ID: 949487660

View in Genome Browser
Species Human (GRCh38)
Location 3:4555215-4555237
Sequence ACCTTAAAGCAGGAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949487660_949487667 10 Left 949487660 3:4555215-4555237 CCCTGCCTCTCCTGCTTTAAGGT 0: 1
1: 0
2: 1
3: 46
4: 291
Right 949487667 3:4555248-4555270 CCTTAGGTGTTTCCTGAGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 149
949487660_949487665 -6 Left 949487660 3:4555215-4555237 CCCTGCCTCTCCTGCTTTAAGGT 0: 1
1: 0
2: 1
3: 46
4: 291
Right 949487665 3:4555232-4555254 TAAGGTGAGGAAACTACCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949487660 Original CRISPR ACCTTAAAGCAGGAGAGGCA GGG (reversed) Intronic
900223606 1:1522674-1522696 CTCTTAGAGCAGGAGACGCACGG - Intronic
901002128 1:6154136-6154158 ATCCTAAAGCTGGAGGGGCAGGG + Intronic
903161992 1:21495630-21495652 GGCTTGAAGCAGGAGAGGTACGG + Intergenic
903221210 1:21870640-21870662 ACCACACAGCAGGTGAGGCAAGG + Intronic
903563465 1:24246466-24246488 CCCTGAAAGGAGGAGAGGGAAGG - Intergenic
904148418 1:28414855-28414877 ACCTAAAATCAGGAGAAGCAAGG - Intronic
904414181 1:30345951-30345973 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
904558232 1:31379566-31379588 ACATCAAAGCAGGATAGGGAAGG - Intergenic
904922589 1:34020541-34020563 ACCCCACAGCAGGAGAGGCCTGG - Intronic
905765532 1:40596949-40596971 AACATAAAGCTGGAGAGGCATGG + Intergenic
906350685 1:45056300-45056322 ATATTAGAGCAGGTGAGGCACGG + Intronic
906689127 1:47781116-47781138 ACCATAAAGCTGGAAAGGGACGG + Intronic
908208195 1:61872701-61872723 ACCTTAAAGCAGGAGCGTAAGGG - Intronic
908829092 1:68162301-68162323 ACCATAAAGCAGATGAGGCAGGG - Intronic
909610735 1:77549164-77549186 AGCTAAAAGCAGGCCAGGCACGG - Intronic
910250679 1:85195483-85195505 ATCTAAAAGGAGGAGAGGGATGG + Intronic
912058620 1:105636258-105636280 AACTTAAAGCAGTAGAAGAAAGG - Intergenic
913119943 1:115730804-115730826 GTCTGAAACCAGGAGAGGCAAGG - Intronic
913432017 1:118805676-118805698 AGAGCAAAGCAGGAGAGGCAAGG - Intergenic
913599926 1:120413361-120413383 AACCTAAAGCAGGCCAGGCACGG - Intergenic
914087133 1:144463302-144463324 AACCTAAAGCAGGCCAGGCACGG + Intergenic
914192917 1:145426392-145426414 AACCTAAAGCAGGCCAGGCACGG + Intergenic
914311476 1:146470900-146470922 AACCTAAAGCAGGCCAGGCACGG - Intergenic
914590942 1:149105198-149105220 AACCTAAAGCAGGCCAGGCACGG + Intergenic
917314330 1:173709094-173709116 ACACTAAAGCCAGAGAGGCAAGG - Intergenic
917398231 1:174617549-174617571 ACCTAAAAGTAGAAGATGCATGG - Intronic
918467219 1:184833031-184833053 GCCTTATAGGAGGAGAGTCAGGG - Intronic
918907801 1:190521128-190521150 ACCTTGGAGAAGGAGAGGAAGGG - Intergenic
919136556 1:193515957-193515979 ACCAGAAACTAGGAGAGGCATGG - Intergenic
919151572 1:193707386-193707408 CCCTTAAGGCAAGATAGGCAAGG - Intergenic
919514349 1:198503042-198503064 GCCTGAAAGCTGGAGAGTCACGG - Intergenic
920225447 1:204435252-204435274 AGTTTAAAGCAGGAGAGGAGTGG + Intronic
920895274 1:210042089-210042111 AACTGCAAGCAGGAGAGGCAGGG + Intronic
921518271 1:216125358-216125380 GCCTTATAGCACGAGAGGCAGGG - Intronic
