ID: 949500388

View in Genome Browser
Species Human (GRCh38)
Location 3:4674671-4674693
Sequence TTGTTAACTCAGAAGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949500388_949500390 22 Left 949500388 3:4674671-4674693 CCTTGTTACTTCTGAGTTAACAA 0: 1
1: 0
2: 2
3: 14
4: 185
Right 949500390 3:4674716-4674738 TTTTAAGAGCTGTATTGCTGAGG 0: 1
1: 1
2: 2
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949500388 Original CRISPR TTGTTAACTCAGAAGTAACA AGG (reversed) Intronic
902067149 1:13698188-13698210 ATGTTAAATCAGAAGTGGCACGG - Intergenic
902145045 1:14391634-14391656 GTGTTAACTGTGAACTAACAGGG - Intergenic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
907775949 1:57515186-57515208 TTTTTAACCCAGGACTAACAAGG - Intronic
907778451 1:57542047-57542069 TAGTTAACTCATTAGTAAAATGG - Intronic
908683772 1:66691479-66691501 TTGGTAACTCACAAGAAACTAGG - Intronic
909139189 1:71842103-71842125 TTGTTAGCTCAGAAGTCACATGG + Intronic
909299045 1:73987711-73987733 ATGTTAGATCAGAAGAAACATGG - Intergenic
909920208 1:81372324-81372346 TTTATATCTTAGAAGTAACATGG - Intronic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910117017 1:83742686-83742708 CTGATTACTCAGAAGTCACAAGG + Intergenic
911591152 1:99749656-99749678 TTCTTAATTCAGAAGTATCTGGG - Intronic
912140829 1:106724678-106724700 TTGCTAACTCAGAAGATAAATGG + Intergenic
913431541 1:118799004-118799026 TTGTTAACACAGAAATACAAAGG - Intergenic
916993443 1:170269597-170269619 TTGTAAAGTCAGAACTAAAAAGG - Intergenic
918792991 1:188855313-188855335 ATGTTAGCTAAGAAGTAACATGG - Intergenic
922733207 1:227964326-227964348 TTGATAACTGAGAAGTGAGAAGG - Intergenic
922852363 1:228744306-228744328 TTTTTAAATCATAAGTAACTGGG - Exonic
1063295125 10:4797496-4797518 ATGTTAAATCAGTAGAAACACGG - Intronic
1063860856 10:10306333-10306355 TTGTTACCACAGAAATAACTTGG + Intergenic
1066216696 10:33295262-33295284 TTGGGAACACAGGAGTAACATGG + Intronic
1066396011 10:35022454-35022476 ATGTTTAAGCAGAAGTAACAGGG + Intronic
1067932923 10:50581510-50581532 TTGTTTTCTCAGATGTAAAATGG + Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1077934964 11:6773866-6773888 TTGTGAGGTCAGAAGTAAGATGG + Intergenic
1081072262 11:38626466-38626488 TCTTTAACTCTGAAGTAAAAGGG - Intergenic
1084092541 11:66888122-66888144 TTGTTACCTTAGAAGGAAGAAGG - Intronic
1084337472 11:68468409-68468431 TTGTTTACTCAGAAGGGGCAGGG - Intronic
1085453412 11:76652202-76652224 TAGTTAACTCAGTAGAAAAATGG + Intergenic
1085484667 11:76851892-76851914 TTCTAAACTCAGAAGAAACTTGG - Intergenic
1087187773 11:95219782-95219804 TTGTTTACTCAGCATTAAAAAGG - Intronic
1087366872 11:97231240-97231262 TTGTTAACTGTAAAATAACAGGG - Intergenic
1088097969 11:106121761-106121783 GTGTTTACTCAGAAGTTCCAGGG - Intergenic
1090642439 11:128740961-128740983 TTGTTAACCCAGAGGGAAAAAGG + Intronic
1094054376 12:26254268-26254290 TTGTTAACAAACAAGTAAAATGG - Intronic
