ID: 949502323

View in Genome Browser
Species Human (GRCh38)
Location 3:4692822-4692844
Sequence CATAAAAATAAGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 751}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949502323 Original CRISPR CATAAAAATAAGATGGAGGC AGG Intronic
900195992 1:1375684-1375706 AAAAAAAATAAGACGCAGGCTGG + Intergenic
900279121 1:1854487-1854509 CATAAAAAAAAGGTAGAGGAAGG + Intronic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902596377 1:17512409-17512431 CAAAAAAATTAAATGTAGGCTGG - Intergenic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
903167171 1:21528766-21528788 CATGAAAATATTATGGAGTCAGG + Intronic
903506501 1:23839399-23839421 AAAAAAAAAAAGCTGGAGGCCGG - Intergenic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
904175251 1:28623223-28623245 AATAAAAATAAACTAGAGGCTGG + Intronic
904503024 1:30928305-30928327 CATAAAAATTATTTTGAGGCTGG - Intergenic
904779814 1:32937413-32937435 CACTCAAATGAGATGGAGGCTGG + Intronic
905054952 1:35085341-35085363 AGTAAAAATAATATGGGGGCCGG - Intronic
905418298 1:37820067-37820089 AATAAAAACCACATGGAGGCGGG + Intronic
905432567 1:37935201-37935223 AAAAAAAAAAAGATGGAGTCTGG + Intronic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
905761899 1:40565808-40565830 CTTAAAAATAAAATGTAGGATGG + Intergenic
905833565 1:41095583-41095605 TATAAAAATATGCTGGAAGCAGG + Intronic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906308570 1:44737321-44737343 CATAAAAGTAAAATGTAGGCTGG + Intergenic
907579174 1:55556386-55556408 AAATAAAATAAGATGGAGCCTGG - Intergenic
907790588 1:57659677-57659699 AATGAAAAAAAGATGGGGGCTGG + Intronic
907997508 1:59647730-59647752 AAAAAAAAAAAGATGGTGGCAGG - Intronic
909015608 1:70376740-70376762 ATTAAAAATTAGATGGGGGCTGG - Intronic
909042476 1:70670576-70670598 ACTAAATATAAGTTGGAGGCAGG - Intergenic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
911010764 1:93278283-93278305 CATGAATATAAAATGCAGGCCGG - Intronic
911552693 1:99303493-99303515 CATAAAAATAAAAGGTAGCCAGG + Intronic
912128113 1:106565700-106565722 GATAAAAATAGGGTGTAGGCAGG + Intergenic
912171767 1:107108757-107108779 CATAAAGATAATAAGCAGGCCGG - Intergenic
912701429 1:111881215-111881237 GATTAAAAAAAGATGGAGGTGGG - Intronic
912853873 1:113149943-113149965 AAAAAAAACAAGGTGGAGGCCGG + Intergenic
912884444 1:113455087-113455109 TAAAAAAATAAGCTGGAGGAAGG + Intronic
913459183 1:119065347-119065369 CAAGAAAATAAAATGGAGGAGGG + Intronic
913685968 1:121232302-121232324 CTTAGAAAGAGGATGGAGGCAGG - Intronic
914037820 1:144019905-144019927 CTTAGAAAGAGGATGGAGGCAGG - Intergenic
914151634 1:145048027-145048049 CTTAGAAAGAGGATGGAGGCAGG + Intronic
914700769 1:150131210-150131232 CTTAAAAATAAAATTTAGGCTGG + Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
915098529 1:153481837-153481859 AATTAAAAAAATATGGAGGCTGG - Intergenic
915492656 1:156259825-156259847 CACAAAAATAAGTTGGGGCCAGG - Intronic
915812081 1:158923765-158923787 CATAATAACAAGATTGAGGAAGG + Intergenic
916807959 1:168278654-168278676 CGCAAAAATAAGAGGGAGGCAGG - Intergenic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
917689229 1:177450272-177450294 TTGAAAAATAAAATGGAGGCCGG - Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919451847 1:197781618-197781640 AATAAAGAGAAGATGGAGGTGGG + Intergenic
919567326 1:199205061-199205083 CATAAAAATATGCAGGAGACTGG + Intergenic
920360712 1:205414284-205414306 TAAAATAATAATATGGAGGCCGG + Intronic
920473291 1:206250859-206250881 CTTAGAAAGAGGATGGAGGCAGG - Intronic
921150473 1:212398232-212398254 ATTGAAAATAAAATGGAGGCAGG + Intronic
922665938 1:227469120-227469142 TATAGACATAAGATGGAGCCAGG - Intergenic
923195696 1:231664536-231664558 CATAAAGGAAAGAGGGAGGCAGG + Intronic
923881033 1:238104419-238104441 GATAAAAAGAAAATGGAGGCTGG - Intergenic
924068049 1:240246297-240246319 GATAAAAGTAGGATGTAGGCTGG + Intronic
924441173 1:244086670-244086692 CAAATAAATAAGATGAAGACAGG - Intergenic
924618906 1:245642577-245642599 AAAAAAAAAAAAATGGAGGCTGG + Intronic
924721018 1:246623118-246623140 TGTAAAAATAAAATGCAGGCTGG - Intronic
1062788657 10:286410-286432 CATAAAGATGAGATTGAGGTTGG - Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062941869 10:1428266-1428288 CATAAAAACATTTTGGAGGCAGG - Intronic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1063656988 10:8000411-8000433 CATAAAAAAAAGAAAAAGGCCGG - Intronic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1064008885 10:11719498-11719520 GATAAAAATAACATCTAGGCTGG - Intergenic
1064174584 10:13063334-13063356 CATAAAAATCAAATAGAGGATGG - Intronic
1064534426 10:16344052-16344074 CATAAGAATAAAAGGGAGTCTGG + Intergenic
1064647088 10:17470863-17470885 CATAAAACTAAGATCAAGGCCGG + Intergenic
1065905577 10:30248297-30248319 AATGAAAATAAGATGGAGATGGG + Intergenic
1066007554 10:31159458-31159480 CTTAAGAAAGAGATGGAGGCAGG + Intergenic
1066496117 10:35943817-35943839 CATCAAAATAAGTTGCAGGCCGG - Intergenic
1066695174 10:38070907-38070929 GATAAAAATAATATTGTGGCCGG + Intergenic
1066997325 10:42576283-42576305 GATAAAAATAATATTGTGGCCGG - Intronic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067302394 10:45023997-45024019 CATAGAAATAAAAATGAGGCCGG + Intergenic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1068112195 10:52692764-52692786 AATAAAAGTAAGATTAAGGCCGG - Intergenic
1068755014 10:60643066-60643088 ATTAAAAATAAGATGGAGCCAGG - Intronic
1068978481 10:63036085-63036107 TATAAAAATAAAAAGAAGGCAGG + Intergenic
1068997906 10:63228542-63228564 GATAAAAACAAGAAGCAGGCTGG + Intronic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069211179 10:65761600-65761622 CATGAGAACAAGATGTAGGCTGG + Intergenic
1069262831 10:66420502-66420524 ATTAAAAACAATATGGAGGCCGG + Intronic
1069476664 10:68739443-68739465 CATAAAAAAAAGAATGAGGCTGG - Intronic
1069523443 10:69145329-69145351 TATAAAAATAAAATTTAGGCCGG - Intronic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071182129 10:82998384-82998406 ATTAAGAATAAAATGGAGGCTGG - Intergenic
1071235906 10:83647691-83647713 CACAAAAACAGGATGTAGGCTGG + Intergenic
1071670304 10:87602931-87602953 CACAAAAGAAAGATGTAGGCTGG - Intergenic
1072005215 10:91239104-91239126 CCCAAAAATAAGATAGAGACAGG - Intronic
1072612159 10:97024967-97024989 CATAAAAAAAATATGGGTGCAGG + Intronic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073584910 10:104700596-104700618 CATCAGAATAAAATGGAGTCGGG + Intronic
1073961616 10:108937371-108937393 CATAAGATTATAATGGAGGCAGG + Intergenic
1074011888 10:109490596-109490618 CATAAAAGAAATGTGGAGGCCGG + Intergenic
1074213643 10:111362528-111362550 CTTAAAAATGAGATTGGGGCGGG - Intergenic
1074325253 10:112444916-112444938 ATTAAAAAAAAGATGGAGGTGGG - Intronic
1074439121 10:113459512-113459534 CCCAATAATAAAATGGAGGCAGG + Intergenic