921927693 1:220725972-220725994 ACCTAAAAGAAGGAGAAGAAAGG - Intergenic
922082268 1:222308714-222308736 GCCTTGGAGCATGAGAGGCAGGG + Intergenic
922549791 1:226485531-226485553 ACCCTACAACAGGAGAGGCCAGG - Intergenic
923769704 1:236927778-236927800 ACCTGCAAGCTGGAGAAGCAGGG + Intergenic
924672452 1:246143385-246143407 AAGTCAAAGCAGGACAGGCATGG + Intronic
1063112632 10:3049929-3049951 ACCTTAGAGCAGGAGCAGCAAGG + Intergenic
1063140376 10:3251402-3251424 ACCTCAAACCATGAGAGACATGG + Intergenic
1063154670 10:3368366-3368388 TCCTTAAATCCGAAGAGGCAAGG + Intergenic
1064206507 10:13328787-13328809 AGCTGGAAGCAGGTGAGGCAGGG - Intronic
1065101310 10:22335354-22335376 CCCTAAAACCAGGAGAGGAAGGG + Intergenic
1065842168 10:29711438-29711460 AACAAAAAGCAGGAGAGACATGG + Intronic
1068345297 10:55770069-55770091 ACCTGAAACTAGAAGAGGCAAGG + Intergenic
1068349872 10:55829488-55829510 TACTTAAAGCAGGCCAGGCACGG + Intergenic
1070571251 10:77640462-77640484 AGCTTCAATCAGCAGAGGCAGGG - Intergenic
1074046380 10:109843330-109843352 ACCTGAAGGCAGGAGACACAAGG - Intergenic
1074799349 10:116983574-116983596 ATCTTGAAGCAGGAGGGGCGAGG - Intronic
1075297007 10:121286427-121286449 ATCTTAAAACAAGAGAGGAATGG - Intergenic
1075298965 10:121303561-121303583 TCCTTAAAGCAGAACTGGCAAGG + Intergenic
1075663411 10:124214012-124214034 TCCATAAAGCAGGGGAGGCTGGG + Intergenic
1076527422 10:131120847-131120869 ACCTGCAAGCTGGAGAGGGAGGG - Intronic
1078417045 11:11174430-11174452 GCCTTAAATCAGGAGTGGCCGGG - Intergenic
1079454627 11:20625777-20625799 AGCTTAGAGGAGGAGAGGCAAGG - Intronic
1080415684 11:32067951-32067973 CCCTAAAAAAAGGAGAGGCAGGG + Intronic
1080522505 11:33079802-33079824 ACCTTAAAACAAGAGGGGCTGGG + Intronic
1080827462 11:35860228-35860250 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1081485317 11:43522732-43522754 ACTATAAAGCAGATGAGGCAGGG + Intergenic
1081500329 11:43660167-43660189 ACCCTCCAGCAGGAGAGGGAGGG - Intronic
1081722572 11:45301158-45301180 ACCTTAAAAAAGGAGATGCAAGG - Intergenic
1083288309 11:61675172-61675194 ACCTTATAGCAGGAGGGACAAGG + Intergenic
1084248899 11:67880606-67880628 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
1084602650 11:70155327-70155349 ACATGAAAGCAACAGAGGCATGG + Intronic
1084823917 11:71714864-71714886 TCCTTTAAGCAGGATAGCCAAGG + Intergenic
1084929874 11:72546543-72546565 ACCTAAATGCAGGAGAGCCTGGG - Intergenic
1084977592 11:72811255-72811277 AACTTAAATCAGGCCAGGCACGG - Intergenic
1085362763 11:75906636-75906658 ACCATAAAGCTGGCCAGGCACGG - Intronic
1089061855 11:115632255-115632277 ACCTTGGAGAAGGAGAGGAATGG + Intergenic
1089310101 11:117552271-117552293 AGGTCAAAGCAGGAGAGTCAAGG - Intronic
1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG + Intergenic
1091363022 11:134993244-134993266 ACCTGAAGTCAGGAGAGCCAAGG + Intergenic
1091979256 12:4852512-4852534 AGCTTAAAGCAAGGGAGACAAGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092419183 12:8316028-8316050 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG + Intronic