1095718983 12:45379921-45379943 TTCTCAAAGCAGAAGTAACAAGG - Intronic
1097551897 12:61083108-61083130 TTGGAAACTCACAAATAACAAGG + Intergenic
1098328549 12:69328129-69328151 TGGTTAACACAGGAGTTACACGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1106201458 13:27540901-27540923 TAGTTAAGTCTGAATTAACAGGG + Intergenic
1109732364 13:66430888-66430910 TTGTTAATTCCCAAGTCACAAGG + Intronic
1110388233 13:74939884-74939906 TTTTTAATTCATAAGAAACAAGG - Intergenic
1110424385 13:75349842-75349864 TTAATAAATCAGAAGTTACAGGG - Intronic
1112520139 13:100088092-100088114 TTGTAAACTCTCAAGTAAGAGGG + Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1114306317 14:21426460-21426482 TTGTGAACACAGTAATAACAAGG - Intronic
1114842880 14:26286544-26286566 TTGTTACCTTATAAGTAACTGGG - Intergenic
1119137199 14:72231954-72231976 TTTTGAACACAGAAGTGACAAGG + Intronic
1120160709 14:81141989-81142011 TGGTTAACTCATTTGTAACATGG - Intronic
1126080103 15:44952141-44952163 TTGTTAACTATGGAGTAAAAGGG - Intergenic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1127190346 15:56523905-56523927 TTGTTCACTCAGGAGTTAGAGGG + Intergenic
1130792029 15:87165515-87165537 CTGTTAACTCATAATTCACAGGG + Intergenic
1134268846 16:12716023-12716045 TTTTTAGCCAAGAAGTAACATGG + Intronic
1135702613 16:24645558-24645580 ATGTCAACTCAGTATTAACATGG + Intergenic
1137980233 16:53063207-53063229 CTGTTTGCTCAGTAGTAACATGG - Intronic
1140987332 16:80170780-80170802 TGCTCCACTCAGAAGTAACAGGG + Intergenic
1141015151 16:80441852-80441874 TTTTTAACTCCAAAGCAACAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1151663945 17:75534910-75534932 TTGTTAATTAAGTAGTAAAAGGG - Intronic
1153639823 18:7147283-7147305 TTATTAACTCACAATTAATAAGG + Intergenic
1155397162 18:25398502-25398524 TTGTTAACTCAAAGTTAGCAGGG - Intergenic
1156112201 18:33742244-33742266 TTGTAAACTCAGTTGTAAAATGG - Intronic
1156674755 18:39514207-39514229 TTGTTATCACAGAAGAAAAATGG + Intergenic
1157207214 18:45710793-45710815 TTGTTTGCACAGAAGTGACAGGG - Intergenic
1159067611 18:63587618-63587640 AGGTTAACTCAGAAATAAAATGG - Intronic
1159321494 18:66856783-66856805 TTTTTAACTCAGTATTTACATGG - Intergenic
1161833964 19:6632341-6632363 TTCTGAACTCAGAAGAAAAACGG + Intergenic
927152101 2:20202191-20202213 AACTTACCTCAGAAGTAACAAGG + Exonic
927814589 2:26203478-26203500 TTATTAATTCAGAGGTAAGATGG + Intronic
928177235 2:29042881-29042903 TTGTTATCACAGTCGTAACATGG - Intronic
932995429 2:76845695-76845717 TTTTTAACTCAAAAATAAAATGG + Intronic
935883852 2:107594491-107594513 TTGGTAACACAGAAATAACTTGG - Intergenic
936028155 2:109049606-109049628 TTGTTAAATCAGAAGAAAGAGGG - Intergenic
936737705 2:115466812-115466834 TTGTTTACTCACAGGTAAAATGG + Intronic
938230369 2:129654089-129654111 TTGTTACCTCAGAAGAAAAAAGG + Intergenic
938705272 2:133918843-133918865 TGGTTAACTCATTAGTAAAATGG - Intergenic
