ID: 949480974

View in Genome Browser
Species Human (GRCh38)
Location 3:4493540-4493562
Sequence GGAGAGGGGTTAGCAGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949480974_949480986 12 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480986 3:4493575-4493597 CCCAAACCGGCGTGGCTCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 92
949480974_949480979 -1 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480979 3:4493562-4493584 CTCGCCCTGCTCCCCCAAACCGG 0: 1
1: 1
2: 2
3: 28
4: 287
949480974_949480982 4 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480982 3:4493567-4493589 CCTGCTCCCCCAAACCGGCGTGG 0: 1
1: 0
2: 0
3: 13
4: 97
949480974_949480991 27 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480991 3:4493590-4493612 CTCCCCGGGCACCAAGGTAGCGG 0: 1
1: 0
2: 0
3: 11
4: 88
949480974_949480988 13 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480988 3:4493576-4493598 CCAAACCGGCGTGGCTCCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
949480974_949480990 21 Left 949480974 3:4493540-4493562 CCAGCGGCTGCTAACCCCTCTCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 949480990 3:4493584-4493606 GCGTGGCTCCCCGGGCACCAAGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949480974 Original CRISPR GGAGAGGGGTTAGCAGCCGC TGG (reversed) Exonic
900289176 1:1916630-1916652 GGAGTGGGGTGGGCAGCCTCGGG + Intronic
900931854 1:5742913-5742935 GGAGAGGGGTCCTCAGCGGCTGG - Intergenic
901650891 1:10742681-10742703 GGTGAGGAGTTAGAAGCCTCTGG + Intronic
903846085 1:26280560-26280582 AGAGAGGGATTATCAGCCACGGG - Intronic
904277753 1:29395323-29395345 GGAGAGGGGCCAGAAGCCACTGG - Intergenic
904486844 1:30830553-30830575 GGAGTGGGGTTAGCAGGTGTAGG + Intergenic
905688968 1:39928766-39928788 GGAGAGGGGACAGGAGCCACTGG + Intergenic
906367315 1:45221826-45221848 GGAGAGGGAGTAGCTGCCTCAGG + Intronic
907246561 1:53112930-53112952 GGAGAGGGGTGAGCTGGAGCAGG - Intronic
907247613 1:53117970-53117992 AGGGAGAGGTGAGCAGCCGCGGG + Intronic
907423869 1:54366159-54366181 AGAGGGGTGTTAGCAGCAGCTGG - Intronic
908939003 1:69409886-69409908 GCAGAGGGGTGAGCAGCTGCAGG - Intergenic
916477710 1:165185956-165185978 GGGGAGGGGTTTACAGCCCCAGG - Intergenic
916891454 1:169116021-169116043 GGAGAGGGCTGAGCAGGCACAGG + Intronic
918316651 1:183328191-183328213 GGAGAGGGATCAGATGCCGCAGG + Intronic
920339695 1:205268075-205268097 GGAGAGGTGTCAGCAGAGGCAGG + Intronic
922757591 1:228105209-228105231 GGAGAGGGGATAGCAGGGCCAGG + Intronic
923886133 1:238158533-238158555 GGAGGGGGGTTACCAGAGGCTGG - Intergenic
1063977605 10:11429782-11429804 GGAGAGGGGGAAGCTGCCGTGGG + Intergenic
1064368674 10:14731028-14731050 GGAGAGGGCTTAGCAGGCACAGG + Intronic
1064504042 10:16010045-16010067 GGTGAGGGGATGGCAGCAGCTGG - Intergenic
