ID: 949482956

View in Genome Browser
Species Human (GRCh38)
Location 3:4511334-4511356
Sequence CAATTTCAATAGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 257}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949482950_949482956 5 Left 949482950 3:4511306-4511328 CCTTTTTTTTTACGCACAGCTCA 0: 1
1: 0
2: 1
3: 15
4: 268
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482949_949482956 6 Left 949482949 3:4511305-4511327 CCCTTTTTTTTTACGCACAGCTC 0: 1
1: 0
2: 1
3: 13
4: 200
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482946_949482956 9 Left 949482946 3:4511302-4511324 CCCCCCTTTTTTTTTACGCACAG 0: 1
1: 1
2: 4
3: 30
4: 366
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482944_949482956 14 Left 949482944 3:4511297-4511319 CCTGCCCCCCCTTTTTTTTTACG 0: 1
1: 0
2: 10
3: 181
4: 1147
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482943_949482956 15 Left 949482943 3:4511296-4511318 CCCTGCCCCCCCTTTTTTTTTAC 0: 1
1: 0
2: 19
3: 250
4: 2133
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482945_949482956 10 Left 949482945 3:4511301-4511323 CCCCCCCTTTTTTTTTACGCACA 0: 1
1: 0
2: 3
3: 41
4: 427
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482947_949482956 8 Left 949482947 3:4511303-4511325 CCCCCTTTTTTTTTACGCACAGC 0: 1
1: 0
2: 1
3: 11
4: 204
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257
949482948_949482956 7 Left 949482948 3:4511304-4511326 CCCCTTTTTTTTTACGCACAGCT 0: 1
1: 0
2: 0
3: 15
4: 242
Right 949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 37
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949482956 Original CRISPR CAATTTCAATAGAGGGCAAA GGG Intronic
902875571 1:19338899-19338921 CAATTTCTATGGAATGCAAAAGG - Exonic
903914710 1:26755308-26755330 CATTTTCATTAGATGGCAACTGG - Intronic
903979837 1:27177684-27177706 AAATTACAATAGGGGGGAAAGGG + Intergenic
904063529 1:27729562-27729584 GAATTTAAGTAGAGGGCATATGG - Intronic
904178748 1:28650620-28650642 CCAGTTCAATAATGGGCAAAAGG + Intergenic
907421745 1:54352351-54352373 CAATCTCCAGAGAGGCCAAATGG + Intronic
907895579 1:58687012-58687034 CAGTTTCAAAATAGAGCAAAGGG + Intronic
908290762 1:62664902-62664924 CAGATTCAGGAGAGGGCAAAGGG + Intronic
908460359 1:64342914-64342936 GAATTTCATTAGAGGACTAAAGG - Intergenic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908768896 1:67577997-67578019 CAACTTCTATAGAGGGAAGAGGG + Intergenic
909573153 1:77140409-77140431 CAATTATGGTAGAGGGCAAATGG - Intronic
909633152 1:77787689-77787711 CAATTTCAAAAATGGGCAAAGGG - Intronic
909689023 1:78384721-78384743 CAATTTAGAGGGAGGGCAAAGGG + Intronic
909747620 1:79117968-79117990 CCATGTCAATTGATGGCAAAAGG + Intergenic
909980902 1:82099605-82099627 CAAATTAAATAAAGGGCTAACGG + Intergenic
911418765 1:97612093-97612115 TAATATCAATACAGGGCATAAGG - Intronic