1096256218 12:50063789-50063811 ATCTTAAAGCAGGAGAGCCAGGG + Intronic
1097224057 12:57466611-57466633 ACATTAAAACAGGCCAGGCACGG + Intronic
1097519700 12:60651944-60651966 ACCTGAACACAGGAGAGGAAGGG + Intergenic
1098730792 12:74035299-74035321 ACATTAAATCAGGAGAGACCAGG - Intergenic
1098828242 12:75326989-75327011 TCCTGAAGGCAGAAGAGGCAAGG + Intronic
1099243323 12:80164241-80164263 ACCTTGAAGGAGAAGAGGAAAGG - Intergenic
1101505309 12:105340908-105340930 ACCAGAAGCCAGGAGAGGCATGG + Intronic
1101962781 12:109262336-109262358 CCCTTAAAAGAGAAGAGGCAGGG - Exonic
1102145003 12:110648459-110648481 GACTTGAAGCAGCAGAGGCAAGG + Intronic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1103094223 12:118119862-118119884 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1103480898 12:121249102-121249124 ATCTCACAGCAGGAGAGGCTTGG + Intronic
1104654667 12:130565041-130565063 ACCATAAAGCAGCAGGGGGAAGG + Intronic
1108003426 13:45925124-45925146 AATTTGAAGCAGGAGAGGCTTGG - Intergenic
1111255535 13:85662667-85662689 ACCTTTAAGCATGAGAGGTTTGG - Intergenic
1112245525 13:97729988-97730010 AACTGAAAGCAGGAGGGGAAAGG - Intergenic
1113138401 13:107118824-107118846 ACCTTAAAGTAAAAGAGGAAAGG + Intergenic
1113220063 13:108089956-108089978 ACAAGAAACCAGGAGAGGCAAGG + Intergenic
1114347224 14:21808739-21808761 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
1114439736 14:22736632-22736654 ACCTTAATGCAGGAGCTGAAGGG - Intergenic
1115272499 14:31569485-31569507 ACCTCAATGCAGGCCAGGCATGG - Intronic
1115886979 14:37983005-37983027 ACCTTAAATCAAGAGAGTCAAGG - Intronic
1117747103 14:58881035-58881057 ACCTTAAAGGAGCTGAGGGAGGG + Intergenic
1118406506 14:65429571-65429593 ACTTTAAAGCAGGCCAGGCATGG + Intronic
1118769222 14:68930552-68930574 ACCCTAAAGCAGGAGGGCCATGG + Intronic
1119187413 14:72652496-72652518 AAATTAAGGCAGGAGAAGCAGGG + Intronic
1119414436 14:74460124-74460146 AGCTTAAAGCCTGAGAGGAAAGG - Intergenic
1119780466 14:77273655-77273677 CCATTAAAGCAAGGGAGGCATGG - Intergenic
1120497600 14:85256096-85256118 ACCAGAAGCCAGGAGAGGCATGG + Intergenic
1120751449 14:88202428-88202450 TCCTCATAGCAGGAGAGGCTGGG - Intronic
1122423035 14:101589333-101589355 ATCTTTAAGCTGGAGGGGCATGG - Intergenic
1122616028 14:103018634-103018656 ACACCAAAGCAGGAGAGGCCAGG + Intronic
1122811113 14:104288557-104288579 ACATTAAAGTATGAGTGGCACGG + Intergenic
1124213479 15:27783954-27783976 GCCTTAAAGCAGGGGAGGAGAGG + Intronic
1125368939 15:38949277-38949299 AGCATAAAGCAGGCCAGGCACGG + Intergenic
1125494816 15:40182531-40182553 ACCCTTAAGCAGGACATGCATGG - Intronic
1126464020 15:48944206-48944228 ATCTTAAAGCATGAGAGCCTAGG + Intronic
1127459211 15:59182607-59182629 AGCTTACAGCAGGAGAGCTAAGG + Intronic
1127628713 15:60805395-60805417 ACCTTAATGTAGGAAATGCAGGG + Intronic
1129200265 15:73994531-73994553 ACGGTAAAGCGGGAGAGGTAGGG - Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1132520194 16:383754-383776 ACCTTGGAGGAGGAGAGGCGGGG + Intronic
1132974139 16:2703124-2703146 ACCTGAAAGCAAACGAGGCAGGG - Intronic
1133075763 16:3279784-3279806 ACCTAAAACCAGGAGTGGTAAGG + Intronic