1075165620 10:120065584-120065606 TATAAAAATGAGATGATGGCTGG - Intergenic
1075700533 10:124466751-124466773 CTTAAAAATGATATGCAGGCTGG - Intronic
1075891567 10:125955765-125955787 TTTAAAAATAAGATGGGGCCAGG - Intronic
1075970180 10:126645269-126645291 AAAAAAAAAAAGCTGGAGGCTGG + Intronic
1076147271 10:128133052-128133074 ATTAAAAGTGAGATGGAGGCTGG - Intergenic
1076265363 10:129105537-129105559 GAGAAAAATAAGATAGAGCCAGG + Intergenic
1076463509 10:130662397-130662419 CATAAGAAAAAGCTGAAGGCTGG - Intergenic
1076731832 10:132443033-132443055 TATAAAAATAAGTTGCAGGCCGG + Intergenic
1076768524 10:132650796-132650818 CATGAAAATAAGAGGGAGTCCGG + Intronic
1077965979 11:7134056-7134078 CTTAAAAAAAAAATAGAGGCAGG + Intergenic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078239471 11:9517184-9517206 ATTAAAAAAAAAATGGAGGCTGG - Intronic
1078310687 11:10238109-10238131 CAAAAATATAACATGGAGGCTGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078767182 11:14309779-14309801 CAGAAAATTAACAGGGAGGCAGG + Intronic
1079033763 11:17005232-17005254 CATCAAAAGAGAATGGAGGCTGG + Intronic
1079214490 11:18496165-18496187 CATAAAATTAAAATCCAGGCTGG + Intronic
1079832953 11:25293520-25293542 CATAAAAATAACTTGGATTCCGG + Intergenic
1081617009 11:44597076-44597098 CATAAAACAAAGAGGCAGGCTGG - Intronic
1082007192 11:47426046-47426068 CATAAAACCAGGATGGAGTCAGG + Intronic
1082042627 11:47698466-47698488 AATAAAAATAAGAATGTGGCTGG - Intronic
1082073757 11:47960725-47960747 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1082198532 11:49333359-49333381 AATTAAAATGAAATGGAGGCGGG - Intergenic
1082233047 11:49792564-49792586 AATAATCATAAGATGGAGGGAGG - Intergenic
1082690490 11:56296935-56296957 CAGAAAAAAAAGATTGATGCTGG + Intergenic
1082738805 11:56887601-56887623 CATTAAAATATGAGGGAGCCAGG + Intergenic
1082809846 11:57473238-57473260 CATAAAAATCAGATGCAGATGGG + Intronic
1083233923 11:61339969-61339991 AATAAAAAAAAGAGGAAGGCAGG - Intronic
1083489166 11:63002204-63002226 AATAAAAATAAAAAAGAGGCTGG - Intronic
1084055120 11:66626959-66626981 CACAAAAATAAAAGGGAGCCAGG - Exonic
1084346295 11:68551781-68551803 TATAAAAATAAAAAGGAGGCCGG - Intronic
1084392122 11:68884267-68884289 AATAAAATTAAGTTAGAGGCCGG - Intergenic
1084552598 11:69855140-69855162 CTTAAAAATATGATGCTGGCCGG + Intergenic
1086243198 11:84720693-84720715 CATAAAAATAAAAGGAAGCCAGG + Intronic
1086372197 11:86166165-86166187 TAAAAAAATAAGATGTTGGCAGG + Intergenic
1086512090 11:87569977-87569999 CAAAAAACTAACATTGAGGCTGG + Intergenic
1087558888 11:99758979-99759001 CAAAAGAATATGATGAAGGCTGG + Intronic
1088173657 11:107024766-107024788 AATAAAAATAAAATGTAGCCTGG + Intergenic
1088220132 11:107562002-107562024 GACAAAAATAAGATGGATGTGGG + Intronic
1088565725 11:111170660-111170682 AATAAAAGTAAAATGGAGGCTGG - Intergenic
1090169774 11:124590959-124590981 CATAAAAATTGAATAGAGGCTGG + Intergenic
1090336007 11:125965640-125965662 CCTAAAAATAAGAGTGAAGCAGG + Intronic
1090734207 11:129597245-129597267 CATAAAACTTAGAAGGGGGCTGG + Intergenic
1091549183 12:1524868-1524890 CATAAAGAGAAAATGGGGGCCGG - Intergenic
1091939941 12:4470146-4470168 CACAAACATCAGATGGAGGCTGG + Intergenic
1092439199 12:8483044-8483066 CATAAAGTTATGATGGAGCCAGG + Intergenic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1092909781 12:13136709-13136731 CATCAAAATAACCTGCAGGCAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094363684 12:29657807-29657829 CATAAAAACAAAATCTAGGCTGG + Intronic
1095423639 12:42051531-42051553 TATAAAAATATAATGGAGGCTGG + Intergenic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1095844071 12:46727382-46727404 CATAAGAGAAAGATGTAGGCTGG + Intergenic
1095936557 12:47689743-47689765 CATAAAACCAAGAAGCAGGCCGG + Intronic
1096152213 12:49321823-49321845 CACAAAAATTAGCTGGTGGCAGG + Intergenic
1096371508 12:51072915-51072937 CTTAAAAATAAATTGGGGGCGGG + Intronic
1096621245 12:52867005-52867027 AATAATAATAAAATCGAGGCCGG - Intergenic
1096757081 12:53808657-53808679 AACAAAAAAAAGAGGGAGGCTGG - Intergenic
1096824367 12:54263437-54263459 CAGAAAAACAAGAGGTAGGCCGG + Intronic
1097072770 12:56367447-56367469 CTTAAAAACAACATGGGGGCTGG + Intergenic
1097564335 12:61249859-61249881 CATAGGAAGAAGATGTAGGCTGG + Intergenic
1097907608 12:64936474-64936496 CAAGAAAATAATCTGGAGGCAGG - Intergenic
1098232091 12:68381731-68381753 CCTAAAAATAATTTGGGGGCAGG + Intergenic
1098516326 12:71380469-71380491 CATAAAAAGAAGAGAGAGGTTGG - Intronic
1098561651 12:71879479-71879501 CATAAAAATAAAATGCATACAGG - Intronic
1098912437 12:76222988-76223010 AATAAAAATATATTGGAGGCTGG + Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099339944 12:81417695-81417717 CATAAAAATAAAATGGAAATGGG - Intronic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1099915520 12:88887855-88887877 CTTAAAAATAAAAAGCAGGCCGG + Intergenic
1100474293 12:94921639-94921661 AATAAAAAACAAATGGAGGCAGG - Intronic
1100614980 12:96224029-96224051 AATACAAATGAGATGCAGGCAGG + Intronic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1100823349 12:98452528-98452550 CAATAAAATAAAATTGAGGCCGG - Intergenic
1100956355 12:99913648-99913670 TATAAAAATAAGATGATGACTGG - Intronic
1100973506 12:100096831-100096853 AATAAAAATAAGGCAGAGGCAGG + Intronic
1101534281 12:105603166-105603188 CATGAAAGAAAGATGTAGGCTGG + Intergenic
1101756365 12:107623661-107623683 TAGAAAAATAAGCTAGAGGCCGG - Intronic
1102080629 12:110095071-110095093 CTTAAAAAAAAAATAGAGGCCGG - Intergenic
1102153287 12:110703681-110703703 CAAAAAAAAAAGAGAGAGGCGGG - Intronic
1102344510 12:112150857-112150879 AATAATAATAAGTTTGAGGCTGG - Intronic
1102369763 12:112372727-112372749 AATAATAATAAGATGGATGTGGG - Intronic
1102666265 12:114576079-114576101 AATTAAAATAAAAGGGAGGCAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103033531 12:117637791-117637813 TGTAAAAATAAGACTGAGGCAGG - Intronic
1103662613 12:122533396-122533418 TAAAAAGATAAGAAGGAGGCTGG + Intronic
1103822746 12:123711889-123711911 CAAAAAAATTAGCTGGACGCGGG + Intergenic
1104160259 12:126172275-126172297 ATTAAAACTAAGATGGAGACTGG + Intergenic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1105003929 12:132709534-132709556 AATAAAAATAAAAGGAAGGCCGG - Intergenic
1105242894 13:18623239-18623261 TGTAAAAATAAAATGTAGGCTGG + Intergenic
1105740504 13:23318015-23318037 CATGACAAAAAGATGTAGGCTGG - Intronic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106086373 13:26545898-26545920 TTTAAAAATAAAATAGAGGCTGG - Intergenic
1106408476 13:29494736-29494758 CTTAAAAATAAAATGGAAGTAGG + Intronic
1106851494 13:33797874-33797896 CATATAAATAAGGTGAAGTCAGG + Intergenic
1106916362 13:34519485-34519507 CATAGAAATAAGATGATGACAGG - Intergenic
1107628537 13:42317172-42317194 AATAAAAATAAAAATGAGGCTGG - Intronic