912086495 1:106013073-106013095 CAATCACAGTAGAAGGCAAAGGG + Intergenic
913502102 1:119480753-119480775 ACATTTCAAAAGAGGGCAGAAGG + Intergenic
913676140 1:121142461-121142483 CAATTTTAAAAATGGGCAAAGGG - Intergenic
914028033 1:143930405-143930427 CAATTTTAAAAATGGGCAAAGGG - Intergenic
915493399 1:156264530-156264552 CAACCTCAATAGAGTGGAAAAGG + Intronic
916180346 1:162078108-162078130 CACTCACAGTAGAGGGCAAAGGG - Intronic
919042078 1:192401924-192401946 CTATTTCAATAGAAGACACATGG + Intergenic
919119110 1:193316789-193316811 TCATTTCAATAGGGGGAAAAAGG - Intergenic
920463508 1:206161299-206161321 CAATTTTAAAAATGGGCAAAGGG - Intergenic
922587077 1:226741836-226741858 CAATTTCAAAAGCAGACAAATGG - Intergenic
923699388 1:236285309-236285331 TATTTTTAATAGAGGGGAAAGGG + Intergenic
923814486 1:237360285-237360307 TGATTTCTACAGAGGGCAAATGG - Intronic
1063264194 10:4428655-4428677 AACTTTCAATAGAGGCCAGAGGG - Intergenic
1067798791 10:49342171-49342193 CAGTTACAGTAGAAGGCAAAGGG + Intergenic
1068864199 10:61877962-61877984 CAATGTCAGTAGAGGGTCAAAGG - Intergenic
1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG + Intronic
1069399462 10:68027303-68027325 CAGTTTCAATAACTGGCAAAAGG + Intronic
1071312594 10:84357374-84357396 CAAGTCCAATGGAGGGAAAAGGG - Intronic
1071552810 10:86580294-86580316 CAATTGTAATAGAGATCAAAAGG + Intergenic
1073629572 10:105135011-105135033 CAATTTCAAAAGCAAGCAAAAGG + Intronic
1073942646 10:108715647-108715669 CAATCATAATAGAAGGCAAAGGG + Intergenic
1074153720 10:110781095-110781117 CAATTGCATTAGAGGGAAACCGG - Exonic
1076101915 10:127788621-127788643 TAATTTCAAAAGATTGCAAAGGG - Intergenic
1076150272 10:128156522-128156544 CAATTTAAAAAATGGGCAAAAGG - Intergenic
1078612440 11:12832620-12832642 AAATTTTAATAGAGTGCAAAAGG - Intronic
1079904575 11:26229788-26229810 CAATTTGAATAGTGGGTAATTGG - Intergenic
1080092054 11:28360202-28360224 CACTTTTAAGAGAAGGCAAATGG - Intergenic
1083229489 11:61306949-61306971 CAATTTGAGTAGAGTGGAAAAGG - Intronic
1083735500 11:64677964-64677986 CAATTTCATTTGGAGGCAAAAGG + Intronic
1084471676 11:69364918-69364940 CAATTTCTTTAGAGGCTAAAGGG - Intronic
1085986524 11:81794103-81794125 CAATCACAATGGAAGGCAAAGGG - Intergenic
1086890636 11:92254198-92254220 CAATTTCAATAGATGACAGAAGG - Intergenic
1086895127 11:92303317-92303339 CATGTGCAATAGAGGGGAAATGG - Intergenic
1087186372 11:95201961-95201983 GCATTTCAATAGAGAGAAAAAGG - Intronic
1087862923 11:103185534-103185556 TAATTTCAGTAGAGGTCAATTGG - Intronic
1090231487 11:125109844-125109866 CAGTTAGAATAGAGGGCAAATGG + Intronic
1090578317 11:128132739-128132761 CATTTTCAAATGAGGGCACAGGG + Intergenic
1092994042 12:13931228-13931250 CAATTTCAGTAGAGGATTAAAGG - Intronic
1093249696 12:16786936-16786958 GAATTTTAATAGAGGAGAAAAGG + Intergenic