1136515429 16:30765316-30765338 GCCTTAGAGCAGGTGGGGCAGGG + Exonic
1136737907 16:32479145-32479167 ACCTTAAAGCAAAACAGGGATGG - Intergenic
1137564053 16:49522241-49522263 ACCTCAAAGCGGGTGAGGCAGGG - Intronic
1138868882 16:60856556-60856578 ACTTGAAAGCAGGAGAAGCCAGG + Intergenic
1139740418 16:69030753-69030775 ACCTTAAAACAGGTGAGGGCCGG + Intronic
1140053014 16:71499496-71499518 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1140102839 16:71933275-71933297 ACCATAAAGCAGTAGAGCAAAGG + Intronic
1140725377 16:77807005-77807027 ACCTGAAAGAATGAGAGGGAGGG - Intronic
1141726573 16:85793241-85793263 ACCGTAAAGAAGGCGAGGCAGGG + Intronic
1141978077 16:87531481-87531503 ACCTTGTTGGAGGAGAGGCATGG + Intergenic
1203015166 16_KI270728v1_random:350432-350454 ACCTTAAAGCAAAACAGGGATGG + Intergenic
1203033501 16_KI270728v1_random:623590-623612 ACCTTAAAGCAAAACAGGGATGG + Intergenic
1143188634 17:5025167-5025189 ACATGAAAGCAGGGGAGGCCGGG - Exonic
1145871318 17:28276028-28276050 ACCTTAAGCCAGCAGAAGCAGGG - Intergenic
1145957688 17:28865821-28865843 AGCTTAAAGCTGCAGTGGCAGGG - Intergenic
1146728650 17:35175488-35175510 ACCTAAATGCAGGAGAGGGAAGG + Intronic
1148738062 17:49875867-49875889 GCCTGCAGGCAGGAGAGGCAAGG + Intergenic
1149088104 17:52744123-52744145 ACCTTGAAGCAGGGGAGTCAAGG + Intergenic
1149855872 17:60082145-60082167 ACTTTGAACCAGGAGAGGCTAGG + Intergenic
1152149644 17:78590959-78590981 ACCATAAAGCAGGGAAGGCTGGG - Intergenic
1152461413 17:80444287-80444309 GCCTCAAGACAGGAGAGGCACGG - Intergenic
1203161511 17_GL000205v2_random:56653-56675 ACTATAAAGCAGATGAGGCAGGG - Intergenic
1154488812 18:14903094-14903116 ACCTGAAGTCAGGAGAGCCAAGG - Intergenic
1155089647 18:22494129-22494151 CCCCAGAAGCAGGAGAGGCAGGG - Intergenic
1155606840 18:27615957-27615979 ACCCTTGAGCAGGAGAGGCCAGG - Intergenic
1157814322 18:50720009-50720031 CCCTTATTGCAAGAGAGGCAGGG + Intronic
1158138237 18:54228909-54228931 ACCTTAAAGCAGGAGCTTAAAGG - Intergenic
1158696835 18:59711057-59711079 ACATTAAAGCAGGCTAGGCATGG + Intergenic
1158775602 18:60575025-60575047 AGCTTTCAGCAGGAGAGGCATGG + Intergenic
1160582323 18:79891082-79891104 AACTTAAAGCAGGTGGGGGAAGG - Intronic
1161583708 19:5094043-5094065 CCCTGAAGCCAGGAGAGGCAGGG - Intronic
1161925388 19:7295192-7295214 ACCTTACTGCAGGAGAGGAAGGG + Intergenic
1162937243 19:13987334-13987356 ACCTTTAGGCAGGGCAGGCAGGG + Intronic
1163768435 19:19176527-19176549 ACCTAGAAGGAGGAGAGGTAGGG + Intronic
1164512448 19:28908685-28908707 ACAATAAAGCAGCAGAGGCTTGG - Intergenic
1164526569 19:29017460-29017482 AGGTTAATGCAGGAGGGGCAAGG + Intergenic
1167085534 19:47307228-47307250 ACCTGAAGGTGGGAGAGGCAAGG + Intronic
1167804576 19:51771904-51771926 ACCTTGAAACAGGAGAACCACGG + Intronic
1168669630 19:58230763-58230785 ACCTGAGAGGAGAAGAGGCAGGG + Intronic
926526610 2:13989686-13989708 ACCTTAGAGGAAGAGTGGCATGG - Intergenic
926743865 2:16134823-16134845 ACCTTTCAGCAGGATAGGGATGG + Intergenic
928604743 2:32935329-32935351 ACATTAAAACAGGCCAGGCACGG + Intergenic