1107766643 13:43742473-43742495 TAGACAAATAAGATGGAGGAAGG - Intronic
1108068390 13:46602656-46602678 ATTTAAAATAAAATGGAGGCTGG + Intronic
1108241101 13:48465501-48465523 CATAATAAGAATATGGGGGCGGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108742169 13:53349573-53349595 CAGAAAAATAACATGGAAGGAGG - Intergenic
1109841848 13:67927478-67927500 CATAACAATAAGAATGATGCAGG + Intergenic
1110144849 13:72178187-72178209 CATAAAAGAAAGCTGGGGGCTGG - Intergenic
1110614000 13:77521165-77521187 CTGAAAAACAAGATGGATGCTGG - Intergenic
1110652506 13:77958668-77958690 CATTAAAATAACCTGGGGGCTGG - Intergenic
1110748733 13:79087605-79087627 CAAAAAAAAAAAATGGAAGCAGG + Intergenic
1111252130 13:85615418-85615440 AAAAAAAAGAAGATGGAGGAAGG - Intergenic
1111449871 13:88400911-88400933 TATAAAAAGAAGATTCAGGCTGG - Intergenic
1112142501 13:96660957-96660979 CACAAAAGAAAGATGAAGGCTGG - Intronic
1112283518 13:98083536-98083558 CATAAAAGTAATGTGTAGGCTGG - Intergenic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1112617229 13:101018142-101018164 CAAGAAAATAATTTGGAGGCAGG - Intergenic
1113042432 13:106119651-106119673 CCTAAAAAAAGGATGGTGGCAGG - Intergenic
1113156868 13:107333140-107333162 CATAAAACAAGGATGTAGGCCGG - Intronic
1113465694 13:110511492-110511514 AATAAAATTAAGATGTAGGCTGG - Intronic
1113929802 13:113962105-113962127 ATTAAAAAAGAGATGGAGGCTGG + Intergenic
1114000407 14:18234784-18234806 CATAAAAACTAGATAGAAGCAGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1117374327 14:55107175-55107197 CATAAAAATACCAAGGAGGCCGG - Intergenic
1117388365 14:55239159-55239181 CATAAAAAGGAGATCCAGGCCGG - Intergenic
1117593457 14:57301039-57301061 CATAAAAAATAGATTGAGGGTGG - Intergenic
1117615616 14:57531039-57531061 CATCAAAATCAGATGTAGCCAGG - Intergenic
1118413348 14:65505606-65505628 AATAAAACTGAGATGTAGGCCGG - Intronic
1118434341 14:65755815-65755837 CATAGGAATAAGATGGAAGAGGG - Intergenic
1118641470 14:67796653-67796675 ACTAAAAATAAAAGGGAGGCCGG + Intronic
1119097045 14:71842696-71842718 CATCAAAAAAAGCTGGAGGCCGG - Intergenic
1119315640 14:73692183-73692205 CTTAAGAATAAAATAGAGGCCGG + Intronic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1120021921 14:79540692-79540714 CATGTAAATAAGATTGAGGGAGG + Intronic
1120156389 14:81098006-81098028 CATAAAGTTAAGATGGAAGGAGG - Intronic
1120555697 14:85928029-85928051 CACAAAAGAAAGATGCAGGCTGG + Intergenic
1121089679 14:91172373-91172395 TATGAAAATAAAATTGAGGCTGG - Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121172293 14:91864766-91864788 AAAAAAAAAAAGATGAAGGCAGG - Intronic
1121426833 14:93858435-93858457 CTTAGAAATAAGAGAGAGGCAGG - Intergenic
1122488003 14:102094644-102094666 ATTAAAAAGAAAATGGAGGCTGG + Intronic
1122681282 14:103465262-103465284 GATAATAATAATATGGGGGCTGG - Intronic
1122749575 14:103922663-103922685 AATAAAAATTGGATGGAGGCTGG + Intronic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123488404 15:20761365-20761387 TGTAAAAATAAAATGTAGGCTGG - Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123544901 15:21330438-21330460 TGTAAAAATAAAATGTAGGCTGG - Intergenic
1123963255 15:25429550-25429572 AATAAAAATATGATACAGGCTGG + Intronic
1123977528 15:25567347-25567369 CTTAAAAATAAAATGAAGCCAGG - Intergenic
1124633715 15:31352011-31352033 CAAAAAAAAAAAAGGGAGGCGGG + Intronic
1125770900 15:42165170-42165192 CTTAAAAATGTGAGGGAGGCTGG - Intronic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1126404998 15:48314536-48314558 CATAAAAAAAAGAGTGAGGCTGG - Intergenic
1126586101 15:50289034-50289056 CTTAAAAAGAAGTTGGAGCCTGG - Intronic
1126652651 15:50940016-50940038 TATAAAAATAGGCTGAAGGCTGG + Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127399671 15:58573337-58573359 ATTAAAAATAAAATGCAGGCTGG - Intergenic
1127683963 15:61323671-61323693 CATAAAAATACTCTTGAGGCTGG - Intergenic
1127782425 15:62328931-62328953 CATAAAAATAATCTGTAGGCCGG - Intergenic
1128000625 15:64188080-64188102 CATAAAAATAACATCAAGGTAGG - Intronic
1128143386 15:65317798-65317820 AATAAAAATACGATACAGGCCGG + Intergenic
1129161325 15:73749569-73749591 ATCTAAAATAAGATGGAGGCAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129571647 15:76692390-76692412 TAGAAAAATAACATGAAGGCTGG + Intronic
1130358953 15:83162458-83162480 TACAAAAATAAAATGGGGGCGGG + Intronic
1130557251 15:84931251-84931273 AATAAAAATAAAAAGGAGGAGGG - Intronic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1131297813 15:91167407-91167429 TATAAAATTAAGATGTTGGCAGG + Intronic
1131479757 15:92770696-92770718 TATAAAAAGAAGCTTGAGGCTGG - Intronic
1131777634 15:95819597-95819619 TATAAACATGAGATGGTGGCCGG + Intergenic
1131901056 15:97088472-97088494 AAGAAAAACAAGAGGGAGGCAGG - Intergenic
1132195440 15:99911201-99911223 AAAAAAAATAAGCTGAAGGCTGG - Intergenic
1132344218 15:101098374-101098396 AATAATTAAAAGATGGAGGCCGG + Intergenic
1202953246 15_KI270727v1_random:57709-57731 TGTAAAAATAAAATGTAGGCTGG - Intergenic
1132889913 16:2198619-2198641 AATAAAAATAAGATAGCTGCTGG + Intergenic
1133425589 16:5686097-5686119 GATGAAAAGAAGATGGAGACTGG + Intergenic
1133569145 16:7024617-7024639 CATCAAACAAAGATGGTGGCAGG - Intronic
1133631438 16:7625793-7625815 AATAAAATTAAAATGGAGGATGG - Intronic
1133741107 16:8652160-8652182 GATAAAAGTGAGATGTAGGCCGG + Intergenic
1134285837 16:12861486-12861508 CTTAAAAATTAAATTGAGGCTGG + Intergenic
1135037123 16:19087499-19087521 AATAAAAATGAGATGGGCGCCGG - Intergenic
1135342435 16:21660690-21660712 AATAAAAACAAGATGGAGGCTGG - Intergenic
1135479391 16:22809734-22809756 CACAAAATTAAGAAGAAGGCTGG - Intergenic
1135523937 16:23199016-23199038 CTTAAAAAAAAAATAGAGGCAGG - Intronic
1135824791 16:25717052-25717074 CTTAAAAAAAAAAGGGAGGCAGG + Intronic
1135906042 16:26512719-26512741 GAAAAAAATAAGAGGTAGGCAGG + Intergenic
1137273112 16:46916048-46916070 CATAAAAATAAGAGCCGGGCCGG + Intronic
1137345678 16:47656697-47656719 AGTAAAAAAAAAATGGAGGCTGG - Intronic
1137409917 16:48219682-48219704 TTTAAAAATAAAATGTAGGCTGG + Intronic
1137654458 16:50148110-50148132 CATAAAAATACATTGTAGGCCGG - Intergenic
1137792694 16:51187937-51187959 AAAAAAAAAAAAATGGAGGCTGG - Intergenic
1138813988 16:60183167-60183189 GATAAAAATTAGATCCAGGCTGG - Intergenic
1139164055 16:64545413-64545435 CATTAAAATAAGAAGATGGCTGG + Intergenic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1140014572 16:71169127-71169149 CATACAAAGAAAATGTAGGCTGG + Intronic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141396425 16:83709055-83709077 TAAAAAATTAAAATGGAGGCAGG + Intronic
1141505674 16:84476656-84476678 CATAAAGACAAGAGGGAGGCAGG + Exonic
1142312974 16:89324641-89324663 CATGGAAGAAAGATGGAGGCTGG - Intronic
1142736040 17:1900449-1900471 CCTAAAATAAACATGGAGGCCGG - Intergenic