1069158093 10:65054059-65054081 GGAGCGCGGGTAGCAGCCGGCGG - Intergenic
1073583000 10:104684577-104684599 GAAGAGGGCTGAGCAGCAGCAGG - Intronic
1076126550 10:127978623-127978645 GGAGTGGGTTCAGCAGCCCCGGG + Intronic
1076714167 10:132354833-132354855 GGAGAGGGGGTACCAACCACAGG + Intronic
1078660177 11:13279073-13279095 GGAGAGGGGTCAGGAGGTGCGGG - Intronic
1081670888 11:44941915-44941937 GGAGAGGGGTCAGCAGGCAGAGG - Intronic
1086805633 11:91238947-91238969 GGAGAGGAGTTTGAAGCCTCGGG - Intergenic
1088823350 11:113474866-113474888 GGAGAGGGGATAGCAGCCGCGGG + Intronic
1090917082 11:131174930-131174952 GGAAGGAGGTTAGCAGCAGCTGG - Intergenic
1096615973 12:52833879-52833901 GGAGGGGGGTCAGCAGGCTCTGG + Exonic
1096882587 12:54684870-54684892 GGAGAGGGGCTGGCAGCCTGAGG + Intergenic
1097107603 12:56634739-56634761 GGAGAGGCGTGAGAAGCCTCCGG + Intronic
1104410396 12:128553004-128553026 AGAAAGGGGTTAGCAGGTGCAGG + Intronic
1104774366 12:131383121-131383143 GGAGGTGGCTCAGCAGCCGCAGG - Intergenic
1105605176 13:21920953-21920975 GGAGTGGGTTTGGCAGCCCCGGG - Intergenic
1105705679 13:22966235-22966257 GGAGTGGGGTTACCAGCCAGCGG + Intergenic
1105846379 13:24297728-24297750 GGAGATGGGTGAGCAGCCCTTGG + Exonic
1105858582 13:24391220-24391242 GGAGTGGGGTTACCAGCCAGCGG + Intergenic
1105892966 13:24695231-24695253 GGAGACCGGTGAGCAGCCCCTGG + Intronic
1106077756 13:26475767-26475789 GGAGAGGGTTCAGGAGCTGCAGG + Intergenic
1106356256 13:28986312-28986334 GGAGAGGTGTTAACAGACACAGG + Intronic
1107722832 13:43267114-43267136 GGAGAGGGGTGGGCTGCAGCGGG - Intronic
1109124737 13:58504587-58504609 GGAGAGGCGTGAGCAGCAACCGG - Intergenic
1112484914 13:99811314-99811336 GGAGAGGGGCTGGAAGCCACAGG + Intronic
1113727413 13:112615526-112615548 GGAGTGGGGTTAGCACCCCTGGG - Intergenic
1115471449 14:33772661-33772683 GGAGGGGTGTTAACAGTCGCTGG - Intronic
1119135528 14:72215156-72215178 GAAGAGTGGATAGCAGCCCCTGG - Intronic
1121007611 14:90500362-90500384 GGAGAGGGGCTGGCAGGAGCTGG - Intergenic
1122587325 14:102817994-102818016 GGAGAGGGGTGGGGAGCTGCGGG + Intronic
1123992904 15:25696562-25696584 TGAGAGGGAGTAGCAGCCGATGG + Intronic
1124613405 15:31224309-31224331 GGAGAGGGCTGAGGAGCCGTGGG + Intergenic
1130224437 15:82046370-82046392 AGAGAGGCGTTAGCGGCGGCGGG - Intergenic
1131058237 15:89389210-89389232 GGTGTGGTGTGAGCAGCCGCTGG + Intergenic
1132499636 16:279800-279822 GGACAGGGGTGAGCAGGCCCTGG - Intronic
1133801639 16:9090470-9090492 GGAGGGGGGCGCGCAGCCGCAGG + Intergenic
1135555616 16:23433876-23433898 GGAGAGGGGATCACATCCGCAGG - Intronic
1138598124 16:58040249-58040271 TGAGTGGGTTCAGCAGCCGCGGG + Intronic
1143586424 17:7852909-7852931 GCAGAGGGGTGGGCAGCCCCAGG - Intronic
1144344725 17:14339540-14339562 GGAGATGGGTCACCAGCTGCAGG - Intronic
1144606154 17:16667087-16667109 GGAGCGCGGGTAGCAGCCGGCGG + Intergenic