930112071 2:47687197-47687219 ACCATACAGAAGGAGAGGCAGGG - Intergenic
930229500 2:48828348-48828370 AACTTACAGCAGCAGAGGAAGGG - Intergenic
930627160 2:53710743-53710765 AGCTTAAAGCAGGAAAGTCAAGG - Intronic
931579289 2:63755373-63755395 ATCTAATAGCAGGAGACGCAAGG + Intronic
933072870 2:77883348-77883370 GCATTAAAAAAGGAGAGGCATGG - Intergenic
938043627 2:128097084-128097106 ACCTTGTAGCAGGCCAGGCATGG + Intronic
938380064 2:130831599-130831621 ACCTGAACACAGGGGAGGCAGGG - Intergenic
938758311 2:134400805-134400827 GCCTTAAAGCAGGAGATGGGCGG - Intronic
939444816 2:142295337-142295359 ACCATCAAGCAGAAGAGTCAGGG + Intergenic
941993161 2:171576525-171576547 ACCTTAAGGCAGGAGCTGAAGGG + Intergenic
943720432 2:191198526-191198548 AGCTTATAGCACGTGAGGCAGGG - Intergenic
945557683 2:211299721-211299743 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
946705580 2:222455472-222455494 AACATAAAAAAGGAGAGGCAGGG + Intronic
946843631 2:223840265-223840287 ATATTAAAGCAGGAAAGGCCAGG + Intergenic
947728604 2:232416140-232416162 ACCTTAAACTATGAGGGGCATGG + Intergenic
1168951509 20:1805110-1805132 ACCTTTGAGTAGGAGAAGCAGGG + Intergenic
1169307583 20:4505741-4505763 ACCTAAAGGCAAGAGAGGCTGGG + Intergenic
1169945809 20:10986639-10986661 AGCTTGAAGTAGGAGAGGCGAGG + Intergenic
1169999449 20:11598146-11598168 ACCTTAAAGCAGGAAGTGAAAGG - Intergenic
1170864000 20:20137204-20137226 ACCTTAAGGCAGCACAGCCATGG + Intronic
1172215920 20:33235639-33235661 AAATTAGAGCAGGAGAGGAAAGG + Intergenic
1172475176 20:35231759-35231781 ACATTAAAGCAGGCCAGGCATGG + Intronic
1173737161 20:45370455-45370477 CCCTTAAAGGAGGACAGGAAAGG + Intronic
1174856299 20:54048533-54048555 ATCCAAAAGCAGGAGAGGAAAGG - Intronic
1175057473 20:56211333-56211355 ACCTTAAAGCAGGAGCCTAAAGG - Intergenic
1175577955 20:60076749-60076771 ACCGAAAACCAGAAGAGGCAAGG - Intergenic
1176070774 20:63225108-63225130 ACCAAAAAGCATGAGAGGCAGGG + Intergenic
1176341226 21:5697700-5697722 ACCATAAAGCAGATGAGGCAGGG + Intergenic
1176473480 21:7129853-7129875 ACCATAAAGCAGATGAGGCAGGG + Intergenic
1176503601 21:7626756-7626778 ACCATAAAGCAGATGAGGCAGGG - Intergenic
1177912092 21:27045397-27045419 AACTAAAAGCTGGAGAGGAAGGG + Intergenic
1178833873 21:36079631-36079653 ACCTTAAACCAGCAGAGAAAGGG - Intergenic
1180794376 22:18594922-18594944 AGCATAAGGCTGGAGAGGCAGGG - Intergenic
1181227364 22:21400398-21400420 AGCATAAGGCTGGAGAGGCAGGG + Intergenic
1181251286 22:21534441-21534463 AGCATAAGGCTGGAGAGGCAGGG - Intergenic
1181978990 22:26752769-26752791 TCCTTAAAGCAGGAGAGAGATGG - Intergenic
1183689540 22:39380914-39380936 TCTTGAAAGCAGGAGAGGCCAGG - Intronic
1183949649 22:41345765-41345787 ACCCCAACGCAGGTGAGGCAGGG - Intronic
1184448451 22:44568244-44568266 ACATTAAGGCAGCAGAAGCAGGG + Intergenic
1203240490 22_KI270733v1_random:12164-12186 ACCATAAAGCAGATGAGGCAGGG + Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
950211064 3:11123943-11123965 ACCTCACAGAAGGAGAGGCCAGG - Intergenic
951556303 3:23923983-23924005 ACCTAAATGCATGAGAGGCCAGG - Intronic
952105791 3:30067943-30067965 TCTTTCAAGCAGGAGAGGCTGGG + Intergenic