1143196071 17:5077416-5077438 AACAAAAACAAGCTGGAGGCCGG + Intergenic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1144201675 17:12947615-12947637 CATAAAAACTAGGTGGAGGAGGG - Intronic
1144480516 17:15625245-15625267 AATAAAAATAAGATAGATTCTGG + Intronic
1144615355 17:16766443-16766465 TATAAAAAGCAGATGTAGGCCGG + Intronic
1144897346 17:18549219-18549241 TATAAAAAGCAGATGTAGGCCGG - Intergenic
1144917794 17:18738500-18738522 AATAAAAATAAGATAGATTCTGG - Intergenic
1144929517 17:18848100-18848122 AATAAAAATAAAATACAGGCCGG - Intronic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1145135026 17:20396502-20396524 TATAAAAAGCAGATGTAGGCCGG + Intergenic
1146174712 17:30658415-30658437 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146348172 17:32074426-32074448 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1147124432 17:38356367-38356389 CCCAAAAAAAAGATGGAGTCTGG - Intronic
1147385451 17:40078716-40078738 AAAAAAAAAAAGATGAAGGCTGG - Intronic
1147711627 17:42471122-42471144 CAAAAAAAAAAAATGTAGGCTGG + Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1148567932 17:48644806-48644828 AAAAAAAAGAAGTTGGAGGCAGG + Intergenic
1148646259 17:49221172-49221194 CAAAAAAATAAAATAAAGGCCGG + Intronic
1148930374 17:51122251-51122273 CATAAAAACAATATGAAGGTTGG + Intergenic
1149505854 17:57193402-57193424 AATAAAAATAAAAAGGAGCCAGG + Intergenic
1149759764 17:59218824-59218846 CATAAAAATTATTTTGAGGCTGG - Intergenic
1149805073 17:59609529-59609551 CATAAGAATAAAATGGATTCAGG - Intergenic
1150051481 17:61968619-61968641 CATTTAAATAAAAAGGAGGCCGG - Intronic
1150645774 17:66976616-66976638 GATAGAAAGAAGATGAAGGCAGG - Intronic
1150689855 17:67355829-67355851 CTCAAAAATAAGTTGGAAGCCGG + Intronic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1151462800 17:74264793-74264815 CATCAAAATTAGTTGCAGGCTGG - Intergenic
1151760549 17:76099801-76099823 CACAAAAATATGATGAAGGCAGG + Intronic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1152839364 17:82556997-82557019 AATAAAAATAAAAGAGAGGCTGG - Intronic
1153085095 18:1276381-1276403 TATAAGGAGAAGATGGAGGCAGG - Intergenic
1153308008 18:3650557-3650579 TATAAAAATGACGTGGAGGCTGG - Intronic
1154242868 18:12668293-12668315 CAAAAAAAGTGGATGGAGGCTGG + Intronic
1154446041 18:14436638-14436660 TGTAAAAATAAAATGTAGGCTGG - Intergenic
1155636940 18:27967212-27967234 CATAAAAATCTGATGATGGCAGG + Intronic
1155934136 18:31737856-31737878 AATAAAAATAAGATTCTGGCTGG - Intergenic
1156084041 18:33377738-33377760 GACAAAAATGAGATGGATGCAGG + Intronic
1156573306 18:38282942-38282964 CATAGGAGAAAGATGGAGGCTGG - Intergenic
1156789978 18:40959805-40959827 CATAAAAGTAAGAGTGAAGCAGG - Intergenic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1157732235 18:50014109-50014131 CATAAAAATGACATTGAGGTGGG + Intronic
1157830352 18:50851703-50851725 AATGAAAATAAGATCTAGGCTGG - Intergenic
1157943735 18:51956151-51956173 AAAAAAAAAAAGGTGGAGGCAGG + Intergenic
1157978383 18:52352301-52352323 CACAACAATAAAATTGAGGCAGG - Intronic
1158347777 18:56533174-56533196 TAAAAAAATAAGTTTGAGGCTGG + Intergenic
1158454281 18:57592740-57592762 CTTAAAGATAAGAAGCAGGCTGG + Intergenic
1159077705 18:63700313-63700335 CATAATGATAGGTTGGAGGCTGG + Intronic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1159951210 18:74485528-74485550 AATAAAAACATCATGGAGGCCGG - Intergenic
1160742344 19:692711-692733 CATAATATTAAGTTGGGGGCTGG - Intronic
1161222705 19:3125241-3125263 CAAAAAATTAAAATAGAGGCCGG - Intergenic
1161506112 19:4644561-4644583 AATAAAAATAAAATGGACACCGG + Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161701251 19:5796931-5796953 AAAAAAAAAAAGTTGGAGGCTGG + Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161757753 19:6146799-6146821 AAAAAAAATAAGATGGGGCCAGG + Intronic
1162273548 19:9635617-9635639 GGTAAGAACAAGATGGAGGCTGG + Intronic
1162601115 19:11669916-11669938 TATAAAATTATGATGAAGGCCGG - Intergenic
1163172742 19:15543867-15543889 AAAAAAAAAAAGATGGGGGCGGG + Intronic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1163476303 19:17527988-17528010 ACTAAAAATAAGATGCAGGCTGG - Intronic
1164001538 19:21104909-21104931 TATAAAAATAAAAATGAGGCCGG - Intronic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1164848473 19:31457535-31457557 TATAAAAAGATAATGGAGGCAGG - Intergenic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
1165401919 19:35606512-35606534 AATAAAAATAACAAGGAGGGTGG - Intergenic
1165561173 19:36681295-36681317 AATTAAAATAATATGGAGACAGG - Intergenic
1165575914 19:36817661-36817683 CAAAAAAAAAAAATAGAGGCAGG + Exonic
1165582563 19:36880491-36880513 CTTAAAAATAAAATGCAGGCAGG + Intronic
1165706122 19:37977464-37977486 AATAAAAATAATAATGAGGCCGG - Intronic
1165891874 19:39117503-39117525 TAAAAATATAAGATGCAGGCCGG - Intergenic
1166011830 19:39948492-39948514 CAAACAAATAAAATGGAGCCCGG - Intergenic
1166372118 19:42307736-42307758 AAAAAAAAAAAGATGGAGGGTGG - Intronic
1166394590 19:42429622-42429644 CATAAAAATTAAATGTTGGCTGG - Intronic
1166841432 19:45699500-45699522 AATAAAAATAAAATAAAGGCTGG + Intronic
1168020845 19:53607549-53607571 AATAAAAATAAGTTTTAGGCTGG + Intergenic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
1168426187 19:56240868-56240890 CAAAAAAATAAAATGTAGCCGGG - Intronic
925555315 2:5124435-5124457 CCTAAAAATAAAATTGAAGCTGG - Intergenic
925806656 2:7657771-7657793 CATAGGAGAAAGATGGAGGCTGG - Intergenic
925955855 2:8963237-8963259 CAAAAAAAAAAAATTGAGGCGGG + Intronic
926137856 2:10349409-10349431 CATAAAAATGATATAGACGCCGG + Intronic
926206464 2:10837441-10837463 GAAAAAAATAAGATGAAGCCAGG + Intronic
926463324 2:13161020-13161042 CTCAAAAATTAGATGCAGGCAGG - Intergenic
926569648 2:14515697-14515719 AACAAAAATAACATGGAGCCAGG + Intergenic
926847310 2:17156017-17156039 AATATAAATAAGAAGGAGGAAGG - Intergenic
928053421 2:28025698-28025720 CATCATAACAACATGGAGGCTGG - Intronic
928150944 2:28828281-28828303 CATAAACACAAGATGAGGGCCGG - Intronic
928546902 2:32336847-32336869 AATAAAAATAAAAAGTAGGCTGG + Intergenic
928573598 2:32632105-32632127 AAAAAAAATTAAATGGAGGCTGG - Intronic
928976679 2:37094643-37094665 AATCAAAAGAAAATGGAGGCCGG + Intronic
929078637 2:38099487-38099509 GATAAAAATAAGATGGGGAGGGG - Intronic
929388001 2:41434208-41434230 CATAGAAAGAAGATGTAGGCAGG + Intergenic
929472303 2:42206508-42206530 CATAAAAACTAAATGCAGGCTGG - Intronic
930016765 2:46976023-46976045 AAAAAGAATAAAATGGAGGCTGG - Intronic
930062398 2:47301029-47301051 CATAAAAATCAGATGGAATTTGG + Intergenic
930536297 2:52649677-52649699 CATGAAAGAAAGATGTAGGCTGG + Intergenic
930779443 2:55209167-55209189 CATCAAAATAAAGAGGAGGCCGG - Intronic
931046851 2:58363489-58363511 TATAAAAATAAAATCTAGGCTGG + Intergenic
931400845 2:61929992-61930014 CATAAACCTAAGATGGGGGGAGG + Intronic
931588233 2:63852358-63852380 CATACAAATCACTTGGAGGCTGG - Intronic