1095354326 12:41253624-41253646 CAATTTCACTACTGGGCATATGG + Intronic
1095511533 12:42955971-42955993 AAATTTAAAAAGAGGGGAAAAGG + Intergenic
1095580307 12:43789312-43789334 CAATCACAATGGAAGGCAAAGGG - Intronic
1096229976 12:49891283-49891305 CAGTTCCAAAAGAGAGCAAAAGG + Intronic
1097606732 12:61764183-61764205 CAATTACAATAAAGGAGAAATGG + Intronic
1098101550 12:67022981-67023003 AAATTTTAAAAGTGGGCAAAAGG - Intergenic
1098172517 12:67761074-67761096 CAATTCCAATAGAAAGCCAATGG + Intergenic
1100622607 12:96293344-96293366 CTATTTCAATAGAAGACAACTGG + Intronic
1101448649 12:104756403-104756425 CAGCCTCAGTAGAGGGCAAAGGG - Intronic
1105397219 13:20048690-20048712 CATTTTCAATAACTGGCAAAAGG - Intronic
1106645042 13:31625083-31625105 CAAATTCAATACAAGGAAAATGG - Intergenic
1106783985 13:33088975-33088997 TAATGTCAATAGAAGACAAAAGG - Intergenic
1108225854 13:48287977-48287999 CTATTTCAGAAGAGGGGAAAAGG + Intergenic
1109009352 13:56920552-56920574 CAATTTCATTAGAGAAGAAACGG + Intergenic
1109140038 13:58703734-58703756 GAGTGTCAATAGAGGCCAAATGG - Intergenic
1109662545 13:65483037-65483059 TAATATCATTAGAGGGGAAATGG - Intergenic
1110527806 13:76559662-76559684 AAGTTTCAGTGGAGGGCAAATGG - Intergenic
1111265037 13:85799161-85799183 GAATTTTAATTGAGGGAAAAAGG - Exonic
1112223404 13:97514118-97514140 CAATTATAATGGAAGGCAAACGG + Intergenic
1112753570 13:102606219-102606241 CAATTCAGATAGATGGCAAAAGG - Intronic
1112882834 13:104130316-104130338 CTTTTGCAATATAGGGCAAATGG + Intergenic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1114137065 14:19865391-19865413 CTAGTTCAATAGAGAGGAAAAGG + Intergenic
1115085637 14:29512166-29512188 AAATTTCCATTAAGGGCAAACGG + Intergenic
1116151784 14:41151261-41151283 CCATTTCAAAAGTGGACAAAGGG + Intergenic
1116239966 14:42328163-42328185 CATTTTCATTAGAGGAGAAAAGG - Intergenic
1116380647 14:44263394-44263416 AAATTTCCATTGTGGGCAAAGGG - Intergenic
1119503310 14:75149636-75149658 CAATTCCAATATGGAGCAAAGGG + Intronic
1119957366 14:78813462-78813484 CTATTTCAATAGAAGTCATAGGG + Intronic
1120101269 14:80448357-80448379 CATTTTGAAGATAGGGCAAAAGG - Intergenic
1121390604 14:93570283-93570305 CAATTTCAAAATAGGGCAGTTGG - Intronic
1121402405 14:93691465-93691487 CAGTTTCATTAAAGGGCAAGGGG + Intronic
1121591272 14:95113309-95113331 CAAATTCAGTAGAGGGGAAGAGG - Intronic
1122106842 14:99464327-99464349 CTCTTTTAATAGAGAGCAAAGGG - Intronic
1202881757 14_KI270722v1_random:67310-67332 AAATTTCAATAGATGCCAATTGG - Intergenic
1127605934 15:60588811-60588833 CAATTCAAATCGTGGGCAAAAGG + Intronic
1128198150 15:65779153-65779175 CAAATTCAAGAGAAGGAAAAAGG + Intronic
1128690455 15:69720886-69720908 GAATTTGAACAGAGGGGAAAAGG - Intergenic
1128960619 15:72000079-72000101 CAATTTTAATACTGGCCAAATGG + Intronic
1129791516 15:78343717-78343739 TAATTTTAATCCAGGGCAAATGG - Intronic