939420479 2:141962182-141962204 TAGTTCACTCTGAAGTAACAAGG + Intronic
939742036 2:145920011-145920033 TTGCAAACTCAGAAGGAAAAGGG + Intergenic
943311113 2:186325902-186325924 TTCTTAACTCTGAAGACACAGGG + Intergenic
944087002 2:195861007-195861029 TTGTTAAATCAGAACTTAAAAGG + Intronic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
946466934 2:219920311-219920333 TAGTTTTCTCATAAGTAACATGG + Intergenic
946695405 2:222352734-222352756 TTGTTAAAGGTGAAGTAACAGGG - Intergenic
947099879 2:226608492-226608514 TTGTCTTCTCAGAAGTAAAATGG + Intergenic
947354722 2:229280308-229280330 ATGTGAAATCAGAAGTAACTGGG - Intergenic
1169739596 20:8877602-8877624 TTGCAAACTCAGATGTTACAGGG - Intronic
1170341007 20:15327241-15327263 TTCTTATCTCAGAAGACACAAGG - Intronic
1170656931 20:18296173-18296195 TTGTAAACTTAGAACTAAAAGGG - Intronic
1173401226 20:42727772-42727794 TTTTAAACACAAAAGTAACAAGG - Intronic
1175208560 20:57330450-57330472 TGGTTTTCTCAGAATTAACAAGG + Intronic
1177660888 21:24082528-24082550 TTATAAACTCAGAATTAAAAAGG - Intergenic
1181716009 22:24729472-24729494 TTGCTTACTCAGCAGTAAAATGG - Intronic
1182977763 22:34639433-34639455 TTGTTCAATCAGAAGTGTCAAGG + Intergenic
1184316514 22:43697249-43697271 TTGTTAACTCTCAAGTCAAAGGG - Intronic
949243407 3:1896716-1896738 TAGTTTACTAAGAAGTAACCTGG + Intergenic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
950244278 3:11401171-11401193 TTGTTAAAACAGAAGTAGCTGGG - Intronic
952676451 3:36036907-36036929 ATGTTAACTGAAAAATAACAAGG - Intergenic
952837981 3:37620530-37620552 TTGTTTTCTCAGATGTAAAATGG - Intronic
953258982 3:41319335-41319357 TTGAGAACTCAGTAGAAACAAGG - Intronic
954981888 3:54753431-54753453 TTGTGAACTCTGAAGGTACATGG + Intronic
955191285 3:56763936-56763958 ATATTAACTAAGAAGAAACACGG + Intronic
957195592 3:77063087-77063109 TTTTTAGCTCAGAAGTAAACTGG + Intronic
960118653 3:113924519-113924541 TTGTTTACTCAGAAGTCATCAGG + Intronic
964444831 3:156747881-156747903 TTGTTAACTAGGAAGAAAAATGG + Intergenic
966323565 3:178729136-178729158 TTGTTAACCAAGAAGAGACAAGG + Intronic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
966635232 3:182125803-182125825 TTTGTAAATCACAAGTAACATGG - Intergenic
967777655 3:193401004-193401026 TTTTAAAACCAGAAGTAACAGGG + Intergenic
968467742 4:761037-761059 TTAATAACACAGAATTAACAGGG + Intronic
968571155 4:1341498-1341520 TGGATAACTCAGAAGGTACAAGG - Intergenic
970762213 4:19503986-19504008 GTGTTAACTCCAAATTAACAGGG - Intergenic
970769806 4:19597749-19597771 TCATTAACTCACAAGCAACAAGG - Intergenic
971264018 4:25082417-25082439 TTGTTAACTCCCCAGTACCAAGG + Intergenic
973649065 4:52979506-52979528 TCATTAATTCAGAAATAACAAGG + Intronic
974390015 4:61254275-61254297 TTGTAAACTCAGAAGCCTCATGG + Intronic
975264883 4:72351696-72351718 TTGTTAACTAAGCACAAACATGG + Intronic
977824544 4:101515322-101515344 TTGTTAACTGTGAATTCACAGGG + Intronic
