ID: 949498351

View in Genome Browser
Species Human (GRCh38)
Location 3:4654918-4654940
Sequence CCCTTTTGTGCTCCTTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949498342_949498351 16 Left 949498342 3:4654879-4654901 CCTGCTGTGGGTTTGTGGATTTG 0: 1
1: 0
2: 2
3: 23
4: 191
Right 949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 147
949498341_949498351 20 Left 949498341 3:4654875-4654897 CCTTCCTGCTGTGGGTTTGTGGA 0: 1
1: 0
2: 1
3: 22
4: 239
Right 949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949498351 Original CRISPR CCCTTTTGTGCTCCTTACTG GGG Intronic
901502605 1:9662577-9662599 GCCTTTTGTGGTTCTTGCTGTGG + Intronic
902679440 1:18032712-18032734 CCCTTCTGTAATCCTTACTATGG + Intergenic
902807448 1:18869864-18869886 CCCTTCTGTGCTCCAGCCTGGGG + Intronic
903135159 1:21304452-21304474 CCCTTATCTCCTCCTCACTGTGG + Intronic
903472163 1:23594865-23594887 CCATGTTCTGCTTCTTACTGAGG - Intronic
904739143 1:32658795-32658817 GCCTTTTGTTCTTGTTACTGAGG + Intronic
905506297 1:38482212-38482234 CTCTTTTGAGCTCCTCCCTGTGG - Intergenic
906485711 1:46233214-46233236 CCCTTTAGTCCTTCTCACTGTGG + Intergenic
908018988 1:59880358-59880380 CCTTGTGGTGCTCCTTCCTGTGG - Intergenic
909950693 1:81716711-81716733 CCCTTTTATGCTCCTTTTGGTGG - Intronic
911345236 1:96688849-96688871 CCCCTATATGCTCCTTACAGGGG - Intergenic
912617690 1:111121989-111122011 CCTTTTTGTGCTCCTTAAATAGG - Intronic
1068323160 10:55446885-55446907 CACTTTTCTGCTTCTTACTGTGG - Intronic
1070073282 10:73110515-73110537 CTCTTTTGTGCTGATTCCTGAGG + Exonic
1070863996 10:79694951-79694973 TCCTCTTGTGCTCCTGTCTGGGG - Intergenic
1071630895 10:87217177-87217199 TCCTCTTGTGCTCCTGTCTGGGG - Intergenic
1071771220 10:88730823-88730845 CCCTTCTGAGCTACTTACTTGGG - Intronic
1072503715 10:96043818-96043840 GCCTTTTGTTCCCCTTTCTGAGG + Intronic
1073826039 10:107322651-107322673 CCCATTTGTGGTTATTACTGAGG + Intergenic
1075390791 10:122089928-122089950 CCCTTTTTTGCTACTGACTTAGG + Intronic
1075576370 10:123580591-123580613 CCGTCCTGTGCTCCTTACTGTGG + Intergenic
1076250997 10:128983757-128983779 CCCCTTTGTCCACCTTGCTGGGG + Intergenic
1076693520 10:132236165-132236187 CCTTTCTGTGCTCCTGACTGAGG - Intronic
1081336085 11:41869067-41869089 CCATTTAGTACTCCTTACTTCGG - Intergenic
1081897646 11:46600438-46600460 TCCCTTTGTGGTCCTTAGTGTGG - Intergenic
1085359648 11:75875787-75875809 CCCTTTTGTGGTCCTCAGTGTGG + Intronic
1085519435 11:77129498-77129520 GCCTTTTAAGCTCCTTCCTGAGG + Intronic
1087413298 11:97820329-97820351 TCCATTTATGCTCCTTACTTAGG - Intergenic
1092560482 12:9608125-9608147 CCCTTTTGTGTTCCTCTCTCAGG + Intergenic
1094050342 12:26213548-26213570 CCCTTTTGTTGTCCTTTCTCGGG + Intronic
1095195061 12:39304880-39304902 CCCTGTTATGTGCCTTACTGTGG - Exonic
1098446980 12:70576081-70576103 CCCTTATGAACTCCTTATTGAGG - Intronic
1099842929 12:87989457-87989479 CCCTTTTGTTCACCTTTCTTTGG + Intronic
1101951388 12:109178886-109178908 CCCCTTTCTCCTCGTTACTGTGG + Intronic
1103139819 12:118538776-118538798 CTCTTTTGTGCTAGGTACTGTGG + Intergenic