932007649 2:67943303-67943325 CATATACAGAAGATTGAGGCTGG + Intergenic
933082264 2:78005596-78005618 AAAAAAAAAAAGATGGGGGCTGG - Intergenic
933191061 2:79334611-79334633 AATAAAAAAAGGATGGAGGGAGG + Intronic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934122067 2:88849816-88849838 CAAAATAATAATATTGAGGCCGG - Intergenic
934546128 2:95218024-95218046 CAACAAAATAAAATGAAGGCAGG - Intronic
935503737 2:103873238-103873260 CCTAAAACAAAGATGGAGCCAGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
935977858 2:108596828-108596850 AATAAAAATAAAAAGGAGGGGGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
937621315 2:123990938-123990960 TATAAGAAAAAGAGGGAGGCAGG + Intergenic
937854607 2:126663330-126663352 GATAAAAACATGAAGGAGGCTGG - Intronic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
939355455 2:141095827-141095849 CATGAATATCAGATGGAGGAGGG - Intronic
939677707 2:145093226-145093248 CACAAAAGAAAGATGTAGGCTGG + Intergenic
940614760 2:156036410-156036432 AATAAAAATAAGTTGAAAGCTGG + Intergenic
940642781 2:156364546-156364568 CATAAAGACAACATGGAAGCAGG + Intergenic
940649032 2:156422428-156422450 CATTAAAATACTATGCAGGCAGG + Intergenic
940881907 2:158955062-158955084 TAAAAAAAAAAGAGGGAGGCTGG - Intergenic
941341933 2:164317010-164317032 AATAAAAAGAAAATGAAGGCAGG + Intergenic
941893532 2:170606722-170606744 TATAAAAATAAAATACAGGCCGG + Intronic
942295715 2:174515246-174515268 TATAAAAATGATATGGTGGCCGG + Intergenic
942300167 2:174553526-174553548 AATAAAAATGAAATGGATGCAGG + Intergenic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943640045 2:190347839-190347861 CTTAAAATGAGGATGGAGGCTGG + Intronic
943833288 2:192488541-192488563 CATAGGAAAAAGATGTAGGCTGG + Intergenic
943881488 2:193150702-193150724 CATAAAAATAATAAGGATGAAGG + Intergenic
944187504 2:196965761-196965783 CACAAAGATAAGATGAAGGATGG - Intergenic
944825685 2:203481010-203481032 AATAAAATTAAGATGAGGGCTGG - Intronic
944862271 2:203826308-203826330 CATCTAAGTAAGATGGAGGTGGG + Intergenic
945245669 2:207714455-207714477 TATAGACATAAGATGGAGCCAGG - Intronic
946110559 2:217411733-217411755 ATTAAAAATTAAATGGAGGCTGG + Intronic
946631414 2:221673048-221673070 CTTAAAAATAACATGGAGTAGGG - Intergenic
947271546 2:228341997-228342019 TATAAAAATATGATTGAAGCTGG - Intergenic
947446705 2:230169617-230169639 TAAAAAAATAAGAGTGAGGCTGG - Intronic
948119681 2:235520076-235520098 CTTCAAAATAATATTGAGGCCGG - Intronic
948683552 2:239655618-239655640 CTTAAAAATAATAAGGATGCAGG + Intergenic
948774510 2:240276630-240276652 CATAAAAATAAAAAGAAGGAAGG + Intergenic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
1169308836 20:4517980-4518002 CATAAAAAGAAGTTAGGGGCCGG - Intergenic
1169883395 20:10371715-10371737 GATAAATAGAAGATGGAGGTAGG - Intergenic
1170253916 20:14318425-14318447 CATAAAAATGAGATAGGGGTAGG + Intronic
1170331602 20:15218134-15218156 CATAGAAATAAGATGCAGAAAGG - Intronic
1170348688 20:15416562-15416584 CATAAATATGATATGGAGTCAGG + Intronic
1170786883 20:19475040-19475062 CATAAAAATCACATCCAGGCTGG + Intronic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171203774 20:23263635-23263657 AATACAAATAAGGTGAAGGCAGG - Intergenic
1172695306 20:36818274-36818296 GATAAAATGAATATGGAGGCTGG + Intronic
1172760921 20:37321009-37321031 CAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1173613242 20:44386145-44386167 AAAAAAAATCAGATGGTGGCTGG - Intronic
1173719306 20:45239730-45239752 TATAAAAATAATATAAAGGCAGG - Intergenic
1174247374 20:49191753-49191775 CATAAAAATATAATGGGGCCGGG + Intergenic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174476200 20:50797396-50797418 TAAAAAAATAGCATGGAGGCAGG + Intronic
1174741853 20:53022001-53022023 CATAAAAGTAACATGGTGGAGGG + Intronic
1175904773 20:62374308-62374330 CATAAAAAGAGGCTGGAGTCTGG - Intergenic
1176449938 21:6853214-6853236 TGTAAAAATAAAATGTAGGCTGG + Intergenic
1176702575 21:10073433-10073455 TATAAAAATAAGATAGGCGCTGG - Intergenic
1176828109 21:13718232-13718254 TGTAAAAATAAAATGTAGGCTGG + Intergenic
1177079834 21:16625144-16625166 AATAAATATGAGATGGAGGTAGG - Intergenic
1177504066 21:21998959-21998981 AAAAAAAAAAAAATGGAGGCCGG + Intergenic
1177591193 21:23169980-23170002 CATAAAAACAAAATAGAGACAGG + Intergenic
1177916168 21:27090444-27090466 TATAAAAATAGGCAGGAGGCTGG + Intergenic
1178473602 21:32917344-32917366 TCTAAAAAAAAGATGGAGGGGGG + Intergenic
1178569877 21:33726351-33726373 CATAAAAATAGTATGGGGGTTGG - Intronic
1179266599 21:39809170-39809192 TATAAAAATAAGCAGCAGGCTGG - Intergenic
1179477243 21:41654965-41654987 TATAAAAATGAAATGTAGGCCGG + Intergenic
1179604313 21:42503543-42503565 CTTAAAAACAAAATGGAGGCTGG - Intronic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1180424871 22:15164557-15164579 CATAAAAACTAGATAGAAGCAGG - Intergenic
1181396351 22:22625551-22625573 AAAAAAAAAAAAATGGAGGCTGG - Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181982847 22:26778321-26778343 GATATAATGAAGATGGAGGCTGG - Intergenic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1182678492 22:32059482-32059504 CATAAACAAAAGCAGGAGGCAGG + Intronic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1183179935 22:36253239-36253261 TGTGAGAATAAGATGGAGGCAGG - Intronic
1183268167 22:36843728-36843750 CATAAAATTCAGATGGGGGATGG - Intergenic
1183762705 22:39838524-39838546 AATATAAATAAAATAGAGGCAGG + Intronic
1183906325 22:41043386-41043408 CCTAAAAGTAAGATGCAGGCCGG + Intergenic
1183998708 22:41656222-41656244 AAAAAAAAAAAGATGAAGGCTGG + Intronic
1184579768 22:45408116-45408138 AATAATAATAAGATGAAGGAAGG - Intronic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
949350259 3:3118672-3118694 CATAAAAATAGGAATTAGGCTGG - Intronic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949854844 3:8451928-8451950 CACAAAAATGAGATGGAGAACGG + Intergenic
949976518 3:9465990-9466012 TATGAAAATTAGAAGGAGGCCGG + Intronic
950033778 3:9869644-9869666 CATAAAAATAAAATGCATCCAGG + Intronic
950055773 3:10023322-10023344 CATAAAAATAAAATGCATCCAGG + Intergenic
950058727 3:10051082-10051104 CAAAAAAAAAAGAGTGAGGCCGG + Intronic
950244050 3:11399049-11399071 TTTAAAAATCAGATGCAGGCTGG + Intronic
950391403 3:12699617-12699639 CATCAAAATCACATGGGGGCTGG - Intergenic
950716702 3:14852972-14852994 TATAAAACTGAGGTGGAGGCTGG - Intronic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951505151 3:23436705-23436727 AATAAAAATAAGATGGAACATGG - Intronic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
952377931 3:32782405-32782427 TAAAAAAATATGATTGAGGCCGG - Intergenic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953306127 3:41831314-41831336 CATAAAAAGAAGAGGGAGCAGGG + Intronic
953337745 3:42108192-42108214 ATTAAAAATATGATGCAGGCTGG + Intronic
953762511 3:45700966-45700988 CATTAAAAAGAGATAGAGGCTGG - Intronic