1130166950 15:81471178-81471200 CAATTTCAATGGAGAAGAAAAGG + Intergenic
1131500731 15:92962888-92962910 AAATATCATTAGAGGTCAAATGG - Intronic
1134502359 16:14779258-14779280 CCATTTCCATAGAGGAAAAAAGG - Intronic
1134578203 16:15349636-15349658 CCATTTCCATAGAGGAAAAAAGG + Intergenic
1134724388 16:16407910-16407932 CCATTTCCATAGAGGAAAAAAGG - Intergenic
1134943043 16:18303949-18303971 CCATTTCCATAGAGGAAAAAAGG + Intergenic
1138907805 16:61359122-61359144 AAATTGCAAGACAGGGCAAAAGG + Intergenic
1140288446 16:73627146-73627168 AAATTTCACTAAAGGGTAAAGGG + Intergenic
1144820531 17:18070251-18070273 CAATTGCAAAACAGGACAAAAGG + Intergenic
1145835422 17:27951077-27951099 CTATTTGGATTGAGGGCAAAGGG - Intergenic
1148509031 17:48153287-48153309 CCATTCCAAGAGAGGACAAAAGG - Intronic
1150524709 17:65909963-65909985 CAATTTCAATGGAGTAAAAATGG + Intronic
1150667124 17:67151349-67151371 CTAATTCAATAGAGTGCTAACGG - Intronic
1150950595 17:69799238-69799260 TAATTTAAATGGAGGCCAAATGG + Intergenic
1152206803 17:78978547-78978569 CAATGTCAGTAGATGGCTAAAGG + Intronic
1153015773 18:581177-581199 CAAGTTCAGCACAGGGCAAATGG - Exonic
1153135176 18:1909472-1909494 TGATTTCAATAGAGGGAAACTGG + Intergenic
1155895290 18:31317552-31317574 TAATTTCTTTAGAGGGAAAATGG + Intergenic
1156258078 18:35417871-35417893 CAATTTTAAAAGTAGGCAAAAGG - Intergenic
1156753922 18:40496750-40496772 CAATATACATAGAGGACAAAAGG - Intergenic
1157695715 18:49721827-49721849 CAGTATCATTAGCGGGCAAAAGG - Intergenic
1160349315 18:78160859-78160881 CAATTTCAATAGGAGGTAAGTGG + Intergenic
1162273710 19:9636751-9636773 CTAATTCTAAAGAGGGCAAATGG + Intronic
1162544604 19:11321259-11321281 CAATTATAACAGAAGGCAAAGGG + Intronic
1165609427 19:37137616-37137638 CAATTTCAACTGACTGCAAACGG + Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
1166163976 19:40973634-40973656 CAAGTTCAAGAGAGGGAAAATGG + Intergenic
1166417338 19:42605645-42605667 CAAATTCAAGAGTGGGCAACAGG + Intronic
1166648597 19:44552604-44552626 GAATGTCAACAGAGGCCAAATGG + Intergenic
1167587577 19:50383695-50383717 CAATTCCAATCGAGGGCGAAAGG + Intergenic
1202657368 1_KI270708v1_random:36409-36431 AAATTTCAATAGAGGCCAATTGG - Intergenic
925072251 2:979069-979091 CAATTTCAATGAAAGGAAAATGG + Intronic
925437342 2:3851278-3851300 AAATTTTAAGAGAGAGCAAATGG + Intergenic
925648373 2:6061821-6061843 CTATTTAAATAAGGGGCAAATGG + Intergenic
926103521 2:10136221-10136243 GAATCTCAATAAAGGGCAGAGGG + Intergenic
926639904 2:15223914-15223936 CAATCTCATTATAGGGAAAAAGG - Intronic
926927790 2:18005175-18005197 GATTTTCAATATAGAGCAAATGG - Intronic
927179554 2:20434986-20435008 CAATTTAAATTGAGGGAAAAGGG - Intergenic
927784426 2:25963529-25963551 GAATTTCAGAAGAGGACAAAGGG + Intronic
927825351 2:26305291-26305313 CAGTTCCAATATAGGCCAAAGGG - Intergenic
