685 CCAGTCTCTCTCTCTCTCTCTGG - Intronic
1169577799 20:6985074-6985096 CCAGTCTGTGCCTTTTAATAGGG - Intergenic
1169808638 20:9585385-9585407 CCAGTCTAGGTCTCTTTCTATGG + Intronic
1170312311 20:15006202-15006224 CCAGGATTTCCCTCTTTTTAAGG - Intronic
1170397132 20:15938586-15938608 CCTGTCTGTCCCCTTTTCTCGGG + Intronic
1172301668 20:33854821-33854843 CCACTCTGTCCCCTTTTCTTTGG + Intergenic
1172788443 20:37486037-37486059 CCTGTCTTCCCCTCTTTCTCAGG - Intergenic
1173603681 20:44313914-44313936 GCAGTCTTTCCCTCCTTCTTGGG - Intergenic
1174891395 20:54399032-54399054 CCAGGCTGTACCTCTTTCAAGGG - Intergenic
1175501542 20:59454461-59454483 TCAGTCTCTCTCTCTTTTTAAGG + Intergenic
1175743174 20:61435184-61435206 GCAGTCAGTCCCTGTTACTACGG - Intronic
1176007856 20:62875908-62875930 TCAGTCTGTCCTTCATTCCAGGG - Intergenic
1177391333 21:20476895-20476917 CCAGTCTGTCTCTCTCTCTGTGG + Intergenic
1177567484 21:22843828-22843850 TCAGTCTGTACCCCTTTCTAAGG - Intergenic
1178260991 21:31099475-31099497 CCAGTCTTTCCCTCTGTGTGCGG + Intergenic
1178604095 21:34020231-34020253 CCAGTCTGCCCATCTGTCTTGGG + Intergenic
1180173774 21:46077696-46077718 CAAGTGTGTCCCTGCTTCTAGGG + Intergenic
1180749038 22:18111607-18111629 ACACTCAGTTCCTCTTTCTAGGG + Intronic
1183675620 22:39297434-39297456 CCAGTCTGGGGCTCTTTCCATGG - Intergenic
1183984681 22:41562912-41562934 CCAGTCTATTCCTCTCTCTAGGG + Intronic
1184716032 22:46282311-46282333 CTTGTCAGTCCCTCTTTCCAGGG + Intronic
949110075 3:249536-249558 CCAGTTTCTCACTCTTTCGAAGG - Intronic
949477737 3:4465174-4465196 CCAGTCTGTCCCTCTTTCTAAGG - Intronic
949630753 3:5923759-5923781 CCAGGCTGTCCCACAGTCTAAGG + Intergenic
950640374 3:14344664-14344686 CCAGTGTCTCCCCCTTTCTCAGG - Intergenic
952393142 3:32898135-32898157 CCACCCTGTCCCCCTTTCTCTGG + Intergenic
952688097 3:36172653-36172675 CCAGTAAGCCTCTCTTTCTAGGG + Intergenic
953298859 3:41751240-41751262 CCAATCTGTCCCTGTCTGTAAGG - Intronic
954465344 3:50651228-50651250 CCAGTCTGTGCTTCTTCCTGGGG + Intergenic
954932912 3:54299470-54299492 CCAGTCTTTTCCTTTTTCTCTGG + Intronic
955487574 3:59449953-59449975 TCAGTCTCTCCCTCTTACAAAGG - Intergenic
956398463 3:68850784-68850806 GCAGTCTGTCCATCTGTCAAAGG - Intronic
957072731 3:75579377-75579399 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
959708178 3:109358588-109358610 CCTCTCTGTCTCTCTTTCTTTGG - Intergenic
959801457 3:110500278-110500300 GCAGTCTATCCCTCTGACTAAGG + Intergenic
963444222 3:145382982-145383004 CCAGAATGTAACTCTTTCTAAGG + Intergenic
963652652 3:148002315-148002337 CTATTCTGTTCCTCTTTCTCTGG - Intergenic
964445295 3:156751715-156751737 CCAATCTCTGCCTCTTTCTCTGG + Intergenic
964763726 3:160158400-160158422 CCAGTCTCTCCCTGTCTCTCTGG + Intergenic
965439931 3:168699865-168699887 CAAGGCTGTCCCACTTACTATGG + Intergenic
966717479 3:183028070-183028092 ACAGGCTGACTCTCTTTCTAGGG + Intronic
966866001 3:184259641-184259663 CCAGCCTCAGCCTCTTTCTAAGG - Exonic
969125771 4:4946724-4946746 CCACTCTGTGCATCTTTCTTAGG + Intergenic
969796816 4:9533198-9533220 CCTTTCTGTCCCTCTCTGTAGGG - Intergenic
971474994 4:27064545-27064567 CCACACTGCCCCTTTTTCTAAGG + Intergenic