954260353 3:49434183-49434205 CTTAAAACCAAGATGGAGGCTGG + Intergenic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954843749 3:53535703-53535725 CATAAAACTGAGATGAAAGCTGG + Intronic
956267534 3:67414047-67414069 CATGAAAATAAAAAGGTGGCAGG - Intronic
956546859 3:70413557-70413579 CATAAAAAGAAACTGAAGGCTGG + Intergenic
957228756 3:77483536-77483558 CATGAAAATAAAATTGAGGGAGG - Intronic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957333471 3:78796060-78796082 AATAATCATAAGATGGAGGGAGG - Intronic
957563966 3:81861387-81861409 TTTAAAAATAAGATGGCTGCTGG + Intergenic
957751656 3:84426582-84426604 AAGAAAAATAGGATGGAGGCTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958481670 3:94652108-94652130 CATAAAAACAAGTGGGAGGTAGG + Intergenic
958639403 3:96785490-96785512 CATAAAAATAAAAATGAGCCTGG + Intergenic
959320160 3:104863370-104863392 AAAAAAAATCAAATGGAGGCTGG + Intergenic
959814313 3:110657796-110657818 CAGAAAAAGAAGATTGATGCTGG + Intergenic
959830872 3:110860972-110860994 TATAACAATAAAATGGAGGAGGG - Intergenic
960086550 3:113597198-113597220 CATAAAAATAAAATTTTGGCTGG + Intronic
960355507 3:116648022-116648044 GATATAAATAAGATGGAGCAAGG + Intronic
960954099 3:123019297-123019319 GATAAAAATAATATGTGGGCCGG + Intronic
961847641 3:129780707-129780729 AATGAAAATAAGATGTAGGAAGG - Intronic
962476170 3:135757336-135757358 CAAAAAAATAAGATGGCTTCAGG + Intergenic
962757860 3:138481242-138481264 CATAAAAATAAACTATAGGCTGG + Intronic
962834221 3:139172601-139172623 CAAAAAAAAAAGAAAGAGGCCGG - Intronic
963076830 3:141354941-141354963 CCTAAAAATAAGATGAAAACAGG - Intronic
963217543 3:142766383-142766405 AAAAAAAAAAAGATGTAGGCTGG - Intronic
963366083 3:144336432-144336454 CTTAAAAATTAGAAAGAGGCTGG + Intergenic
963420334 3:145053745-145053767 CATAAGAGAAAGATGTAGGCTGG + Intergenic
963445664 3:145403924-145403946 CATACGAAAAAGATGGAGACAGG + Intergenic
963903839 3:150757682-150757704 CATAAAAAAAAAATCCAGGCTGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
968196335 3:196710540-196710562 CATCTCAAAAAGATGGAGGCAGG + Intronic
968300708 3:197611912-197611934 CATAAAAATAAAAAATAGGCTGG + Intergenic
969225503 4:5795353-5795375 CATCAGAAGAGGATGGAGGCTGG + Intronic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
970139503 4:12966287-12966309 CATAAACAGAAAATGAAGGCTGG - Intergenic
970149476 4:13073800-13073822 CTAAAAAATAAAATGGCGGCTGG + Intergenic
970152209 4:13101618-13101640 CACAAAGACAAGATAGAGGCTGG - Intergenic
970183661 4:13426577-13426599 CATAAAAATATGAGGAAGGTTGG - Intronic
970186410 4:13459076-13459098 CACAGGAAAAAGATGGAGGCCGG - Intronic
972497520 4:39647792-39647814 CATAAAAAGCTGATGGGGGCTGG + Intergenic
972532321 4:39972543-39972565 AATAAAAATAAAATTGAGACAGG + Intronic
972580035 4:40386928-40386950 CTTAAAAGTAAAATGAAGGCTGG - Intergenic
973876190 4:55221822-55221844 CATAAAAATCATCTGTAGGCCGG + Intergenic
974591906 4:63962111-63962133 GATAAAGATAATATGCAGGCCGG + Intergenic
975176283 4:71293135-71293157 CTTAAAAACAAAATTGAGGCCGG - Intronic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
976594548 4:86882710-86882732 CATTAAAATAAGGTGGAGTTTGG - Intronic
977893431 4:102338480-102338502 TTAAGAAATAAGATGGAGGCTGG - Intronic
977970412 4:103206546-103206568 CATAAAGAAATGATTGAGGCCGG - Intergenic
977971237 4:103217022-103217044 CTTAAAAAGAAGATTGAGGGAGG + Intergenic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978380286 4:108120325-108120347 CAAAAACATAAAATGGTGGCTGG - Intronic
979076667 4:116279483-116279505 ATTAAAAATAAGATGGTTGCAGG - Intergenic
979810171 4:125027047-125027069 CACAAAAGAAAGATGGAGGCCGG - Intergenic
979861291 4:125696843-125696865 TCTAAAAATAAGATGGAAGAGGG - Intergenic
979918295 4:126467791-126467813 CATAAAAACAAAATAAAGGCAGG + Intergenic
980374748 4:131929887-131929909 TATAAAAATAAGATAGGCGCTGG - Intergenic
980392110 4:132159882-132159904 AATAAAAAAAACATGGAAGCTGG - Intergenic
980403917 4:132331661-132331683 CATAAAAATAAAATATGGGCCGG + Intergenic
980570891 4:134618802-134618824 AATAAAAAAAAAATGGTGGCTGG + Intergenic
981430164 4:144648004-144648026 CATAAAAATTAGATTCAGCCTGG - Intronic
981891423 4:149743206-149743228 CATAAACCTAAGCTGAAGGCAGG - Intergenic
982217695 4:153096282-153096304 AATAAAAATAAAAAGGAGGAGGG + Intergenic
982799875 4:159692275-159692297 CACAAAAGAAAGATGAAGGCTGG - Intergenic
982992941 4:162302055-162302077 AATATAAATAAAATGGAGGCTGG - Intergenic
983204107 4:164894818-164894840 CATAAAAATGAAATGGGGCCAGG - Intronic
983873123 4:172844917-172844939 AATAAAAATAAGATTCTGGCTGG + Intronic
983914691 4:173279674-173279696 TATAAAATAAAAATGGAGGCCGG + Intronic
983995703 4:174179036-174179058 CATAAAAATAAGTTGAAAGAAGG + Intergenic
984165968 4:176303665-176303687 CTTAGAAATAGGATGGAGGCTGG + Intergenic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985233940 4:187852288-187852310 CATAAAAATAATCTGAAGGTAGG + Intergenic
985268524 4:188172957-188172979 TTTAAAAATTAGCTGGAGGCTGG + Intergenic
986235349 5:5904551-5904573 CATAAGAGAAAGATGTAGGCTGG - Intergenic
986531526 5:8741336-8741358 TATAAAAGTATGATTGAGGCAGG - Intergenic
986839908 5:11684396-11684418 ATTAAAAATAACATGTAGGCCGG - Intronic
987033893 5:14000635-14000657 CAAAAAAAAAAAATGGATGCTGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
987952595 5:24694618-24694640 CATAAGAAAAAGATGGGGGGAGG + Intergenic
988106992 5:26763907-26763929 AATATAAATAAGATGGAGTTAGG - Intergenic
988575350 5:32417962-32417984 CATTAAAATAATATCAAGGCTGG + Intronic
988612854 5:32744285-32744307 CATTAAAACATGATGCAGGCTGG - Intronic
988957680 5:36335221-36335243 TAAAAAACTAAGATGAAGGCTGG - Intergenic
988979832 5:36556102-36556124 CATATGAATAAGATTGAAGCTGG - Intergenic
989270755 5:39530116-39530138 TGGAAAAATAAGATGGAGCCAGG - Intergenic
989503564 5:42198565-42198587 TTTAAACATCAGATGGAGGCTGG - Intergenic
990736848 5:58873695-58873717 CTTAAAAATAAGCTGGATCCTGG - Intergenic
990765251 5:59175772-59175794 AAAAAAAAAAAAATGGAGGCCGG - Intronic
991727860 5:69554228-69554250 CAGAAAAAAAATAGGGAGGCTGG - Exonic
991867097 5:71073648-71073670 CAGAAAAAAAATAGGGAGGCTGG + Intergenic
991907681 5:71528115-71528137 AATTAACATAAGATCGAGGCCGG - Intronic
991943369 5:71876437-71876459 TATAAAAATCACATGCAGGCCGG - Intergenic
992438711 5:76779777-76779799 ATTAAAAATAGGATGGGGGCTGG + Intergenic
992539804 5:77752852-77752874 ATTAAAAATAAGCCGGAGGCCGG - Intronic
992691896 5:79248602-79248624 TATAATTATAAGAAGGAGGCCGG - Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
992969298 5:82039302-82039324 CATAAAAATAGGAGAGAAGCAGG + Intronic
993644608 5:90446952-90446974 CATATAAAAAAGATAGTGGCCGG - Intergenic
994736737 5:103564977-103564999 CATAACAAAATGATGGATGCAGG - Intergenic
996516324 5:124373397-124373419 AATAGAAAGAAGATGGATGCTGG - Intergenic