1103340829 12:120220360-120220382 CCCATTTGTCCACCTTACCGTGG - Intronic
1104750658 12:131236102-131236124 CCCCTCTGGGCTCCTCACTGAGG + Intergenic
1104782065 12:131428358-131428380 CCCCTCTGGGCTCCTCACTGAGG - Intergenic
1105627370 13:22125898-22125920 CCCTTTGCTGCTCTTCACTGTGG + Intergenic
1111496887 13:89062259-89062281 CCCCTTTCTGCTCCACACTGAGG - Intergenic
1113625150 13:111789498-111789520 CCCTCCTGTGCTCCTGAGTGAGG + Intergenic
1114371625 14:22095592-22095614 CTCTTTCTTCCTCCTTACTGAGG - Intergenic
1115033117 14:28822375-28822397 CCATTTTGAGCTCCTTTTTGTGG - Intergenic
1119099217 14:71864656-71864678 ACCTTTTGTACTCATGACTGCGG - Intergenic
1122842194 14:104471397-104471419 CACTTTTCTGCTCCTCCCTGTGG - Intergenic
1125695579 15:41634593-41634615 CCCTTTCCTTCCCCTTACTGAGG + Intronic
1125794678 15:42395466-42395488 CCTCTTTGTGATCCTTACTGTGG - Intronic
1126504956 15:49394263-49394285 CCCTTTTTTGCTCCTACCTAAGG - Intronic
1127972263 15:63970909-63970931 CCCTACTGTGCTCCAAACTGTGG - Intronic
1131109855 15:89758421-89758443 CCCCTTTGATCTCCTTATTGTGG + Intergenic
1131762882 15:95643168-95643190 CACTTTTGTGCTGCATACTGGGG - Intergenic
1131895138 15:97020016-97020038 GCCTTCTGTGCCCCTTTCTGGGG + Intergenic
1131946255 15:97625382-97625404 CCCTACTGTGCTCCTTCTTGAGG - Intergenic
1139446999 16:67004134-67004156 CCCTTTGGTGCTCCTGACCCAGG + Exonic
1141869980 16:86778679-86778701 CCCTTTTGTGCTCTTTATTTTGG + Intergenic
1144423465 17:15118873-15118895 TTCTTTTGTGCTCCCTACAGAGG - Intergenic
1146228342 17:31087259-31087281 TCCTTTTGTGCCCCTTCCTCTGG + Intergenic
1146862364 17:36314507-36314529 CCCTTTGGTGCTACTGTCTGAGG + Intronic
1147092692 17:38118606-38118628 CCCTTTGGTGCTACTGTCTGAGG + Intergenic
1147104516 17:38201885-38201907 CCCTTTGGTGCTACTGTCTGAGG - Intergenic
1147953379 17:44119375-44119397 CCCTTCTGAGCACCTTGCTGTGG - Intronic
1148424979 17:47586563-47586585 CCCTTTGGTGCTACTGTCTGAGG + Intronic
1152928609 17:83099108-83099130 CCCTTCTTTGCTCCTTTGTGCGG + Intergenic
1161930629 19:7337152-7337174 CCCTTTGGTTCTCCTTGCTGTGG + Intergenic
1164679222 19:30122695-30122717 ACCTTTTGAGCTCCTGGCTGAGG + Intergenic
1167374239 19:49102627-49102649 CCTTTCTGTCTTCCTTACTGTGG + Intronic
926004747 2:9365188-9365210 TCCTTTTGTGCTCTTTGCTTTGG + Intronic
927392011 2:22606399-22606421 CCCTTCTGTGGTGGTTACTGGGG - Intergenic
927542425 2:23925472-23925494 CCATTTTGTGGTTCTTATTGGGG - Intronic
930403118 2:50916673-50916695 CCTTTCTGTGCTCCTCTCTGAGG + Intronic
930619997 2:53633762-53633784 TGCTTTTGTGCTCTTTGCTGTGG - Intronic
931066292 2:58591415-58591437 CCCTCTTGTTCTTCTTTCTGGGG - Intergenic
931593960 2:63920001-63920023 ACCTTCTTTTCTCCTTACTGTGG - Intronic
935224995 2:101045650-101045672 TCCTTATGTGCTCCTTTATGAGG - Intronic
936656325 2:114491885-114491907 CCCTTTAGTGCTTTTTCCTGGGG + Intronic
937631652 2:124108861-124108883 CTCATGTGTGCTCCTTACAGGGG + Intronic
939672918 2:145035665-145035687 CTATTTTGTGCTCAATACTGTGG - Intergenic