1145298436 17:21613051-21613073 GGAGAGCGGTCAGCAGCAGGAGG + Intergenic
1145351813 17:22090304-22090326 GGAGAGCGGTCAGCAGCAGCAGG - Intergenic
1146340832 17:32018572-32018594 GGAGAGGGGTTAGTCTCCCCCGG + Intronic
1149992004 17:61388511-61388533 GGAGAGGTGTCAGGAGGCGCAGG - Intronic
1150484415 17:65533783-65533805 GGAGGGGGCTCAGCAGGCGCTGG - Intronic
1150920464 17:69477057-69477079 GGAGAGGACTCAGCAGCAGCAGG - Intronic
1151750096 17:76032244-76032266 GCAGAGGGTTGAGCAGCCCCAGG - Intergenic
1152921845 17:83069817-83069839 GAAGAGGGATGAGAAGCCGCTGG - Intergenic
1153020142 18:621458-621480 GGAGAAGGGTTTGCAGCTGCTGG - Intronic
1153959402 18:10127813-10127835 TGTGAGGGGTCAGCAGCTGCTGG - Intergenic
1158864092 18:61620368-61620390 GGAGTGGGGTTTGCAGCTGAAGG - Intergenic
1162127378 19:8506692-8506714 GGAGAGGGGTTAGGGGCCTGGGG + Intergenic
1162949043 19:14059785-14059807 GGAGGGGGGTTAGCAGGTGGAGG - Intergenic
1163282601 19:16326368-16326390 GGAGCAGGTTTAGGAGCCGCTGG + Intronic
1164889811 19:31813739-31813761 GGAGAGTGGTTAGAAGACGAAGG - Intergenic
1165086368 19:33350932-33350954 AGAGAGGGGTGAGCAGCTGAAGG + Intergenic
1166387150 19:42388816-42388838 GGAGTGGGGTTAGCAAGCGGTGG + Intronic
928103246 2:28451853-28451875 GGAGAGGAGTCAGCAGGGGCTGG + Intergenic
928154056 2:28859584-28859606 GGAGAGGGGGTGTCAGCTGCTGG - Intronic
930198027 2:48528939-48528961 AGAGAGGGGTTAGGAGGCCCCGG - Intergenic
935668471 2:105535045-105535067 GGAGAGTGGATAGCAGAGGCAGG - Intergenic
937912613 2:127082751-127082773 GGGGAGGTGTGAGCAGCAGCCGG - Intronic
938160175 2:128978722-128978744 GGAGAGGGCTCAGCAGCCTTTGG + Intergenic
946156738 2:217811947-217811969 GGAGAGGAGAGAGCAGCCTCAGG - Intronic
947045481 2:225978196-225978218 GGAGAGTAGTTAGCAGGCTCAGG - Intergenic
948365466 2:237451863-237451885 AGAGAGGGGTCAGGAGCCCCAGG - Intergenic
948666785 2:239539841-239539863 AGGGAGGGGTTAGCAGACACGGG - Intergenic
1171135529 20:22691549-22691571 GCAGAGGGTCTAGCAGCAGCAGG - Intergenic
1171250053 20:23639842-23639864 GGAGAGGGAGCAGCAGCCACAGG + Intergenic
1171256154 20:23690357-23690379 GGAGAGGGAGCAGCAGCCACGGG + Intergenic
1171266799 20:23777565-23777587 GGAGAGGGAGCAGCAGCCGCGGG + Intergenic
1171284100 20:23923588-23923610 GTACAGGGATCAGCAGCCGCGGG + Intergenic
1173990970 20:47303179-47303201 GGAGATGGGTGAGGAGCAGCAGG + Intronic
1174072359 20:47908302-47908324 GAAGAGGGGTTCTCAGCCACAGG - Intergenic
1174151704 20:48490396-48490418 GAAGAGGGGTTCTCAGCCACAGG + Intergenic
1175128029 20:56766990-56767012 GGAGAGGGGTGAGCACGCACTGG + Intergenic
1175483966 20:59331518-59331540 AGAGAGGGGGGAGCAGCTGCAGG - Intergenic
1175524473 20:59624028-59624050 GGAGAGTGGTTGGGAGCTGCTGG + Intronic
1176407336 21:6428259-6428281 GGAGAGGGGAGAGCAGAGGCAGG + Intergenic
