ID: 949510813

View in Genome Browser
Species Human (GRCh38)
Location 3:4765177-4765199
Sequence AAGGCTAAGCATAGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949510807_949510813 -1 Left 949510807 3:4765155-4765177 CCTCAATGACATGGAGGATGACA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG 0: 1
1: 0
2: 2
3: 15
4: 241
949510802_949510813 28 Left 949510802 3:4765126-4765148 CCTTGGTTCCAGAGTGGGAGTCG 0: 1
1: 0
2: 1
3: 5
4: 121
Right 949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG 0: 1
1: 0
2: 2
3: 15
4: 241
949510804_949510813 20 Left 949510804 3:4765134-4765156 CCAGAGTGGGAGTCGTGAAGGCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG 0: 1
1: 0
2: 2
3: 15
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949510813 Original CRISPR AAGGCTAAGCATAGGGGAGG TGG Intronic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
901210769 1:7524862-7524884 AAGGCTCAGCCAAGGGGAGAGGG - Intronic
901631837 1:10651843-10651865 AAGATCAAGCACAGGGGAGGGGG - Intronic
903573490 1:24323003-24323025 GAGGCTAAGCACAGAGGAAGCGG - Intronic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
905232608 1:36523848-36523870 AAGGCTATGGTTAGGGGAAGTGG - Intergenic
905690115 1:39936800-39936822 TAGGTAAAGCATAGGGCAGGTGG - Intergenic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
908531629 1:65039815-65039837 GAGGCTAAGCCTAGGGGAATGGG - Intergenic
909030577 1:70534307-70534329 AAAGGTCAGAATAGGGGAGGAGG - Intergenic
910302001 1:85716456-85716478 TAGGTTGAGCATAGGGGAGGAGG - Intergenic
910333337 1:86100856-86100878 AAGGCAAAGAATTGGGGATGGGG - Intronic
910914835 1:92277752-92277774 AGGGCTAGGTATAGGGGAGGGGG - Intronic
911178782 1:94843088-94843110 CAGGCTGGGCATAGGGGAAGAGG + Intronic
912704685 1:111903294-111903316 AAGGCTGAGCAGGTGGGAGGCGG + Intronic
914825000 1:151133540-151133562 GAGGCTCAGCCAAGGGGAGGCGG + Intronic
915914096 1:159930941-159930963 ATGGTTGAGCAGAGGGGAGGTGG - Intronic
916878967 1:169000419-169000441 AGTGGTATGCATAGGGGAGGGGG - Intergenic
916966083 1:169944628-169944650 GAGGGTAAGCAAAGGGGAAGAGG + Intronic
920641710 1:207758425-207758447 AAGACAAAGCACAAGGGAGGGGG + Intronic
921813465 1:219540730-219540752 AAGGGTGGGCATAGGTGAGGTGG - Intergenic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
923394505 1:233547845-233547867 AAGACTAAGCTAAGTGGAGGAGG - Intergenic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1063056565 10:2511000-2511022 AAAGCTAAGAAAAGGGGAGCTGG + Intergenic
1063395593 10:5684800-5684822 AAGGAAAAGAAAAGGGGAGGGGG - Intergenic
1064247672 10:13682231-13682253 AAGGCTAGGAATAGTGGCGGGGG - Intronic
1066600560 10:37101632-37101654 AGGACTAAACATAGGGTAGGAGG + Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1068597513 10:58919079-58919101 AAGGCTCAGCTCAGGGGATGTGG + Intergenic
1068658674 10:59601298-59601320 CAGGCTAAGCAAAAAGGAGGAGG + Intergenic
1068981965 10:63071786-63071808 ACGCCTAAACATATGGGAGGCGG - Intergenic
1070780720 10:79136061-79136083 AAGGCCAGGCCTGGGGGAGGAGG - Intronic