940199476 2:151134473-151134495 TCCTTTTTTTCTGCTTACTGTGG - Intergenic
941050867 2:160732113-160732135 ACCTTTTGTCTTCCTTACTCTGG - Intergenic
948547780 2:238745188-238745210 CCCTGTTGGCCTCCCTACTGCGG + Intergenic
948949564 2:241240170-241240192 CCCTCTTGTCTTCCTCACTGTGG - Intronic
1173547578 20:43910752-43910774 GCCTTGTCTGCTCCTTCCTGCGG + Intergenic
1174916779 20:54661939-54661961 CTCTTTTGTGCTTCTTCATGTGG + Intergenic
1178615068 21:34125454-34125476 CTCTGTTGTGCTGCTGACTGTGG - Exonic
1178621958 21:34185133-34185155 CCCAGTGGTGCTCCTTTCTGAGG - Intergenic
1184339397 22:43877892-43877914 CCCTTTTCTGCTCCATAATGTGG + Intergenic
949117750 3:348579-348601 TCCTTTTTTCCTCCTTACTAAGG + Intronic
949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG + Intronic
950245763 3:11416727-11416749 CTCTTTTCTTCTGCTTACTGTGG + Intronic
951006423 3:17620924-17620946 CCTTTTTGTACTCATTCCTGTGG - Intronic
957120466 3:76084094-76084116 CACTTTTGTGCTCTTTCGTGAGG + Intronic
957959618 3:87232431-87232453 TCCTTTAGTGCTCCTTATTCTGG + Intronic
958131312 3:89428637-89428659 CTCTTTTGTGCCGCTTAGTGGGG - Intronic
958814939 3:98904082-98904104 CCTTCTTGTACTCCTTACTGTGG - Intergenic
960991998 3:123317983-123318005 CCCTCTTGGGCTCCTTCCTCTGG - Intronic
961034853 3:123635123-123635145 CCCTCCTGTTCTCCTTTCTGGGG - Intronic
962722288 3:138187378-138187400 CCCTTTTGCCCTTCTTTCTGCGG + Exonic
964104885 3:153028329-153028351 CCCATTTATGCTTCTGACTGTGG - Intergenic
965549224 3:169947337-169947359 TCTTTTTGTGCTCCTTTTTGGGG + Intergenic
965678827 3:171229766-171229788 CCTTTTTTTCCTCCTCACTGGGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
971694303 4:29878303-29878325 TCCATTTCTGCTCCTTTCTGTGG - Intergenic
978317435 4:107454592-107454614 GGGTTTTATGCTCCTTACTGTGG - Intergenic
980636436 4:135510680-135510702 CCCTTTTGTGCCCCACACCGTGG - Intergenic
981415856 4:144492649-144492671 CCCTTTTGTACTCCTGCCTTTGG - Intergenic
983575222 4:169254259-169254281 CTCTTTTCTGCTCATGACTGTGG - Intronic
985100563 4:186454185-186454207 CTCTTTTGGTCTCCTTCCTGTGG + Intronic
990394787 5:55366177-55366199 CCTTTTTGTCTTCCTAACTGTGG - Intronic
992330482 5:75712451-75712473 CCCTTGTGTTCTACTTGCTGAGG - Intronic
992640527 5:78764828-78764850 CCTTTTTGTCCTATTTACTGTGG - Intronic
995009571 5:107241853-107241875 CACTTTTAGGCTCCTTCCTGGGG - Intergenic
995038595 5:107563338-107563360 TCCTTTTGTGTTCCCTCCTGTGG + Intronic
996307093 5:122059807-122059829 CCCTAATGTGCTCCTTCCAGAGG + Intronic
997709370 5:135990859-135990881 CCCTTCTCTTCTCCTCACTGCGG - Intergenic
997778184 5:136630104-136630126 CCCCTATGTGCTCTGTACTGTGG - Intergenic
1001034142 5:168285148-168285170 CCCTTTTGTCCTCTCTTCTGGGG - Intergenic
1002561888 5:180088248-180088270 GCCTTCTGTGTTGCTTACTGTGG - Intergenic
1004020011 6:11768873-11768895 CCCTTTTGTGTGCCTTTCTTGGG - Intronic
1004913921 6:20313531-20313553 CCTCTGTGTTCTCCTTACTGTGG + Intergenic
1005685814 6:28252193-28252215 TCCTTTGGTGATACTTACTGTGG - Exonic
1007476883 6:42124903-42124925 CTCTTCTGTGCTCCTCACTCAGG - Intronic