927873520 2:26639523-26639545 AAATTTCAATAGAGGTTATATGG + Intronic
928474567 2:31613783-31613805 CAATCACAGTGGAGGGCAAAGGG + Intergenic
930274344 2:49294291-49294313 CAATTCCATCAGAGGGCCAAGGG + Intergenic
930740623 2:54829209-54829231 GCATTTCAATAGAGAACAAAGGG + Intronic
931537502 2:63294813-63294835 TAATTTGTATAGAGAGCAAAAGG - Intronic
933055164 2:77653948-77653970 CTTTTACAATGGAGGGCAAAGGG + Intergenic
934818417 2:97350746-97350768 CAGTTTCAAAGGAGGGCACAGGG + Intergenic
935161092 2:100530132-100530154 CAAGTTACATAGAGAGCAAACGG - Intergenic
936345042 2:111669146-111669168 CAATGTCAAAAGCGGGCACAGGG - Intergenic
936579209 2:113682095-113682117 CAGAATCAATAGAGGCCAAAAGG + Intergenic
936600781 2:113892134-113892156 CTATTTCAAAAGGGGGAAAATGG - Intronic
936839986 2:116757676-116757698 CAATGACAATAGAGGTTAAAAGG + Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
938184711 2:129219800-129219822 CAATAACAATGGAAGGCAAAGGG - Intergenic
939688234 2:145226074-145226096 AATTTTCAATACATGGCAAAAGG - Intergenic
939999157 2:148949754-148949776 CAAATTCACACGAGGGCAAAGGG - Intronic
940631382 2:156243747-156243769 CAAATTTAATACAGGACAAAAGG + Intergenic
941782893 2:169464227-169464249 CAACTTCAATACATGGCAGAAGG - Intergenic
942877631 2:180820625-180820647 CAATTTCCATAGATGTGAAATGG + Intergenic
943666810 2:190617578-190617600 CAAATTAAATAGGGGTCAAATGG - Intergenic
943908997 2:193539325-193539347 CAATGTAAATAGAGATCAAAAGG + Intergenic
944462584 2:199966647-199966669 CAAGTTCAGAAGAGGGGAAAGGG - Intronic
945405757 2:209446827-209446849 AAATCTCAATAGAGGGCCAAAGG - Intronic
946362069 2:219224911-219224933 CACTTCTAATATAGGGCAAAGGG - Intronic
947004809 2:225498840-225498862 AAGTTTCATTAGAGGGAAAAGGG + Intronic
947989985 2:234479197-234479219 CAATGTAACTAGAGGGGAAAAGG - Intergenic
947990364 2:234482774-234482796 CAATTTAAATATAGGGAAACAGG + Intergenic
948426558 2:237890971-237890993 CAATTTTAAGAAAGGGAAAAGGG - Intronic
1169256441 20:4103555-4103577 CAATTTTAAAAATGGGCAAAGGG + Intergenic
1170252613 20:14301774-14301796 CTATTTCAAAAGAGGGAAACAGG - Intronic
1170671349 20:18436846-18436868 CAAAAACAATGGAGGGCAAAAGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171415385 20:24976364-24976386 CAATTACAAAAATGGGCAAAAGG + Intronic
1173829031 20:46066877-46066899 CAATTCAAATTGAGGCCAAAAGG - Intronic
1174721310 20:52815779-52815801 TAATTGCAATACAGGGTAAATGG - Intergenic
1176597239 21:8758753-8758775 AAATTTCAATAGAGGCCAATTGG - Intergenic
1176643056 21:9324715-9324737 AAATTTCAATAGAGGCCAATTGG - Intergenic
1177440277 21:21114301-21114323 CAATTTTTGTAGAGAGCAAAGGG - Intronic
1178778736 21:35578625-35578647 CAAATTCATTAGATGGAAAACGG + Intronic
1179086785 21:38225418-38225440 CAAATTCAATAGAGGCCGGAGGG + Intronic
1180369878 22:11974501-11974523 AAATTTCAATAGAGGCCAATTGG + Intergenic