977938571 4:102833634-102833656 TTCTTGACTCAAAAGTCACAAGG - Intronic
980638791 4:135544660-135544682 TTTTTTTCTCTGAAGTAACATGG + Intergenic
982568990 4:157025029-157025051 TTCTAAACTCAGAAGTATCATGG - Intergenic
983115631 4:163812583-163812605 TTGTAAATTCAGAAGAGACAGGG - Intronic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
983907576 4:173199919-173199941 TTGTTGATTCAAAAGGAACATGG - Intronic
983959722 4:173737828-173737850 TTTTTAACACTGAAGTAAAATGG - Intergenic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
987024224 5:13907970-13907992 ATGTTAGGTCAGAAGTAATATGG + Intronic
989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG + Intergenic
989567946 5:42919775-42919797 TTGTCAACTCAGAAGGCACAAGG - Intergenic
989568056 5:42920843-42920865 TTGTTAACAAAGAAATAACTTGG - Intergenic
990811360 5:59727726-59727748 TCTTTTACTCAGCAGTAACATGG + Intronic
991524220 5:67538396-67538418 ATGTGTACTCAGAAGTAAAAAGG + Intergenic
992587810 5:78259532-78259554 TTTGTAACTCAGAAGGAAAAAGG + Intronic
993684071 5:90916608-90916630 TTGTGAACGCTGAAGAAACAAGG - Intronic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
995897105 5:117027580-117027602 TTGCTAACTCAGCAGTTAAATGG + Intergenic
996644132 5:125794173-125794195 TTGTTTGCTCAAATGTAACAGGG + Intergenic
998542957 5:143000424-143000446 ATTTCAACTCAGAAGTAAAAAGG + Intronic
1000497279 5:162000526-162000548 TTGTTAACTCAGAATTTAAATGG - Intergenic
1001496898 5:172194742-172194764 TTGCCAACTCAGAATTGACACGG + Intronic
1004440949 6:15653288-15653310 TTTCTAGCTCAGAAGTATCAGGG - Intronic
1004922160 6:20385866-20385888 GTGTTAACTCTCAACTAACAAGG + Intergenic
1007087089 6:39156182-39156204 TTGTAAACTCCTAAGCAACAAGG + Intergenic
1009674736 6:66803721-66803743 TTGTTAAGTAAGTAGTAACTTGG - Intergenic
1009851179 6:69201194-69201216 GTGTTAGCTCAAGAGTAACAAGG - Intronic
1010640513 6:78320657-78320679 TTGTTTTATCAGAACTAACAAGG + Intergenic
1010685610 6:78851765-78851787 TTGTTCACTCAGAAATATCAGGG - Intergenic
1011482246 6:87806580-87806602 TTGTTAAAAGAGAAGGAACAGGG + Intergenic
1012269676 6:97193530-97193552 TTTATAACACAGTAGTAACAAGG + Intronic
1012321645 6:97854849-97854871 TTGTTAAGAAGGAAGTAACAAGG + Intergenic
1013182951 6:107733319-107733341 TTATTAACTCAGCAGTAGCTAGG + Intronic
1014334369 6:120114303-120114325 GTGAATACTCAGAAGTAACATGG + Intergenic
1014615486 6:123593043-123593065 ATGTTTAATTAGAAGTAACATGG - Intronic
1014784178 6:125599006-125599028 AGGTCAACTCACAAGTAACAGGG - Intergenic
1014807481 6:125846476-125846498 TTGTTTACTTAGAAGTCCCAGGG + Intronic
1016459690 6:144269443-144269465 TTGTTAACTATGAAGTAAACAGG + Intergenic
1017432441 6:154384352-154384374 TTGCTAACCTAGCAGTAACAAGG - Intronic
1018158836 6:161016996-161017018 TTATTAACATAGAAATAACAAGG - Intronic
1018279297 6:162167588-162167610 TTGTCAATTCTGAAATAACAGGG + Intronic