972700947 4:41492392-41492414 GGAGCCTCTCCCTCTTTCTACGG - Intronic
973773253 4:54225401-54225423 CCAGTCTGTCCCAGGCTCTAAGG + Intronic
974522689 4:63005096-63005118 TCATTCTGTGCCTCTCTCTATGG + Intergenic
975935756 4:79577964-79577986 CCAATCTGTCACTCTTTCTGTGG + Intergenic
976434840 4:85005215-85005237 TCAATCTGGCCCTTTTTCTAAGG + Intergenic
977482519 4:97595950-97595972 CCAGTCTGTGCCTTTTACTTGGG - Intronic
980153140 4:129073007-129073029 ACACTCTGCCCCTTTTTCTATGG + Intronic
980313103 4:131161211-131161233 CCAGTATGTTCATCTTGCTAGGG + Intergenic
981347305 4:143691061-143691083 CCAGTTTGTCCCTGGATCTAAGG + Intronic
982931903 4:161419128-161419150 TCAGTCTGTCCTTCTTTTAAGGG - Intronic
985973911 5:3399903-3399925 CCACTCTGTCCCCATTTCTCTGG - Intergenic
986206892 5:5633112-5633134 TCATTCTCTCTCTCTTTCTATGG - Intergenic
986307763 5:6528438-6528460 AAAGTCAGCCCCTCTTTCTAGGG + Intergenic
986385129 5:7225927-7225949 CGTGTCTGTCTCTCTTTCTCTGG + Intergenic
987266458 5:16261203-16261225 CTACTCAGGCCCTCTTTCTATGG - Intergenic
989748732 5:44864682-44864704 TCATTCTGTCCCTCCTTCTGGGG + Intergenic
993062687 5:83058593-83058615 CAAGCCTGTCACTCTTACTAGGG + Intronic
993616110 5:90114476-90114498 CAAATCTGTCCCTCCTTATAAGG + Intergenic
993829010 5:92729899-92729921 CCTGTCTATTCATCTTTCTATGG - Intergenic
994584486 5:101688856-101688878 CCAGCCTGTCTCTCATTCCATGG - Intergenic
998979149 5:147681739-147681761 CCAGTATGTCACTTTTCCTAAGG - Intronic
999492604 5:152066082-152066104 CCACTCTGTCCATCTCTCTCTGG + Intergenic
1001670994 5:173473872-173473894 CCAGTCTCCTCCTCTTTCAAGGG - Intergenic
1001698256 5:173688673-173688695 CCTGTCTGCCTCTCTTTCAAAGG + Intergenic
1001924979 5:175629553-175629575 CCACTCTGTCCCTCTTATTCTGG + Intergenic
1001955954 5:175848273-175848295 GCAGTCTGTCCCTCCTTTTTGGG - Intronic
1002445520 5:179287849-179287871 CCTGTCTGCCCCTGCTTCTAAGG - Intronic
1004473010 6:15945945-15945967 ACCTTCTGTCCCTCTTCCTATGG - Intergenic
1007578454 6:42940789-42940811 CCATTCTGTTCCACTCTCTATGG - Intergenic
1007828528 6:44620184-44620206 CCACTCTGTCCCTCTCTCCTTGG - Intergenic
1012810026 6:103945071-103945093 CCAGTTTGCCTCTTTTTCTAAGG + Intergenic
1014126293 6:117780314-117780336 CTAAACTGTCCCTTTTTCTAAGG - Intergenic
1015234295 6:130953216-130953238 CCATTCTGTCCCTTTCTTTATGG + Intronic
1015821214 6:137262594-137262616 CAATTTTGTCCCTCTTTTTAAGG - Intergenic
1016515082 6:144884240-144884262 CCAGTCTGTGATACTTTCTACGG + Intergenic
1016523002 6:144967698-144967720 GCATTCTTTCCCTCTTTTTAAGG - Intergenic
1016891130 6:149007777-149007799 CCAATCTGTCCCTACTCCTAAGG + Intronic
1017978826 6:159380737-159380759 CCAGGCTCTCTCTCTTTCTCTGG + Intergenic
1018709212 6:166485834-166485856 CCAGGCTGTCCCTCTGTCCAAGG + Intronic
1018766605 6:166938524-166938546 CCAGAGTTTCCGTCTTTCTAAGG + Intronic
1019161926 6:170074704-170074726 CCAGGCTGTCCCTCCTTCTCAGG - Intergenic
1020100362 7:5390851-5390873 CCATTCTGATCCTCTTTCTGGGG - Intronic
1020589157 7:10113097-10113119 TCAGTCAGTCCCTCTTCCTAAGG + Intergenic
1022170963 7:27830480-27830502 CCATTCAGTTCCTCATTCTAAGG - Intronic