998559220 5:143155461-143155483 CATAAAAATTGGATGAAGGCAGG - Intronic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
998876530 5:146605746-146605768 AATAAAAATAAAATGGAGTGGGG - Intronic
998933730 5:147210897-147210919 CATAAAAATAAAAAGGAACCAGG + Intergenic
998960384 5:147480221-147480243 CGCAAAAAGAAGCTGGAGGCCGG - Intronic
999017351 5:148121659-148121681 AATAAAGAAAATATGGAGGCAGG + Intronic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999107381 5:149085787-149085809 TACAAATATAAGATGTAGGCTGG - Intergenic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999439063 5:151587326-151587348 CATACAAAAAAGAGGTAGGCTGG + Intergenic
999454625 5:151704887-151704909 CATAAGAATAAAGTGTAGGCCGG + Intergenic
999692959 5:154164841-154164863 AAAAAAAAAAAGATGGAGGGCGG - Intronic
1000216728 5:159165384-159165406 CATAAAAATAATATCCTGGCCGG + Intronic
1001625691 5:173131005-173131027 CATAAAAATAAGTTTGCTGCTGG - Intronic
1002201603 5:177531750-177531772 CAGAAAAACAAGTTGGAGCCCGG + Intronic
1002284033 5:178150375-178150397 CAAAAAAAAAAAATAGAGGCTGG - Exonic
1002353451 5:178602602-178602624 CATAAAAACTATATGGAGCCAGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1004008825 6:11661548-11661570 AAAAAAACTAAGATTGAGGCCGG - Intergenic
1004150059 6:13109229-13109251 CATAAAAATAAAAAGCAGGATGG - Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004211832 6:13655173-13655195 CTTAAAATTAAAATGTAGGCTGG + Intronic
1004767421 6:18745882-18745904 CATAAAAATACGATTTGGGCCGG - Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006154751 6:32008061-32008083 CATGAAAATGTGGTGGAGGCTGG + Intergenic
1006466734 6:34199799-34199821 CAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1006498763 6:34443712-34443734 AATAAAAATAATATTGAGGCCGG + Intergenic
1006693079 6:35907403-35907425 CTTTAAAATAAGATGGAGTGAGG + Intronic
1007560915 6:42807477-42807499 CTTCAAAATAATATGAAGGCCGG - Intronic
1008038639 6:46774018-46774040 CAGAAAACTAAAAGGGAGGCTGG + Intergenic
1008118688 6:47584995-47585017 CTTATAAATAAATTGGAGGCCGG + Intronic
1009308193 6:62118726-62118748 CATAGAAGAAAGATGAAGGCTGG - Intronic
1009630314 6:66190817-66190839 TTTAGAAATAAAATGGAGGCAGG - Intergenic
1010791121 6:80066273-80066295 GAAAAAAATAAGATGGAACCAGG - Intergenic
1010870857 6:81036178-81036200 CATAAAAATTAGATCGTAGCTGG - Intergenic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1011339626 6:86299612-86299634 GATGAAGATAAGAAGGAGGCAGG + Intergenic
1012119590 6:95348149-95348171 CACTAAAATAAGATTGAGGAAGG + Intergenic
1012468454 6:99541875-99541897 CTTCAAAATAAGATGGGGGATGG + Intergenic
1012497441 6:99849452-99849474 TTTAAAAATAATATTGAGGCTGG - Intergenic
1012920318 6:105215844-105215866 CAGATAAATAAAATGGAAGCAGG - Intergenic
1013178516 6:107698544-107698566 CAGCAAAAAAACATGGAGGCAGG + Intergenic
1013201439 6:107900295-107900317 CTTAAAAATAAGATAAGGGCTGG - Intronic
1013534321 6:111049900-111049922 TAAAAAAATGATATGGAGGCCGG + Intergenic
1014616576 6:123608870-123608892 CATGAAAAAAAAATGGAAGCAGG + Intronic
1015431322 6:133132871-133132893 TATAAAAATAAAATTGAGGACGG + Intergenic
1015574065 6:134652195-134652217 CATAAAAATAGAGTGGAGGAGGG + Intergenic
1015649009 6:135432646-135432668 TATAAGAATAATATGGTGGCCGG - Intronic
1015657817 6:135539797-135539819 CACAGAAGAAAGATGGAGGCTGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016359331 6:143250996-143251018 CATGAAATTAAGGTGGTGGCAGG - Intronic
1016691987 6:146948744-146948766 TATAAATAGAAGAGGGAGGCAGG - Intergenic
1016893443 6:149030343-149030365 CTTAAAAATAAAATCTAGGCTGG + Intronic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017254746 6:152320811-152320833 AATAAAAATAAGATCAAGGCAGG - Intronic
1019740801 7:2672046-2672068 CATAAAAATAAGATAGGGCTGGG - Intergenic
1020850763 7:13349575-13349597 TATCAAAAGAAGATGCAGGCTGG - Intergenic
1020863617 7:13526734-13526756 CATCAGAATCACATGGAGGCTGG - Intergenic
1021384222 7:20008293-20008315 CATAAAAATTAGCTAGATGCAGG - Intergenic
1021426902 7:20510543-20510565 TCTAAAAATAATGTGGAGGCAGG - Intergenic
1021664448 7:22962055-22962077 CATAAAAACAAGATAAAGCCAGG + Intronic
1022123615 7:27334422-27334444 TATAAAAATAAGATGAGGCCAGG - Intergenic
1022215599 7:28257604-28257626 TAAAAAAATAAGATTCAGGCTGG - Intergenic
1022897319 7:34764406-34764428 TATAAAAATAAGCTGCAGGATGG - Intronic
1023158604 7:37276310-37276332 CACAAAAATAACACGTAGGCCGG + Intronic
1023415898 7:39932159-39932181 CATAAAAATAATAATGAGACTGG + Intergenic
1023981111 7:45070650-45070672 CATAAAAAGCTGTTGGAGGCTGG + Intronic
1024432410 7:49303999-49304021 CTTAAAATTCATATGGAGGCTGG - Intergenic
1025602346 7:63012599-63012621 CAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1026865371 7:73820966-73820988 AACAAAAATAAAATGGAGGCCGG - Intronic
1027385417 7:77654962-77654984 CATTTAAATAAAAAGGAGGCTGG - Intergenic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1028177935 7:87679387-87679409 CTTAAAAAAAAGTTGGGGGCCGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028660065 7:93261379-93261401 CATAAAATTAGGCTGTAGGCCGG + Intronic
1028788666 7:94827256-94827278 CATTAAAATGAGATGGAAGTTGG + Intergenic
1029257297 7:99278237-99278259 AATAAGAATTTGATGGAGGCTGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031350816 7:120728584-120728606 CAAAAACATAAGAAGGAGGCTGG - Intronic
1031538452 7:122963438-122963460 TATTTAAATATGATGGAGGCTGG - Intergenic
1031611330 7:123831328-123831350 TATAAAGAAAAGATGCAGGCTGG - Intronic
1031808465 7:126336373-126336395 AATAACAATTAGATAGAGGCGGG - Intergenic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032767981 7:135018506-135018528 CATAAAAATAAGATTAAGTGGGG - Intronic
1032862089 7:135890016-135890038 CATAAAAGTTCGAAGGAGGCAGG - Intergenic
1033154163 7:138942612-138942634 CGCAAAAGTAAGTTGGAGGCTGG + Intronic
1033517540 7:142123116-142123138 CATAAAAATAATTTTGAGGTCGG - Intronic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1035179073 7:157076368-157076390 CAAAAAACAAAGATGCAGGCTGG - Intergenic
1036475237 8:9087205-9087227 AATAAAAATAAGATGAAGGTGGG - Intronic
1037338269 8:17813203-17813225 CATAAAAATAATTTCCAGGCTGG - Intergenic
1037548163 8:19943891-19943913 TATAAAAATAAAAAGTAGGCTGG + Intronic
1037785969 8:21903469-21903491 CAAAAAAATAAAAAGCAGGCCGG + Intergenic
1038125023 8:24664010-24664032 CATAAAAATAAGGTGGAAGGTGG - Intergenic
1038958486 8:32492959-32492981 AATAAAAATAAGGTGGAGACTGG + Intronic
1039089388 8:33812303-33812325 CATAAGAATAAGATTGAAGCAGG - Intergenic
1039215468 8:35265572-35265594 TATAAAAATAATATGATGGCTGG + Intronic
1039291961 8:36105885-36105907 CCCAAAAATAAGAAGCAGGCAGG + Intergenic
1039576808 8:38630243-38630265 CTTTAAAATAAAATGAAGGCTGG + Intergenic
1040382672 8:46887998-46888020 CATAAAAACAGGATGGACGAAGG - Intergenic
1040874278 8:52134025-52134047 CATAAAAATCATTTGGAGGCGGG - Intronic