1022371652 7:29777182-29777204 TTGTGAAGACAGAACTAACAGGG + Intergenic
1024921094 7:54555356-54555378 TTAGGAACTCAGAAGAAACAAGG - Intronic
1026410648 7:70118476-70118498 TTGTTACCTTAGAAACAACAAGG + Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027593976 7:80149880-80149902 TTGTTAAATGAGAAGAAAAAAGG + Intronic
1029613789 7:101643775-101643797 TTTCTTTCTCAGAAGTAACATGG - Intergenic
1030495789 7:110298027-110298049 TTCTTATCTCTGAAGAAACAGGG + Intergenic
1031066530 7:117111546-117111568 TTGTGAACTAAGAAGTATTAGGG - Intronic
1031111584 7:117617038-117617060 TTTTTACTTCAGAAGTCACAAGG - Intronic
1037145275 8:15564267-15564289 ATGTTAACTCAAAAACAACATGG - Intronic
1037180286 8:15996696-15996718 TTGTTAACTCAGTAGTCAATAGG + Intergenic
1040698103 8:50027112-50027134 TTTTAAACACAGAAATAACATGG - Intronic
1041365362 8:57097045-57097067 TTATTAACTCAGAAGAAAACTGG - Intergenic
1042878424 8:73461504-73461526 TTGTAGAGTCATAAGTAACATGG + Intronic
1044517113 8:93152377-93152399 TTGTGAACTCAGATTTAACTAGG + Intronic
1046164937 8:110420246-110420268 TTTTCAACTCAAAAATAACAAGG + Intergenic
1047225002 8:122948756-122948778 TTGGTAACTCTGAAGAAAAATGG + Intronic
1047290109 8:123522508-123522530 TTGTCAACTCAAAAGTAACCAGG - Intronic
1048361544 8:133701340-133701362 CTGTAAACTCAGAAGTAAAGGGG - Intergenic
1048575155 8:135684336-135684358 TTGTTTTGTCAGCAGTAACATGG + Intergenic
1050540410 9:6664762-6664784 TTGTTACCTCAGAGGTCACAGGG - Intergenic
1051132470 9:13877628-13877650 TAAATAACTCAGAAGTACCAAGG + Intergenic
1051209452 9:14726344-14726366 TTTTTAACTCAGAAGAAAACAGG + Intergenic
1051762967 9:20489132-20489154 TTGTTAAGCCAGGAGAAACAAGG - Intronic
1052170589 9:25391209-25391231 TTATTCACTCAAAAATAACATGG + Intergenic
1058481819 9:105403666-105403688 GAGTTAACTCAGGAGTAGCAGGG + Intronic
1058601440 9:106674963-106674985 TACTTAGCTAAGAAGTAACAGGG - Intergenic
1059930990 9:119260719-119260741 TTCTTAACTCAGATGTGACCTGG - Intronic
1059989298 9:119849747-119849769 TTGGTAACTCAGAAAAAGCAAGG + Intergenic
1186117184 X:6317197-6317219 TTGTTATCACAGAAGACACATGG - Intergenic
1186233973 X:7486771-7486793 TTGTAAACTGAGAAATAACTGGG - Intergenic
1186526645 X:10255247-10255269 TCGTTATCTCAGAATTCACATGG - Intergenic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1194080519 X:89458036-89458058 TTCTAAATTCATAAGTAACATGG + Intergenic
1194707240 X:97190531-97190553 TTGCTAACTAAGGAGCAACATGG - Intronic
1195164654 X:102207256-102207278 TAGTTAACACAGAGGTAGCAAGG + Intergenic
1195194205 X:102479835-102479857 TAGTTAACACAGAGGTAGCAAGG - Intergenic
1197351009 X:125383153-125383175 TTCTTAACTCAGTAGTTACTTGG - Intergenic
1199161087 X:144612808-144612830 TTGTTGACCCTGTAGTAACATGG + Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1199937403 X:152588366-152588388 TTGTTACCTCCAAAGTAAAATGG - Intergenic
1200433194 Y:3114098-3114120 TTCTAAATTCATAAGTAACATGG + Intergenic