1180376366 22:12097604-12097626 AAATTTCAATAGAGGCCAATTGG - Intergenic
1180421207 22:12816081-12816103 AAATTTCAATAGAGGCCAATTGG + Intergenic
1181425117 22:22831042-22831064 AAATTTCAAAAGAGAGAAAAAGG + Intronic
1182045013 22:27267484-27267506 CAGATTCAATAAAGGGGAAAGGG - Intergenic
1183329592 22:37212167-37212189 CAATAGAAATAGAGGGGAAAGGG + Exonic
949207263 3:1455079-1455101 GAGTGTCAATAAAGGGCAAATGG - Intergenic
949280746 3:2343915-2343937 CAATTATGACAGAGGGCAAAGGG + Intronic
949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG + Intronic
949603416 3:5627186-5627208 CAATTTAAATATAAAGCAAATGG - Intergenic
955031281 3:55222411-55222433 CAATGTCAGTGGAGGGCACATGG - Intergenic
956655681 3:71547982-71548004 CAATTTCATAAGAGGACAAAGGG + Intronic
956966119 3:74462674-74462696 TAATATCAATAGAGGACAACAGG - Intronic
957097027 3:75785868-75785890 AAATTTCAATAGAGGCCAATTGG + Intergenic
964729557 3:159850671-159850693 CAATTACGACAGAAGGCAAAGGG + Intronic
965025277 3:163293575-163293597 CAAATTCAATAGAGATGAAAAGG + Intergenic
967505844 3:190251761-190251783 CAATCACAATGGAAGGCAAAGGG - Intergenic
967677074 3:192313440-192313462 CGATTTCAATAGATGGGAAAAGG - Intronic
1202743829 3_GL000221v1_random:80314-80336 AAATTTCAATAGAGGCCAATTGG + Intergenic
969989270 4:11243786-11243808 CAATAAAAATAGAGGGCAGATGG - Intergenic
972797811 4:42439676-42439698 CAATGTCTATAGAGAGGAAATGG + Intronic
973360533 4:49160972-49160994 AAATTTCAATAGAGGCCAATTGG - Intergenic
973399552 4:49626943-49626965 AAATTTCAATAGAGGCCAATTGG + Intergenic
974578927 4:63769057-63769079 CAATTTAAATGAAGGACAAATGG + Intergenic
976082987 4:81376565-81376587 CATTTCCAATAGAGGGAACAGGG - Intergenic
977696241 4:99969760-99969782 CAGTTTCAATACAGGGCATCTGG - Intergenic
980209568 4:129769348-129769370 CAATTTCAATAGGAAACAAAGGG - Intergenic
980471296 4:133255770-133255792 TCATTTAGATAGAGGGCAAATGG + Intergenic
981608106 4:146562302-146562324 GAATTTCAGTAGAAGGCAGAGGG - Intergenic
982862323 4:160468473-160468495 CAATTTAAGCAGAAGGCAAAGGG + Intergenic
983278870 4:165654960-165654982 CAACTTCAATAGCTTGCAAAGGG + Intergenic
983695222 4:170519760-170519782 AAATTTCAATAGAGAGCACATGG + Intergenic
984476001 4:180236072-180236094 TAATTTCAATAGAGAGAAATAGG - Intergenic
1202757965 4_GL000008v2_random:83037-83059 AAATTTCAATAGAGGCCAATTGG - Intergenic
988321415 5:29702208-29702230 CAATTTTATTAAATGGCAAAAGG - Intergenic
988639884 5:33030068-33030090 CAATATCAATAGAATGTAAATGG - Intergenic
988839806 5:35072408-35072430 CAATCCCAATAGAGGGGAAAAGG + Intronic
993405153 5:87502402-87502424 CATTATCTATAAAGGGCAAAGGG + Intergenic
994228716 5:97286885-97286907 CAATTTAAAAAGTAGGCAAATGG - Intergenic
994851936 5:105066852-105066874 CAAGTGAAAAAGAGGGCAAAGGG + Intergenic