1041039011 8:53827083-53827105 CTCAAAAATAAAATGCAGGCTGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1042114155 8:65413305-65413327 CATAACTTTAAGATGTAGGCTGG - Intergenic
1042274327 8:66987257-66987279 GCTAAAAATGAGATGGAGACAGG - Intronic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1042967291 8:74368367-74368389 CATAAAAATATAATGAAGACAGG + Intronic
1043195491 8:77287378-77287400 CATAAACACCAGAAGGAGGCAGG + Intergenic
1044033771 8:87272047-87272069 CATAAAGATAAAATGTAGGCTGG + Intronic
1044389987 8:91638734-91638756 CATAAAAATTAGATGGGGCTGGG - Intergenic
1044689061 8:94858967-94858989 GTTTAAAATAAGAAGGAGGCTGG + Intronic
1044806853 8:96017258-96017280 GATAAAAGTAAGATATAGGCTGG + Intergenic
1045210101 8:100088659-100088681 TCAAAAAATAACATGGAGGCAGG + Intronic
1045755701 8:105538713-105538735 TAAAACAATGAGATGGAGGCTGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1045987468 8:108265270-108265292 AAAAAAAAAAAGATGTAGGCTGG - Intronic
1046227395 8:111301509-111301531 CATAAAATTTATATGAAGGCTGG - Intergenic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1047516049 8:125555944-125555966 AATAAAAATAAAAGAGAGGCTGG + Intergenic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047892067 8:129323810-129323832 CATAAAAATCAGATAGTGTCTGG + Intergenic
1048359111 8:133680435-133680457 CATAAAAATAAAACTGAGCCGGG - Intergenic
1048531515 8:135254311-135254333 GATAAGAATAAGATGGATGTAGG - Intergenic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1049860318 8:144893863-144893885 CATAAACACAAGATGCAGGTAGG - Intronic
1050574342 9:6977569-6977591 AAGTAAAATAAGATGGAGGCAGG - Intronic
1050639330 9:7650330-7650352 CAAAAAAAAAAAATGGAGGAGGG + Intergenic
1050865945 9:10499399-10499421 GATACAAAAAAGATGGTGGCAGG - Intronic
1051094027 9:13444481-13444503 CATAAAAAAAACATGGGGGAGGG - Intergenic
1051638747 9:19204856-19204878 AATAAAAAAAATAAGGAGGCTGG - Intergenic
1051666098 9:19468120-19468142 AAAGAAAATAAAATGGAGGCTGG - Intergenic
1052130924 9:24845915-24845937 CATAAAAGTAATATTAAGGCTGG + Intergenic
1052656304 9:31366146-31366168 AATAAAAATCAGATGGAGAAAGG + Intergenic
1052685692 9:31752678-31752700 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1052972432 9:34385233-34385255 CATAGAATCAGGATGGAGGCTGG + Intronic
1053639775 9:40060227-40060249 TATAAAAATAAGATAGGCGCTGG - Intergenic
1053766358 9:41405254-41405276 TATAAAAATAAGATAGGCGCTGG + Intergenic
1054544974 9:66316413-66316435 TATAAAAATAAGATAGGCGCTGG + Intergenic
1055205145 9:73721054-73721076 CAGAAAAAAAAAATGGATGCAGG + Intergenic
1055216655 9:73871914-73871936 CATAAATACAAGATGGACTCTGG + Intergenic
1055489546 9:76790643-76790665 TATAAAAATAAGAAGGAGAAAGG + Intronic
1055498808 9:76882902-76882924 GATAAAAATAATTTAGAGGCAGG + Intronic
1056119116 9:83469838-83469860 CAGAAAACTAAGATGGGGGGCGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056933663 9:90899064-90899086 CATGAATAAAAGATAGAGGCAGG - Intergenic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057001603 9:91514771-91514793 TAAAAGAATAAGATGTAGGCTGG - Intergenic
1057608171 9:96517024-96517046 CTTAAAAATAAAAAAGAGGCAGG - Intronic
1057779639 9:98039142-98039164 AGTAAAAATAAGAGGGAGGAAGG - Intergenic
1058340645 9:103892003-103892025 CATATACATAAGATTGAAGCTGG + Intergenic
1058411221 9:104734274-104734296 TATAAAAATAAAAAGGAGGCTGG - Intergenic
1058787493 9:108404610-108404632 CATAAATATTAGATGCAGGAAGG - Intergenic
1058954026 9:109929258-109929280 CATTCAAATAAGATGGAGGCTGG - Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059225866 9:112672396-112672418 CAAAAAAAAAAGAGGGAGTCCGG + Intergenic
1059686597 9:116643474-116643496 TATAAAAATAGGAAGCAGGCTGG + Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1062061136 9:134495755-134495777 AATAAAAATAAAATAGAGCCGGG - Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062632630 9:137472288-137472310 AAAGAAAATGAGATGGAGGCTGG + Intronic
1202787593 9_KI270719v1_random:43541-43563 TATAAAAATAAGATAGGCGCTGG - Intergenic
1203519243 Un_GL000213v1:31303-31325 TGTAAAAATAAAATGTAGGCTGG - Intergenic
1185662405 X:1737757-1737779 TATAAAACTAAGCTGTAGGCTGG - Intergenic
1186052431 X:5612542-5612564 AATAAAAATAAAATGGAAGAGGG - Intergenic
1186382836 X:9078966-9078988 CTCAAAAATTATATGGAGGCTGG + Intronic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1188017932 X:25125277-25125299 GATAAAAACAAGTTTGAGGCCGG - Intergenic
1188906322 X:35796277-35796299 TATAAAAATTCTATGGAGGCCGG - Intergenic
1189348067 X:40257480-40257502 TAAATAAATAAAATGGAGGCCGG - Intergenic
1189392023 X:40584353-40584375 AAAAAAAAAAAGATAGAGGCTGG - Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190589431 X:51984113-51984135 CATATAAACAAGATTGAAGCTGG - Intergenic
1190851704 X:54250666-54250688 CAGAAAAATAAGATATAGGAAGG + Intronic
1191137053 X:57076104-57076126 CAAAAAAACAAACTGGAGGCCGG - Intergenic
1192239160 X:69315641-69315663 TTTCATAATAAGATGGAGGCGGG - Intergenic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193333692 X:80263107-80263129 AATAAAAATCACATTGAGGCCGG + Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1194640542 X:96399006-96399028 CAAAAAAATAAAATTGAGGCCGG + Intergenic
1194815167 X:98432086-98432108 CATAAAAATAAAATCTAGGATGG - Intergenic
1195106133 X:101603143-101603165 CATAAAAATAAAATGAAGGCAGG - Intergenic
1195396841 X:104420038-104420060 CATAAAAGACAGATAGAGGCAGG - Intergenic
1195631547 X:107060621-107060643 CAATAAAAAAAAATGGAGGCAGG - Intergenic
1195632726 X:107076019-107076041 CATATAAATACAATGGGGGCTGG + Intronic
1195691224 X:107627428-107627450 GATAAAACTGAGATGGAGGTGGG - Intergenic
1195993096 X:110702713-110702735 CATAAATATCAGATGGGGGTTGG - Intronic
1196539144 X:116884224-116884246 AATAAAAAGATGATTGAGGCTGG - Intergenic
1197201127 X:123749541-123749563 CATAAAAATAAAGTGGAGCAAGG + Intergenic
1197454089 X:126655814-126655836 CATAAAATTAAGATCAAGCCCGG - Intergenic
1197603164 X:128554842-128554864 AAAAAAAAAAAGCTGGAGGCTGG + Intergenic
1197783877 X:130181657-130181679 CTTAAAAATAAATTGGAGGCTGG + Intronic
1197784952 X:130189935-130189957 TAAAAAATTAAAATGGAGGCTGG - Intergenic
1198129659 X:133680990-133681012 CATAAAAATGAGAGGGGGGTAGG + Intronic
1198425356 X:136513895-136513917 CATCAAAAGAAAATGGGGGCAGG + Intergenic
1198446410 X:136721264-136721286 TATAAAAACACAATGGAGGCTGG + Intronic
1198722494 X:139637868-139637890 CATTAGGATAAGAGGGAGGCAGG + Intronic
1199046688 X:143182619-143182641 CATGAGAGAAAGATGGAGGCCGG - Intergenic
1199144142 X:144346375-144346397 CATGGAAAAAAGATGTAGGCTGG + Intergenic
1199785280 X:151099654-151099676 CATAGGAAAAAGATGGAAGCTGG - Intergenic
1200847646 Y:7848679-7848701 CTTGAAAACAACATGGAGGCAGG + Intergenic
1202055822 Y:20828437-20828459 CATAAAAGTCAGATGAGGGCTGG - Intergenic