1011471109 6:87708718-87708740 CTGTCTTGTGCTCCTTACTTAGG - Intergenic
1013174625 6:107666909-107666931 GCCTTTTGTGTTTCTAACTGGGG + Intergenic
1014689902 6:124550545-124550567 CCCTGGTGTGCTCGTTACTAGGG + Intronic
1017167290 6:151420984-151421006 ACCTACTGTGCTCCTTAATGTGG + Intronic
1023533994 7:41188536-41188558 CTCTTTTCTGCTCCCCACTGTGG + Intergenic
1027805886 7:82821774-82821796 CCCAATTGTGCTCCTCAGTGAGG + Intronic
1028816199 7:95148171-95148193 TTCTTTTGTTCTCCTTACTTTGG - Intronic
1032408092 7:131672259-131672281 CCCTTTTCTTCTCCCTACTATGG + Intergenic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1033066902 7:138164689-138164711 CTCTTTTGGGCCCCTTTCTGTGG - Intergenic
1036445381 8:8817607-8817629 CCCTCCTGTTCTCCTTGCTGTGG + Intronic
1036896082 8:12636554-12636576 CCCTTTGGTGCTCCCTTCGGTGG + Intergenic
1037638298 8:20720146-20720168 CCCTTGAGTGGTCCTTACTCTGG + Intergenic
1037787929 8:21913322-21913344 CCAAACTGTGCTCCTTACTGAGG - Intronic
1038179567 8:25213777-25213799 CAGTTTTATGCTTCTTACTGTGG + Intronic
1038193095 8:25341926-25341948 CCTTTTTGTGCTCAGTTCTGTGG + Intronic
1038634555 8:29275165-29275187 TCCTTTTGTGCTCACTAATGGGG - Intergenic
1038761748 8:30390968-30390990 CCCTTCTGTGCTCTGCACTGGGG + Intronic
1043233288 8:77830099-77830121 GCCTTTTGAGCTCCTTGGTGAGG + Intergenic
1043267789 8:78288123-78288145 CTCTTTTTTGCTTCTTAATGTGG - Intergenic
1049156165 8:141067945-141067967 CCGCTGTGTGCTCCTTCCTGGGG + Intergenic
1049332448 8:142062166-142062188 CGGTTTTGTGATCTTTACTGAGG + Intergenic
1051228417 9:14927561-14927583 GCCTTCTGTTTTCCTTACTGAGG + Intergenic
1052930117 9:34049075-34049097 CCCTTATTTGTTCCTTTCTGTGG - Intergenic
1054887766 9:70217356-70217378 CCTTTTTGTGCTTCCTTCTGTGG - Intronic
1055238951 9:74160373-74160395 CCTTTTTGTGCTCTTTCCTGAGG - Intergenic
1057447952 9:95131667-95131689 TCCTTTTGAGCTCTTTAATGTGG - Intronic
1059532350 9:115047322-115047344 ACCTTTTGTGCTACATACTGTGG + Intronic
1060658147 9:125387021-125387043 CCCTTTAGTGCCCCCTCCTGAGG - Intergenic
1061546489 9:131307816-131307838 CCCCTTTCTGCTCCTCACTCAGG - Intronic
1061753081 9:132794165-132794187 CCCTTTTCTGCTCTTTCCTAGGG - Intronic
1185566216 X:1097385-1097407 CCCATTTCTGCTTCTTGCTGGGG + Intergenic
1186144826 X:6614338-6614360 CACTTTTGTTCTCATTTCTGCGG - Intergenic
1187495915 X:19795551-19795573 TCCTTTTGTGCTAATTTCTGAGG + Intronic
1187576623 X:20563280-20563302 CCCCTTTGTGGTCCTGACTGAGG + Intergenic
1187939886 X:24371423-24371445 CCCTGCTGTGCTCCTTCCTGTGG + Intergenic
1188441822 X:30221015-30221037 CCGTTTTCTTCTCATTACTGCGG + Intergenic
1190498865 X:51055552-51055574 CCCATGTGTCCTCCTTACTGAGG + Intergenic
1194923413 X:99795566-99795588 CCCATTTGCGCTCCTCCCTGGGG + Intergenic
1195801214 X:108713076-108713098 CCCTTTTCTGCTCCCTCCAGTGG + Intergenic
1199702995 X:150399114-150399136 CCCATTTGTCCTCCATACTGTGG - Intronic
1201291060 Y:12421150-12421172 CCCGTCTGTCCTCCATACTGAGG + Intergenic
1202603115 Y:26614685-26614707 CCCTCTTCTGCACCCTACTGTGG - Intergenic