ID: 949505901

View in Genome Browser
Species Human (GRCh38)
Location 3:4727237-4727259
Sequence TGTCTCTCAATCACAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949505901 Original CRISPR TGTCTCTCAATCACAGTGTG TGG (reversed) Intronic
900274364 1:1814432-1814454 AGCCTCTAAATCAGAGTGTGGGG + Intronic
903237571 1:21960054-21960076 TGCCTTTCAATAACATTGTGAGG + Intergenic
903866089 1:26399037-26399059 TGTCACTAACTCACTGTGTGGGG - Intergenic
905745725 1:40415730-40415752 TATGTCTCAGGCACAGTGTGAGG + Intronic
906946991 1:50303074-50303096 TGTCTTTGAATCACAGTGATTGG + Intergenic
907182919 1:52586583-52586605 TGTCTCTCAATCAGAAGGTGGGG + Intergenic
908222493 1:62021435-62021457 GGTCATTCAATTACAGTGTGTGG + Intronic
908430490 1:64051901-64051923 TGCCACTTAATTACAGTGTGGGG + Intronic
908481587 1:64545826-64545848 TGTCTCTAAATCAGAGTGCTTGG + Intronic
908986433 1:70029167-70029189 TTTCTCTCTCTCACAGTGTTTGG - Intronic
910586896 1:88890678-88890700 TGTCTCTCATTACCACTGTGAGG - Intronic
913069850 1:115288844-115288866 CTTCTTTCCATCACAGTGTGTGG + Intronic
913479522 1:119274160-119274182 TCTTTGTCAATCACAGTGAGTGG - Intergenic
913570460 1:120114818-120114840 TGTCTCTCCTCCACAGAGTGGGG - Intergenic
917983940 1:180295604-180295626 TGTCTCTGTGTCACACTGTGGGG + Intronic
921098442 1:211907538-211907560 TGTGTCTCAGTCTCAATGTGTGG + Intergenic
923111189 1:230891577-230891599 TGTCTCTGAGTCACAGTTTCAGG - Intergenic
1063763206 10:9105402-9105424 TTTCTCTCAAAAATAGTGTGGGG + Intergenic
1064512768 10:16113300-16113322 TGTCTCTCAGTCTCTGTGAGAGG - Intergenic
1064776531 10:18784471-18784493 TGTCTCACTTTCAAAGTGTGAGG - Intergenic
1066230147 10:33424234-33424256 TGTCTCTGCTTCACAGTGTCTGG - Intergenic
1067376366 10:45731018-45731040 TTTTTCTCAATCACAGTCTTAGG + Intronic
1067884065 10:50071704-50071726 TTTTTCTCAATCACAGTCTTAGG + Intronic
1068294415 10:55051128-55051150 TGACCCTCAATCACAGTGCTGGG - Intronic
1071028522 10:81143968-81143990 TGTCTTGCAATCACAGAGGGAGG + Intergenic
1074741293 10:116486709-116486731 TGTCAATCAAACACAGTGTGTGG - Intergenic
1074895738 10:117776289-117776311 TGGCTCTCCATCACAGGGTTTGG + Intergenic
1076407423 10:130221939-130221961 TGTGTCTCCATCTCAGTCTGTGG + Intergenic
1077819831 11:5726584-5726606 TGGCTCTCACTCCCTGTGTGTGG + Intronic
1078587837 11:12609435-12609457 TTTCTCTCAATAACATTTTGTGG - Intergenic
1079905922 11:26247157-26247179 GGTCTTTTAATCTCAGTGTGAGG - Intergenic
1083115540 11:60455853-60455875 TGTTTCTCAAGCACACTGGGAGG - Exonic
1085101484 11:73804216-73804238 TCTCTCTCAATAACAGTGATAGG - Intronic
1086926764 11:92649074-92649096 TGTCTCTCATATTCAGTGTGTGG + Intronic
1086973645 11:93109572-93109594 GTTCTCTCAACCACTGTGTGGGG + Intergenic
1087496144 11:98893279-98893301 TGGCTCACAATCACAGTGGAAGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1092567287 12:9680991-9681013 TTTCTGACAATCATAGTGTGTGG + Exonic