996097067 5:119410308-119410330 GTATTTGAATAGAGAGCAAATGG - Intergenic
996274774 5:121651512-121651534 CAATCTCAATACTGGGCAAAAGG + Intergenic
997581910 5:135023342-135023364 CAAATTCAAAAATGGGCAAAGGG - Intergenic
1001090695 5:168738195-168738217 AAATGTCAACACAGGGCAAAAGG - Intronic
1001227590 5:169958540-169958562 CTATTAAAATAGAGGACAAAAGG + Intronic
1003853947 6:10253265-10253287 CAATTTCAACAAAGGGGAATAGG - Intergenic
1004166281 6:13259659-13259681 CAATTTCACTATATGACAAATGG - Intronic
1004228700 6:13812166-13812188 CAATTACAATAGAGGCCCAAAGG + Intronic
1004697624 6:18048485-18048507 AAATATTAATAGAAGGCAAAAGG - Intergenic
1008560486 6:52720079-52720101 CAATTACAGCAGAAGGCAAAAGG - Intergenic
1009822334 6:68819225-68819247 CAGTTTCAATGGAGTGAAAAGGG - Intronic
1011172124 6:84516839-84516861 CAATTACAGCAGAAGGCAAAGGG - Intergenic
1011210529 6:84951310-84951332 CTAATTGTATAGAGGGCAAAAGG + Intergenic
1011703611 6:89979526-89979548 GAATTTCAGTAGATGGGAAATGG - Intronic
1012335270 6:98047613-98047635 CCATTTCAAAAGATGCCAAAGGG - Intergenic
1013054148 6:106566828-106566850 CAATTTTAATAGATAACAAATGG - Intronic
1014192512 6:118514180-118514202 CTAATTCAAGAGAAGGCAAAGGG + Intronic
1014614036 6:123580543-123580565 CAATGTCATTAGAAGGCAAGAGG - Intronic
1015018641 6:128444516-128444538 CTATTGCAATAGAGGGAAAGAGG - Intronic
1015091150 6:129361192-129361214 CATCTTCACTAGAGGTCAAATGG + Intronic
1017357119 6:153522850-153522872 AAATTTCAATAAAGGCAAAAAGG + Intergenic
1018522202 6:164662910-164662932 CAATTTGAATATAGAGCAAAGGG + Intergenic
1024713433 7:52044893-52044915 CAATTTAAAAAGTGGGAAAATGG + Intergenic
1026063036 7:67043509-67043531 CAATTTAAATAGCTGGCAAATGG - Intronic
1026715312 7:72783990-72784012 CAATTTAAATAGCTGGCAAATGG + Intronic
1027763183 7:82305773-82305795 TCATATCTATAGAGGGCAAAGGG + Intronic
1029014700 7:97303633-97303655 CAATTTTAAAAATGGGCAAAAGG - Intergenic
1030004317 7:105100687-105100709 GAATTACAATGGAGGGCAAGAGG + Intronic
1030883411 7:114910017-114910039 CTATTCCAATAGAAGACAAATGG - Intergenic
1031032787 7:116752741-116752763 CACTTTCTATAAAAGGCAAACGG - Intronic
1031201913 7:118699255-118699277 CAGTTTCTACAAAGGGCAAACGG + Intergenic
1032116253 7:129119908-129119930 CAATTTAAAAAATGGGCAAATGG - Intergenic
1032423084 7:131798931-131798953 CCATTACAATACAGGGCTAAAGG - Intergenic
1033672785 7:143509319-143509341 CAATTTCTATACAGGGAAAGTGG - Intergenic
1035226586 7:157437111-157437133 GAATTTCTACAGAAGGCAAAAGG + Intergenic
1039577008 8:38631772-38631794 CAATTTCATTAAATGGCATAGGG - Intergenic
1042002542 8:64141851-64141873 CAATAGCAGTAGAAGGCAAAGGG - Intergenic
1043450961 8:80366252-80366274 TAATTTTACTAAAGGGCAAATGG + Intergenic
1044193842 8:89351862-89351884 CAATTATAATGGAAGGCAAAAGG + Intergenic
1044576676 8:93777383-93777405 CAAATTCAAAAGAGAGCAGAAGG - Intronic