955447642 3:59031110-59031132 AACTTAAAGCTGGCCAGGCACGG - Intronic
956601482 3:71027382-71027404 ACCAGAAAGCAGGAGATGAAGGG + Intronic
957063168 3:75498774-75498796 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
958667836 3:97162710-97162732 ACCTTAAATGAGGGGAGGCTGGG - Intronic
960409048 3:117299360-117299382 ATCTCAGAGCAGGAGAGTCAAGG - Intergenic
961191757 3:124968181-124968203 ACCTGATAGCAGAAGAGGCCTGG - Exonic
961290233 3:125840803-125840825 CCCTTTAAGCAGGATAGCCAAGG + Intergenic
961299283 3:125911930-125911952 ACCAGAAGCCAGGAGAGGCAAGG - Intergenic
961896866 3:130175223-130175245 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
962241854 3:133756786-133756808 AGCTTAACACAGGAGAGCCATGG - Intronic
963456033 3:145549355-145549377 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
963489135 3:145976823-145976845 ACCTTACAGCAGGAGGGAAAAGG + Intergenic
964167135 3:153722070-153722092 TCCTTAAAACAGGTGAGGAAAGG - Intergenic
964874378 3:161349509-161349531 AACTAAAAACAGGAGATGCATGG - Intronic
966347602 3:178996791-178996813 GCCTTAAAGCAGGAGACTAAGGG + Intergenic
966503562 3:180673881-180673903 AACTTAAAGCAGGCAATGCAAGG + Intronic
966736469 3:183190765-183190787 ACCTCACAGCAGCAGAGACATGG + Intronic
967300063 3:188004043-188004065 ACAACAAAGCAGGAAAGGCAAGG - Intergenic
967578359 3:191124053-191124075 ATCTTAAAGGAGGATATGCATGG - Intergenic
967983512 3:195079207-195079229 ACCTTGGAGAAGGAGAGGGATGG + Intronic
969007053 4:4028781-4028803 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
969746559 4:9077283-9077305 CCCTTTAAGCAGGATAGCCAAGG + Intergenic
969805918 4:9608676-9608698 CCCTTTAAGCAGGATAGCCAAGG + Intergenic
970315668 4:14826400-14826422 ACTTTAAAGAAGGAGAGGCCAGG - Intergenic
970460200 4:16267200-16267222 ACCTTAAAGCAAGAGAAAAAGGG + Intergenic
971727126 4:30328171-30328193 GCCTTACAGCAGCAGAGGCAGGG + Intergenic
972137740 4:35913314-35913336 AACACAAAGCAGGAGAGGAATGG + Intergenic
972203741 4:36747360-36747382 ACCTTAACTCAGAAGGGGCAGGG - Intergenic
972444078 4:39127000-39127022 ACCTTAAAGCAGGAGTGTAAGGG - Intergenic
972810844 4:42584233-42584255 ACCATAAAGTAGGGGAAGCAGGG + Intronic
974833874 4:67222951-67222973 GCCTTAAAGCTGGAGGGCCACGG + Intergenic
975343095 4:73263113-73263135 ACCTAATTGCAAGAGAGGCATGG - Intergenic
979902967 4:126247000-126247022 ACCATGAAACAGGACAGGCATGG + Intergenic
980420701 4:132556483-132556505 AACTTAATGCAGGAGTGTCAGGG + Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
986160882 5:5227231-5227253 ACCTAAACGCAGTAGATGCAGGG - Intronic
986683999 5:10259896-10259918 ATGTTAAAGAATGAGAGGCAGGG + Intronic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
987853246 5:23384112-23384134 ACCTTAAAGCAGTAAAAGCAAGG - Intergenic
990217111 5:53547006-53547028 ACCTCACTGCAAGAGAGGCAGGG - Intergenic
990317319 5:54595523-54595545 AACTTAAAGCAGGCTAGGCGCGG - Intergenic
990374108 5:55152125-55152147 ACCAGAAACCAGAAGAGGCAAGG + Intronic
991022093 5:61990040-61990062 ACATTCAAGAAGGAAAGGCATGG - Intergenic