1092595840 12:10003965-10003987 TTTCCCTCAATCACACTGGGTGG - Intronic
1093039829 12:14365436-14365458 CGTCTCTCAGTTGCAGTGTGAGG - Intergenic
1095944874 12:47748148-47748170 TGTCTCTGTATGACAGGGTGAGG + Exonic
1097927935 12:65151259-65151281 TGTCTCTCCAACACATGGTGTGG + Intergenic
1098521641 12:71440184-71440206 GGGCTCGCAATGACAGTGTGTGG - Exonic
1098848173 12:75563533-75563555 TGCCTGTCAATCAAAGTGTTTGG + Intergenic
1099806455 12:87526598-87526620 TATCTCTCAATCTCTGTGGGAGG + Intergenic
1100578761 12:95918735-95918757 TGTCTCCCCATCATGGTGTGGGG + Intronic
1107236754 13:38179577-38179599 TGTCTCTTAATAGCAGTATGAGG - Intergenic
1109154794 13:58894049-58894071 TGTCTCTGATTCTCAGTGTCTGG + Intergenic
1109669306 13:65584364-65584386 TGTCTCTCAGTCTCTGTGGGAGG + Intergenic
1113679809 13:112235312-112235334 TCTCTCTTAGCCACAGTGTGTGG + Intergenic
1116533839 14:46006776-46006798 TTTCTTTCTATCACATTGTGAGG - Intergenic
1118468933 14:66056909-66056931 TTTCTATCAGACACAGTGTGGGG - Intergenic
1119061836 14:71482546-71482568 TCTCTCTCAGTCAAAGTGTGTGG + Intronic
1120707080 14:87756267-87756289 TGTCTCTGCATGAGAGTGTGCGG + Intergenic
1121410135 14:93743992-93744014 TGTCTCACAAGGACAGTGTGGGG + Intronic
1121627768 14:95399222-95399244 TGGCGCTCAATCACAGACTGTGG + Intergenic
1128169904 15:65502375-65502397 TGTCTCTCAAAGAAAGTTTGTGG + Intronic
1129351879 15:74960197-74960219 TGTCTCATAATCACTCTGTGAGG - Intronic
1130830213 15:87591618-87591640 TGTCTCTCCATCACTGTCTTGGG + Intergenic
1131305627 15:91240704-91240726 TGTATGTCAATCACCGTGAGAGG + Intronic
1133737534 16:8627352-8627374 TGTCCCTCAAACACAGGGAGGGG + Intronic
1134686333 16:16161402-16161424 TGTCCCTCAAGCCCAGTTTGGGG + Intronic
1134869400 16:17638244-17638266 GGTCTCACAATCACAGTGGAAGG + Intergenic
1137542474 16:49374314-49374336 TGTCTCTCAGTCTCTGTGAGAGG - Intronic
1137808264 16:51328511-51328533 TGTCTCTCCATCAAGGGGTGGGG - Intergenic
1140433396 16:74924144-74924166 TGTGTCTCTGTCACAGTGCGTGG - Intronic
1141302188 16:82827382-82827404 TGTCTGCCACTCACAGAGTGAGG + Intronic
1145843275 17:28014388-28014410 TGTATCACATTCACAATGTGGGG + Intergenic
1146954821 17:36931420-36931442 TGTCTCTCAACCCAAGTCTGAGG + Intergenic
1151816165 17:76472511-76472533 GGTCTCTTAATCCCAGTGAGAGG - Intronic
1152487562 17:80604093-80604115 TGTCTCTCAAACACAGACGGGGG + Intronic
1152592465 17:81220415-81220437 TTTCTCAGAATCACGGTGTGGGG - Intronic
1153641688 18:7163077-7163099 CCTTTCTCAATCCCAGTGTGTGG - Intergenic
1154466075 18:14643405-14643427 TGTCTCTGCAACACAGTGAGAGG - Intergenic
1157918313 18:51691569-51691591 TCTCTCTCATTCCCTGTGTGAGG + Intergenic
1158507290 18:58057935-58057957 AGTCCCACAATCCCAGTGTGGGG - Intronic
1161900238 19:7113092-7113114 TTTCTCTCCTTCACAGTGGGTGG - Intronic
1164496745 19:28772265-28772287 TGTCTCTCAATATTATTGTGTGG + Intergenic