1178960737 21:37062355-37062377 GGAGAGGGGTTAACACCCACAGG - Intronic
1179106052 21:38401715-38401737 AGAGTGGGGTGAGCAGCCGGTGG + Intronic
1179682844 21:43036662-43036684 GGAGAGGGGAGAGCAGAGGCAGG + Intergenic
1180200251 21:46219818-46219840 GGAGAGGTGTTTGCAACCCCTGG + Intronic
1181056252 22:20261794-20261816 GGAGAGGGGTAGGCAGACACAGG + Intronic
1183581770 22:38730691-38730713 GGGGAAGGTTCAGCAGCCGCTGG - Exonic
1184663323 22:45975596-45975618 GGAGAGGTGGAAGCAGGCGCTGG - Intronic
1184752996 22:46499865-46499887 GGAGAGGGGTTTGCAGACGGTGG - Intronic
1184912616 22:47546528-47546550 GGAAAGGGGGTAGGAGCTGCAGG - Intergenic
1185005971 22:48277220-48277242 GGAGAGGGGCTGGCAGCAGGGGG - Intergenic
1185048197 22:48539738-48539760 GGAGAGGGCTTAATAGCCGCAGG + Intronic
1185300438 22:50077203-50077225 GGTGAGGGGTTGGCGGCCGCTGG - Intronic
1185409595 22:50674801-50674823 GGGGAGGGGTGAGTAGCCGTGGG - Intergenic
949480974 3:4493540-4493562 GGAGAGGGGTTAGCAGCCGCTGG - Exonic
950004509 3:9682988-9683010 GGAGAGGTGGTAGGAGCTGCTGG + Intronic
952161363 3:30696588-30696610 GGAGAGGGGTTAGAAGACCTTGG - Intergenic
954288804 3:49638159-49638181 GGAGAGGGCCTAGGAGCCACAGG + Intronic
954855532 3:53640873-53640895 GGATGGGGGTTAGAAGCAGCAGG + Intronic
960451772 3:117818638-117818660 GGAGAGGGGTGAGTAGCAGAGGG - Intergenic
962809153 3:138946870-138946892 GGAGAGGGGAGAGCAGCGACAGG - Exonic
963503953 3:146161451-146161473 GGAGAGGGAGGAGGAGCCGCCGG + Intronic
965370722 3:167858930-167858952 GAAGAGTGGTTATCAGCGGCTGG + Intergenic
968225687 3:196970530-196970552 GGTGAGGGGTTAGCTGCAGAGGG - Intergenic
968661729 4:1801450-1801472 GGAGTGGGGTTGCCAGCGGCTGG - Exonic
969304470 4:6317912-6317934 GGAAAGGTGTGAGCAGCGGCTGG + Intergenic
969715343 4:8865652-8865674 GGAGAGGGGTCAGAAGGGGCGGG + Intronic
971156754 4:24091567-24091589 GGAGAGAGAGTAACAGCCGCTGG - Intergenic
973573856 4:52266324-52266346 GAATAGGGGTTTGCAGCTGCTGG - Intergenic
975888041 4:78989193-78989215 GGAGAGGTGTTAGTAGCTGTAGG + Intergenic
981355946 4:143789378-143789400 GGAGAGGGGTTATTAGCAGGTGG - Intergenic
984957324 4:185058361-185058383 GGAGAGTGGTCAGCAACAGCTGG - Intergenic
988466336 5:31495995-31496017 GGAGAGGTGTGAGCTGCAGCTGG + Intronic
989170898 5:38469622-38469644 GGAGAGGGGTATGGGGCCGCAGG + Intergenic
995601670 5:113804348-113804370 GGAGAGGAGACAGCAGCCACTGG - Intergenic
995746306 5:115407498-115407520 GGATAGTGGTTAGCAGCAGGTGG - Intergenic
997114591 5:131112546-131112568 GCAGAGGGGTGAGCAGGAGCAGG - Intergenic
997261197 5:132466641-132466663 GGGCAGGGGTTGGCAGCTGCTGG + Intronic
998690169 5:144579469-144579491 GGAGTGGGCTTAGGAGCAGCTGG + Intergenic
999297959 5:150472457-150472479 GGAGAGGGGTAGGCAGAGGCTGG - Intergenic
1001042936 5:168349744-168349766 GGAGTGGGGTTGGCTGCCGTGGG + Intronic
1001428486 5:171641115-171641137 GGACTGGGGTCAGCAGCCCCAGG + Intergenic