1022519989 7:31000100-31000122 CCAGTCTGTCCTTCTGGTTATGG - Intergenic
1022818180 7:33933366-33933388 CCCGTGTGTCCCTCTTTCTACGG - Intronic
1023100228 7:36710349-36710371 AGAGTCTGCCCCTCTTCCTAGGG - Intronic
1023920536 7:44626083-44626105 CCAGTCCTTCCCTGTTTCCATGG + Intronic
1027704707 7:81514585-81514607 GCTGTCTATCCCTCTTTCCACGG + Intergenic
1028024821 7:85823881-85823903 TCAGTCTGTTGCACTTTCTATGG + Intergenic
1032478768 7:132229907-132229929 CCAGGCTGCCCCTCTTGCTGTGG - Intronic
1032839005 7:135699238-135699260 CCTGTTTTTCCCTCTTTCTACGG + Intronic
1035288689 7:157823116-157823138 CCATTCTGTCCATCTACCTATGG + Intronic
1035980866 8:4370269-4370291 CCAGTCTTTCCCAGTTTGTAAGG + Intronic
1036242711 8:7092897-7092919 CCTCTCTGTCCCTCTCTGTAGGG - Intergenic
1036258092 8:7221130-7221152 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1036359394 8:8066376-8066398 CCTCTCTGTCCCTCTCTGTAGGG - Intergenic
1036525192 8:9528497-9528519 CTTTTCTTTCCCTCTTTCTATGG + Intergenic
1036789220 8:11707417-11707439 CCAGTCTCCCCATCTTTCTTGGG + Intronic
1036830019 8:12014247-12014269 CCTCTCTGTCCCTCTCTGTAGGG + Intronic
1036891562 8:12600576-12600598 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1036899104 8:12658541-12658563 CCTCTCTGTCCCTCTCTGTAGGG + Intergenic
1038584680 8:28778104-28778126 CCAGCCTGCCCCTCCTTCCACGG - Intronic
1043176731 8:77030613-77030635 CCCATCTCTCCCACTTTCTAAGG - Intergenic
1044073962 8:87795316-87795338 CCAGTCTGTGCCTCTTAATTGGG - Intergenic
1048646078 8:136421360-136421382 CCAGGCTTTGCCTCTTTCAAAGG - Intergenic
1048735012 8:137489437-137489459 TCATTCTATTCCTCTTTCTAAGG - Intergenic
1050055266 9:1646333-1646355 CCTGCATGTCCCTGTTTCTATGG + Intergenic
1050384673 9:5075397-5075419 ACAGGCTGACCCTCTTGCTAAGG + Intronic
1052730244 9:32276773-32276795 CCAATCTGTCCTGCTTTCTCTGG + Intergenic
1054676323 9:67858920-67858942 CCAGACAGGCCCTCTTTCTCAGG + Intergenic
1057039053 9:91834151-91834173 CCAGGCTGTGCCTTTTTCTCTGG - Intronic
1057451957 9:95171797-95171819 CCAATCAGCCTCTCTTTCTAGGG - Intronic
1058699392 9:107588095-107588117 CCTGTCTGTCCCTATTTACAGGG - Intergenic
1060640548 9:125234887-125234909 CTAGTCTGTAACTCTTTCTGAGG - Exonic
1061117576 9:128624300-128624322 CCAGTGTGTGCCTCTCTCCATGG + Intronic
1185455748 X:309967-309989 CCAGTCTCTGCCTCTGTCTGTGG - Intronic
1185455809 X:310307-310329 CCAGTCTCTGCCTCTGTCTGTGG - Intronic
1185455867 X:310646-310668 CCAGTCTCTGCCTCTGTCTGTGG - Intronic
1186598920 X:11015328-11015350 CCAGTTTGTCCCTCATTGGAGGG - Intergenic
1189277788 X:39799279-39799301 CCAGTCTGTCTCCCTCTCCAAGG + Intergenic
1190068073 X:47256477-47256499 CCAGTCTGTCCCTGGATCTAAGG - Intergenic
1190506108 X:51127404-51127426 CCAGTCTGTGCCTCTTAATTGGG - Intergenic
1190773387 X:53533552-53533574 CCAGTATGTCCCCCTTTATCTGG + Intronic
1191887823 X:65907017-65907039 CCAGTATGTCCCATTTGCTAAGG - Intergenic
1192317277 X:70062806-70062828 CCATTCTTTCTCTCTTTCTGTGG - Exonic
1193663984 X:84293444-84293466 TCATTCTCTACCTCTTTCTATGG + Intergenic
1196253389 X:113487521-113487543 CCAGTCTTTCCCACTTTTTCAGG + Intergenic
1196342221 X:114608089-114608111 ACAGTCAGTCCCTCTTGCAAAGG + Intronic