1164657975 19:29938592-29938614 TGTCTCCCATTCCCAGTGGGGGG + Intronic
1166259105 19:41625725-41625747 TGTCTCTCGACCACTGTATGCGG + Exonic
1166276331 19:41756813-41756835 TGTCTCTCGACCACTGTATGCGG - Exonic
1167849142 19:52188842-52188864 TGTCTCTCAATCCCAGAGCCTGG - Intergenic
925387776 2:3474237-3474259 TGACTCTCGATCACAAGGTGAGG + Intronic
926579322 2:14617237-14617259 TGTCACCTAATCACAGGGTGAGG - Intergenic
930037508 2:47096207-47096229 AATCAATCAATCACAGTGTGGGG + Intronic
931129541 2:59318816-59318838 TCTCTATCAATAACTGTGTGAGG - Intergenic
936537032 2:113320546-113320568 TGTCTCCTAAGCACACTGTGTGG - Intergenic
936738694 2:115477528-115477550 TGTCTCTCAATCCATGTATGTGG - Intronic
937640583 2:124206473-124206495 TTTCCCTCAACCACAGTGTTGGG + Intronic
937664464 2:124468824-124468846 GGTCACTCTAGCACAGTGTGAGG - Intronic
939936616 2:148300639-148300661 TGTCTCTGATTCAGAGTGTAGGG - Intronic
942175489 2:173329603-173329625 TTTCTCTCAACAACATTGTGTGG + Intergenic
942826897 2:180189456-180189478 TCTCACTCAATAACACTGTGTGG + Intergenic
946517612 2:220430353-220430375 TTTCTCTTAATTACAGTGAGTGG + Intergenic
947600074 2:231441815-231441837 TGTGTCTCAAACACAGTTTGAGG - Intergenic
1174676115 20:52357745-52357767 TGTCTTTCCATCACACAGTGAGG - Intergenic
1175351905 20:58328570-58328592 TGTCTTTAAATGACATTGTGGGG - Intronic
1176808510 21:13515191-13515213 TGTCTCTGCAACACAGTGAGAGG + Intergenic
1176996784 21:15564211-15564233 TGCCTATCAATCACAATGTGTGG + Intergenic
1177774241 21:25550269-25550291 TTTCTCTCAATGCCAGTGTAAGG - Intergenic
1177822586 21:26047792-26047814 TAACTATCAAACACAGTGTGTGG + Intronic
1179464704 21:41563711-41563733 TGGCTCTCAATCGGATTGTGAGG - Intergenic
1180141111 21:45893759-45893781 TGTTTCTGGAACACAGTGTGGGG + Intronic
1183766177 22:39877463-39877485 TGCCTGTCAGTCTCAGTGTGGGG - Intronic
949505901 3:4727237-4727259 TGTCTCTCAATCACAGTGTGTGG - Intronic
950911599 3:16600769-16600791 TGTCTCTGCATCACAGTGTTTGG + Intronic
956091768 3:65675128-65675150 TCAGTCTCAATCACAATGTGTGG + Intronic
956307345 3:67840287-67840309 TTTCTCTAAATCAGAGTGTCTGG + Intergenic
958478499 3:94616190-94616212 TGTATCTCAAGCAAAGTGTAAGG - Intergenic
960583117 3:119297082-119297104 TGTAGCACAATAACAGTGTGTGG - Intronic
963382522 3:144549840-144549862 TGTCTCTCTATTACAGCTTGGGG + Intergenic
964037751 3:152218959-152218981 TGTCTCTCAGTCTCCGTGGGGGG + Intergenic
964732597 3:159883265-159883287 GATCTCTCAAGCACAGTCTGAGG - Intronic
964775520 3:160272177-160272199 TATCAACCAATCACAGTGTGTGG + Intronic
965392436 3:168121131-168121153 TGTTTGTCAAGCACAGTGTGAGG - Intergenic
966021659 3:175219837-175219859 TTTCTCTCAATAATAGTTTGTGG + Intronic
966345997 3:178980633-178980655 TGTATAACAATCAGAGTGTGGGG + Intergenic
969118332 4:4888485-4888507 TGTTTCTCAATCACAAGGTTGGG - Intergenic