1001948266 5:175797639-175797661 GGAGGGGGCTGAGAAGCCGCGGG + Intronic
1004576101 6:16896751-16896773 GGAGAGGGGCTAGTAGCCTCAGG + Intergenic
1005255792 6:24001666-24001688 AGAAAGGGATTAGCAGCCACTGG + Intergenic
1005298938 6:24452175-24452197 TGAGAGAGTTTAGCAGCCACAGG + Intronic
1005968747 6:30744626-30744648 GGGGAGCGGTTGGCAGCAGCGGG + Intergenic
1008154050 6:47991429-47991451 GGAGAGAGGTTTGCACCAGCAGG + Intronic
1008535809 6:52505433-52505455 GGAGAAGAGATAGCAGCCTCTGG - Intronic
1018060181 6:160084128-160084150 TGAGAGAGGAGAGCAGCCGCAGG - Exonic
1018916302 6:168134583-168134605 GGGGAGGGCTTTGCAGCTGCTGG + Intergenic
1019618869 7:1979833-1979855 GGAGCCGGGTCTGCAGCCGCAGG - Intronic
1022999323 7:35791194-35791216 GGAGAGGGGCTAGAAGCAGCTGG + Intergenic
1027696442 7:81416950-81416972 GGAGAGGGCTTAGCATATGCAGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1031889631 7:127279106-127279128 GAAGAGGGGTCAGCAGAGGCAGG - Intergenic
1032986767 7:137345883-137345905 GGAAAGGGGTTGGCAGCTCCCGG + Intergenic
1034282323 7:149862916-149862938 GGAGAGGGCTGACCAGCCCCAGG + Intronic
1036785130 8:11680746-11680768 GGAGAGGGGTGCGCAGAAGCCGG - Intronic
1039548810 8:38428950-38428972 GGAGAGGTGTTGGCAGCTGCTGG - Intronic
1039898041 8:41730199-41730221 GAAGCGGGGTCAGCAGCGGCTGG - Intronic
1041164655 8:55079318-55079340 GAAAAGGGGTTTGCAGCCTCTGG - Intergenic
1041467631 8:58172891-58172913 GGACAGGAGAAAGCAGCCGCAGG - Intronic
1041500638 8:58534975-58534997 GGCGAGGGGTCATCAGCTGCAGG - Intergenic
1045783231 8:105892341-105892363 GGAGAGTGGTTACCAGAGGCTGG + Intergenic
1049172176 8:141168314-141168336 GGAGGGGGCTGAGCAGGCGCCGG + Exonic
1049413551 8:142484626-142484648 GCAGGGGGGTGAGCAGCCGAGGG - Intronic
1053029223 9:34759790-34759812 GGAGAGGAGTTTGCAGCAGATGG - Intergenic
1056135123 9:83623360-83623382 GGAGAGGGCGCGGCAGCCGCGGG - Intronic
1061396277 9:130345664-130345686 GGAGTGGGGGTAGCAGCCCCTGG + Intronic
1061445361 9:130634325-130634347 AGAGAGTGGTCAGCAGCCTCTGG + Intronic
1061693526 9:132354677-132354699 GGACAGGGGGTCGCAGCGGCCGG + Intronic
1062290278 9:135791212-135791234 GGACAGGGCTGAGCAGCCTCTGG + Intronic
1062561945 9:137145620-137145642 GGAGGGGGGTTCCCAGCCTCCGG + Intronic
1186690828 X:11973921-11973943 GGAGTGGGGTTAACAGACCCAGG + Intergenic
1187972918 X:24676649-24676671 GGAAATGGGTTGGCAGCAGCAGG + Intergenic
1193515108 X:82452677-82452699 GGAGGGGCGCTAGCAGACGCTGG - Intergenic
1195108714 X:101624250-101624272 GGGGAGGGGTTAGAAATCGCCGG + Intronic
1195884496 X:109624981-109625003 TCAGAAGGGTTCGCAGCCGCTGG + Exonic
1200139606 X:153892813-153892835 GGAGAGGGGACAGCAGCTGGTGG - Intronic
1200232360 X:154450364-154450386 GGCGAGGGGTGAGCAGGGGCTGG - Intronic
1201239595 Y:11946060-11946082 GGACAGGGGTTTGCAACCCCAGG + Intergenic