992275280 5:75110052-75110074 CCCTTAAGGAAGGAGAGGTAAGG - Intronic
994336816 5:98576691-98576713 ACCATAAAGCAGATGAGGCAGGG + Intergenic
995411118 5:111858284-111858306 ACCTTACTGCAGGGGAGGGAGGG - Intronic
997017819 5:129957710-129957732 TCCTGAAGGCATGAGAGGCAAGG - Intronic
997700313 5:135893319-135893341 TCCTTAATGCAGGCCAGGCATGG + Intronic
998728429 5:145045413-145045435 ACGTTTAAGCATGAAAGGCAAGG + Intergenic
998736353 5:145145586-145145608 GCCAAAAAGCAGGAGAGGGAAGG + Intergenic
1000784803 5:165529761-165529783 ACCTAATAGCAGGAGTAGCATGG - Intergenic
1001250115 5:170140643-170140665 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1002365504 5:178706552-178706574 TCCTGCAAGCAGGAGAGGGAGGG - Intergenic
1002994697 6:2271876-2271898 AGCTAAGAGCAGGAGAAGCAAGG - Intergenic
1004987711 6:21101577-21101599 AATTTAAAGCAGGACAGGGATGG - Intronic
1005685233 6:28247527-28247549 ATCTTCAAGCAGGACAGGAAAGG + Intronic
1006093047 6:31639472-31639494 ACCTTGAAGCAGAATAGGGATGG - Intronic
1007193771 6:40041514-40041536 CCTTTAAAGAAGTAGAGGCAGGG - Intergenic
1007902003 6:45421853-45421875 ACCTTGAAGCGCGAGAGACAGGG + Intronic
1013162713 6:107561234-107561256 ACATTACAGAAGGAGAAGCAAGG + Intronic
1013588580 6:111601194-111601216 ACCTTGAAGCTGAGGAGGCATGG + Intronic
1014084320 6:117325633-117325655 ACCTTAAATTAGGAAAGCCAAGG + Intronic
1014943274 6:127468381-127468403 ACCTTTAAGCAGGGAAGACATGG + Intronic
1015498011 6:133901053-133901075 ACCAGAAACCAGAAGAGGCAAGG + Intergenic
1016904267 6:149133300-149133322 TCCATAAAGCAGTAGAGGAAAGG + Intergenic
1018157247 6:160997092-160997114 AAATTAAAGCAGGAAAAGCAAGG - Intronic
1018762920 6:166906620-166906642 GCCTGAAAGCATGCGAGGCACGG - Intronic
1019046939 6:169156596-169156618 TCCTTGAAGCAGGAAAGGCATGG + Intergenic
1019163877 6:170086747-170086769 ACCCCGTAGCAGGAGAGGCAGGG + Intergenic
1019397922 7:833103-833125 AACTGAAAGCAGAAGGGGCAGGG - Intronic
1019835248 7:3377249-3377271 ATCTTAAAGCATGGGAGGGAAGG - Intronic
1020327553 7:6986897-6986919 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
1022846600 7:34216149-34216171 ACCTGCAAGCTGGAGAGCCAGGG + Intergenic
1022918371 7:34984888-34984910 ACCTTAAAGCAGGAGAATACTGG - Intronic
1023301136 7:38772862-38772884 ACCAAAAAGCAAGAGAGGGAAGG + Intronic
1024035284 7:45502980-45503002 ACCCTGGAGCAGGAGAGGCCAGG + Intergenic
1025007927 7:55369075-55369097 ACCAGAAACTAGGAGAGGCAAGG + Intronic
1026100304 7:67378731-67378753 ACCTCAAAGCTGCAGAGGCCTGG + Intergenic
1028951091 7:96635701-96635723 ACCTTTTAGAATGAGAGGCAAGG + Intronic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1030586680 7:111429358-111429380 ATCTTTCAGCAGAAGAGGCAAGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1031875152 7:127131076-127131098 ACCTTAGTGCAGGAGTTGCATGG + Intronic
1033203426 7:139394501-139394523 ACTTTAAAGAAGTGGAGGCAGGG + Intronic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1035121080 7:156567600-156567622 ACCTCACAGCAGGTGAGGCAGGG - Intergenic
1035672505 8:1430829-1430851 ACATTAAATCAGGAATGGCACGG + Intergenic