969855520 4:9996196-9996218 TGTCTCTCAGTCAGGGAGTGTGG + Intronic
970794313 4:19893049-19893071 TGAGTATCAATCACAGTGTAGGG - Intergenic
976444417 4:85114051-85114073 TTTCTCTCCATGACTGTGTGTGG - Intergenic
976737462 4:88325041-88325063 TTTCTCTCAATCTCTGTGTATGG + Intergenic
978203676 4:106053170-106053192 TGTCCGTCAGTCACAGTGCGTGG - Intronic
979610540 4:122684384-122684406 TGTCTGTTGATCACAGAGTGGGG + Intergenic
979752331 4:124294669-124294691 TATCTCTGAATCACCTTGTGGGG - Intergenic
982073778 4:151718798-151718820 TGGCTCTCACTCACATGGTGTGG + Intronic
983305641 4:165982082-165982104 TGTCTATCAATCACATTATTTGG - Intronic
983427463 4:167605019-167605041 TGTCTCTCAATATCTGTGTGGGG + Intergenic
984265203 4:177490059-177490081 TGACTCTGAATCACGGAGTGAGG - Intergenic
986683524 5:10254918-10254940 TGTCTCTGAATCAGAGCATGAGG + Intronic
988726744 5:33933954-33933976 TGTCTCTCATTCACAGTGGCAGG - Intergenic
990015148 5:51052301-51052323 TTTCTTTCAATCATATTGTGAGG + Intergenic
993491270 5:88553314-88553336 TGTCTCTCAATCAAATTATGGGG - Intergenic
998739735 5:145187026-145187048 TGTCTCTCCAGCACAGTGTCTGG + Intergenic
999910937 5:156198374-156198396 TGTCTCTCAATCCAAGTGCTCGG - Intronic
1000445484 5:161313800-161313822 TGTCCCTTAATCACTATGTGAGG - Intronic
1002986823 6:2197888-2197910 TGTTTCTCAATAACAGCTTGAGG - Intronic
1003841734 6:10127653-10127675 AGTCTCTCTATCACAGTTTCAGG - Intronic
1004516623 6:16326982-16327004 TGGCTCTGAAGCACTGTGTGTGG + Exonic
1005239943 6:23812666-23812688 TGTCTGTGAATCACAGTTTCCGG - Intergenic
1007726263 6:43917650-43917672 TATTTCCCAATCACAGTGTGGGG - Intergenic
1009889480 6:69663384-69663406 TGACTGTAAATGACAGTGTGAGG - Intergenic
1012115011 6:95285801-95285823 TGTCTCCCAATCTCAGTGGGAGG + Intergenic
1012368357 6:98470887-98470909 CGTCTCTCAACCACAGTGTGGGG + Intergenic
1013414340 6:109911610-109911632 TGTCTCTCAATTACTGTGGAAGG + Intergenic
1015087501 6:129313030-129313052 AGTCTCTGAATCACAGGTTGTGG - Exonic
1015232415 6:130930733-130930755 TGTCTCTCAATAATGGTGTCTGG - Intronic
1017065821 6:150528239-150528261 CGTCTCTGAAGCACAGTGTGAGG - Intergenic
1017274536 6:152550768-152550790 TCACTCTCAATCAGAGTCTGTGG - Intronic
1017936743 6:159012177-159012199 TGTGTCTGAATCAGAGTATGAGG + Intergenic
1017979712 6:159390166-159390188 TGCCTTTGAAACACAGTGTGGGG - Intergenic
1021392411 7:20109563-20109585 TGTATCTCAGGCACATTGTGAGG + Intergenic
1022893577 7:34725997-34726019 GGTCTCTCAATCATAGTGGAAGG - Intronic
1024512042 7:50212169-50212191 TGTCTCCCAATGCCAGCGTGGGG - Intergenic
1024558401 7:50623215-50623237 TGTTTCTCAGTCTCAGTGTCTGG - Intronic
1026982034 7:74532588-74532610 TGTGTCTCCATCACTGGGTGGGG + Intronic
1029294110 7:99525862-99525884 TGACTCTGAATCACACTGGGTGG + Exonic
1031156994 7:118121817-118121839 TGTCACTCAGTCACGGTCTGTGG + Intergenic
1031433105 7:121697278-121697300 TTTCTCTTAATCACAGTGGGTGG + Intergenic