1044648623 8:94470800-94470822 CAATTACAGTAGGGGGAAAAAGG + Intronic
1044786962 8:95804580-95804602 CAATTTTAAAAATGGGCAAAGGG + Intergenic
1045676238 8:104610933-104610955 CAATCTCAATAGATGTGAAAAGG - Intronic
1047429417 8:124778007-124778029 AAATTCCTATAGAGGACAAATGG + Intergenic
1049929783 9:445237-445259 GAATTTTAAAAGAGGGGAAAAGG - Intronic
1051084270 9:13330237-13330259 ATATTTCAATAAATGGCAAAGGG - Intergenic
1056675137 9:88669670-88669692 CCATTTAAAAAGTGGGCAAAGGG - Intergenic
1057416639 9:94869625-94869647 CAATTTCATTTGAAGGTAAATGG - Intronic
1060311266 9:122464601-122464623 TACTTCCAATAGAGGGAAAATGG - Intergenic
1061641716 9:131963230-131963252 CAATTTCTACAGAGAGGAAATGG + Intronic
1062342828 9:136101320-136101342 CAGTTTCACTACAGGGCAAACGG - Intergenic
1203689570 Un_GL000214v1:30057-30079 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203712461 Un_KI270742v1:110278-110300 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203538755 Un_KI270743v1:67909-67931 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203556060 Un_KI270743v1:208604-208626 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203646705 Un_KI270751v1:73996-74018 AAATTTCAATAGAGGCCAATTGG + Intergenic
1185788179 X:2907939-2907961 CAGTTTCAACACAGGGGAAAGGG - Intronic
1186656054 X:11613306-11613328 CAATTTCCATGGTGGCCAAAAGG - Intronic
1186671173 X:11768949-11768971 CAATTTCCACAGAGGGCCAGAGG + Intronic
1186852979 X:13598374-13598396 CAAATTCCATGGAAGGCAAAAGG - Intronic
1187666203 X:21612866-21612888 GAATTTCAAAATAAGGCAAAAGG - Intronic
1188934549 X:36157946-36157968 CAATTTCAATTGTGTGCAAAAGG - Intergenic
1189378329 X:40483236-40483258 CAATCACAATGGAAGGCAAAGGG + Intergenic
1190794700 X:53730268-53730290 CATTTTCAATAGAAGATAAAAGG - Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1192008375 X:67241463-67241485 CAATTTCAAAACATGGCAATTGG + Intergenic
1193227761 X:79005427-79005449 AAATGTCAAGAGAGGCCAAAGGG - Intergenic
1195522278 X:105845127-105845149 CAATGCAAATAGAGGGCAAGTGG - Intronic
1195986524 X:110636700-110636722 CAATTTAAATATAATGCAAAAGG + Intergenic
1196115131 X:111991163-111991185 CAATTGGTATAGAGGGGAAAGGG - Intronic
1196123072 X:112070844-112070866 AAATTTCAATAGGTGGCAAAAGG - Intronic
1199498338 X:148480127-148480149 GAATATCATTAGAGGGAAAAAGG - Intergenic
1200823804 Y:7618566-7618588 CAATTTCAATAGGAAGCCAAAGG + Intergenic
1200879763 Y:8200868-8200890 CAATTTCAATAGGAAGCGAAAGG + Intergenic
1201055161 Y:9981258-9981280 CAATTTCAATAGGAAGCCAAAGG - Intergenic
1201543704 Y:15137422-15137444 CAATTGCAATAAAAGCCAAATGG + Intergenic
1202236252 Y:22712522-22712544 CAATTTCAATAGGAAGCCAAAGG - Intergenic
1202306913 Y:23483646-23483668 CAATTTCAATAGGAAGCCAAAGG + Intergenic
1202563894 Y:26186940-26186962 CAATTTCAATAGGAAGCCAAAGG - Intergenic