1036369062 8:8147198-8147220 CCCTTTAAGCAGGATAGCCAAGG + Intergenic
1036607772 8:10322794-10322816 AGATAAAAGCAGAAGAGGCAGGG + Intronic
1036881828 8:12518444-12518466 CCCTTTAAGCAGGATAGCCAAGG - Intergenic
1039258692 8:35747008-35747030 ACCTTTAAGTAGGGGAGGCAAGG - Intronic
1039354585 8:36801003-36801025 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1039391668 8:37185799-37185821 ACCCCAGAGCAGGAGAGGCCAGG - Intergenic
1041348391 8:56924577-56924599 ACCTTAAAGAAGGAAGGGGATGG + Intergenic
1043972718 8:86550121-86550143 ACCTTTAAGCAAGAGAGCAAAGG + Intronic
1045759132 8:105582882-105582904 AACTGAAAACAGGAGGGGCACGG - Intronic
1046345158 8:112914247-112914269 TCCCTAAAGCAACAGAGGCATGG - Intronic
1046890547 8:119416723-119416745 ACCTGAAGGCAGGCGAGACAAGG - Exonic
1047763141 8:127968903-127968925 ACCAGAAGCCAGGAGAGGCAAGG + Intergenic
1048925738 8:139269559-139269581 ACAGTAAAGCAGAAAAGGCATGG + Intergenic
1048965575 8:139612126-139612148 ACCTCAAAGCTGGAGAGCAACGG + Intronic
1050254170 9:3776836-3776858 ACCTGGAAGTAGGAGAGGGAGGG + Intergenic
1050336296 9:4593360-4593382 ACCATAAAGGAGGTGAGGCTGGG - Intronic
1050591258 9:7162756-7162778 ACTTTCAAGCAGGAGAGTTACGG - Intergenic
1050906193 9:11009740-11009762 ACCAGAAAGCAGGACAGGCATGG - Intergenic
1052626248 9:30980840-30980862 ACCTGGAAGCAGCAGAGGAAGGG - Intergenic
1052739128 9:32376360-32376382 TCCTTAAAGCAGTTGAGGCTGGG + Intergenic
1055038436 9:71843363-71843385 ACCATAAAGCAGAAGAGAAATGG - Intergenic
1055925321 9:81504412-81504434 AGCTAAAATCAGGTGAGGCAGGG - Intergenic
1056445821 9:86665497-86665519 TCCATAAAACAGGGGAGGCATGG + Intergenic
1058606385 9:106728022-106728044 GCCTTAAAGCAGGAGTCTCAGGG - Intergenic
1060392732 9:123291673-123291695 ACCTTAAAACAGGGAAGGCTCGG + Intergenic
1060547914 9:124471449-124471471 TCCTTGAAGAAGGAGAGCCAAGG + Intronic
1061440072 9:130595978-130596000 ACCTTAAAGAAAGAGAAGAATGG + Intronic
1061664963 9:132155273-132155295 TCCCAAAAGCAGGAGAGGAATGG + Intergenic
1062248960 9:135584585-135584607 ACCATGGAGCAGGAGAGCCAAGG - Intergenic
1203421841 Un_GL000195v1:293-315 ACCATAAAGCAGATGAGGCAGGG - Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186133851 X:6497790-6497812 TCCTTAAAGGTGGGGAGGCATGG - Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1188696024 X:33191712-33191734 ACCATAAAGCAGGCCAGGCATGG - Intronic
1189484724 X:41421297-41421319 ACCTCCAAGCAGGGCAGGCATGG + Intergenic
1189692880 X:43635324-43635346 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1189693462 X:43639857-43639879 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1193367112 X:80648127-80648149 ATCTTAAGGAAGGAGAGGAAGGG + Intergenic
1195156559 X:102128927-102128949 ACCTTAAAGTTTGAGAAGCAAGG + Intergenic
1196847181 X:119905562-119905584 ACCATAAATCAGGAGGGGAAAGG - Intronic
1197759758 X:130019731-130019753 ACCTTCTAGCAGGCGAGGCATGG + Intronic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199062445 X:143375479-143375501 ACATTGAAGCAGGAGAGAGAGGG + Intergenic
1199253145 X:145688248-145688270 ACTTAAAAGCAGTAGAGGCCGGG + Intergenic