1035026079 7:155827183-155827205 TGACCCTCAATCACAGTGTGAGG + Intergenic
1035343743 7:158183734-158183756 TGTCTCCCCCTCACACTGTGGGG + Intronic
1035360380 7:158309458-158309480 TGACTCACGATCACAGGGTGAGG - Intronic
1036017025 8:4796561-4796583 TGTCTCCCACTCACTGTGGGAGG + Intronic
1036595378 8:10207112-10207134 TGTCTATTGATCACAGTTTGGGG + Intronic
1037049639 8:14355728-14355750 TCTGTGTCAATCACAGTGTCTGG + Intronic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1039744856 8:40415502-40415524 AGTCTCTCAATCAGACTATGTGG + Intergenic
1041785929 8:61634248-61634270 TGTCTTTAAATCACTGGGTGGGG - Intronic
1043072160 8:75651910-75651932 TGTCTCTGAATCCCAGGGTTGGG - Intergenic
1044904421 8:96985386-96985408 TGTCTCTCAATCTCACTCTCAGG + Intronic
1045910916 8:107408868-107408890 TTTCCCACAATCACAGTGTCAGG + Intronic
1046034054 8:108820324-108820346 TGTCTATCAATCACTAAGTGTGG + Intergenic
1046148253 8:110189737-110189759 AGGCTCTCAATCACAGGCTGTGG + Intergenic
1046923072 8:119755006-119755028 TGTCTGTAAAACACAGTGTCTGG - Intronic
1047718338 8:127616330-127616352 TGTTTCTCAAGGACATTGTGAGG - Intergenic
1048766992 8:137855275-137855297 TGTATGTGAATCACAGTGTCTGG + Intergenic
1048885638 8:138907157-138907179 TATTTCTCCATCACAGTGTGGGG + Intronic
1049331747 8:142058239-142058261 TTTCCCTCAATCACATTCTGGGG - Intergenic
1050345818 9:4685631-4685653 TATCTCTCAATCCCAGAGTCAGG - Intronic
1051014596 9:12459899-12459921 TGTCTCCCAATCTCTGTGGGAGG - Intergenic
1052448961 9:28601530-28601552 TGTCACTCAATCAGAGTGTGTGG + Intronic
1052964283 9:34327886-34327908 TGTCTCTAATTCACTGTGGGTGG - Intronic
1054774635 9:69114880-69114902 TCTCTCTTAATGACAGTGTGGGG - Intergenic
1056761067 9:89415314-89415336 TGGCTCCCAGGCACAGTGTGGGG + Intronic
1056867483 9:90242168-90242190 TGTGTCTGAGTCCCAGTGTGTGG - Intergenic
1057780753 9:98048099-98048121 TGTCTCTCAGTCAGGGGGTGTGG - Intergenic
1057862411 9:98651765-98651787 TGTCAACCAATCACAATGTGTGG + Intronic
1059516655 9:114902255-114902277 TGTCTCTCAACAACTTTGTGGGG + Intronic
1060914998 9:127383056-127383078 AGTCTCACAAGCACTGTGTGGGG - Intronic
1061808670 9:133149880-133149902 AGTCGCTCAACCCCAGTGTGAGG - Intergenic
1186880854 X:13864706-13864728 TGTCTTTCATACACAGTATGTGG - Intronic
1190035145 X:47015968-47015990 TGTCCCTAAATAACTGTGTGGGG - Intronic
1191823093 X:65334929-65334951 TATCTCTCAGTGGCAGTGTGGGG + Intergenic
1192996508 X:76518310-76518332 ACTCACTCAATCACAGGGTGAGG - Intergenic
1193183397 X:78484416-78484438 GGCCTCACAATCATAGTGTGAGG + Intergenic
1195870900 X:109484403-109484425 TGCCTCTTAATCACAGTATGGGG + Intergenic
1196923129 X:120604546-120604568 TGCCTCTAAATCACAGTGCACGG - Exonic
1197966721 X:132071353-132071375 TCTTTTTCAATCACAGTCTGTGG + Intergenic
1199867092 X:151861620-151861642 TGTGTCTTAATCACTGTGTGTGG + Intergenic