1071027349 10:81131299-81131321 AAGGCCAAGCAGAGAGAAGGGGG + Intergenic
1071275416 10:84049729-84049751 AAGGTTCAGCTTAGGGGAGGAGG + Intergenic
1072247426 10:93555633-93555655 ATGGATAAGGATAGGGGTGGGGG - Intergenic
1072795273 10:98349789-98349811 TGGGCTGAGCTTAGGGGAGGAGG + Intergenic
1072905956 10:99454098-99454120 GAGGCTGAGCATAGGGTGGGAGG - Intergenic
1073009216 10:100346939-100346961 AAGGAGAAACAGAGGGGAGGGGG + Intergenic
1073381832 10:103083852-103083874 CAGGCTTAGCATAGCAGAGGAGG - Exonic
1073653416 10:105386027-105386049 AAGATTGAACATAGGGGAGGGGG - Intergenic
1074090499 10:110248948-110248970 TAGACTTAGGATAGGGGAGGTGG + Intronic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077457448 11:2689406-2689428 AATGGGGAGCATAGGGGAGGAGG + Intronic
1078872123 11:15357446-15357468 AGGGCTAGGTATAGGGGAAGGGG - Intergenic
1079427799 11:20360194-20360216 AGGGGAAAGCATAGGGAAGGAGG - Intergenic
1080586848 11:33690302-33690324 AAGGTTTAGAAGAGGGGAGGAGG + Intergenic
1080697332 11:34613938-34613960 ATTGCTAAGAATAGGGGTGGGGG + Intergenic
1081272875 11:41108191-41108213 AAGGCTAAGGGTAGGGGAAGGGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083812149 11:65112099-65112121 AAGGCTAAGCGAAGGAGAGCTGG + Intronic
1084413308 11:69016246-69016268 AAGGCCCAGCCTAGTGGAGGAGG - Intergenic
1088242761 11:107788375-107788397 AGGGCAAAGCATGGGGGAAGGGG - Intergenic
1091072530 11:132581557-132581579 ATGGCTAAGCAATGGGGATGGGG + Intronic
1091768869 12:3138809-3138831 AAAGCCAAGCAAAGGGAAGGAGG - Intronic
1093541153 12:20286963-20286985 AAGGATAAGCATGGTGGAGCAGG + Intergenic
1094371924 12:29748431-29748453 AGGGCTAAGCTTTGGGGAAGAGG - Intronic
1094409448 12:30153398-30153420 AAGGGTCTGGATAGGGGAGGTGG - Intergenic
1095114078 12:38331409-38331431 AAAGCTTAGCATTAGGGAGGTGG - Intergenic
1095685794 12:45031862-45031884 AAAGTGAAGAATAGGGGAGGGGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097667360 12:62495416-62495438 AAGAGTAAGAATAGGGAAGGAGG + Intronic
1097851295 12:64412906-64412928 AGGGCAAAGTATAGGGGAAGGGG + Intronic
1101493041 12:105227676-105227698 ACTCCTAAGCATAGGGGAGGTGG - Intronic
1101640732 12:106584318-106584340 AAGAATGAGCCTAGGGGAGGGGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104484963 12:129143328-129143350 AGGGTGAAGCATGGGGGAGGGGG + Intronic
1104685999 12:130784530-130784552 AAGGCTAAGGTTGGGGGAGTGGG + Intergenic
1106057158 13:26249143-26249165 AAGGTTGAGTATAGGAGAGGAGG - Intergenic
1106149676 13:27087076-27087098 AAGTCAAAGCAGAGGGGAAGGGG + Intronic
1109368999 13:61397123-61397145 AAGGATAAGCAAAGGGCATGGGG + Intergenic
1109589530 13:64459898-64459920 AAGGCTAAGCATAGTGAATCTGG - Intergenic
1110621772 13:77604434-77604456 AATGCCAAACAAAGGGGAGGGGG - Intronic
1111639711 13:90952204-90952226 AATGCTAAGCACTGGGGAGAAGG - Intergenic
1114567927 14:23646075-23646097 GAGGCTCAGCACAGTGGAGGGGG + Intergenic
1115320642 14:32076749-32076771 AGGGAGAAGCAGAGGGGAGGAGG + Intronic
1117955966 14:61123849-61123871 AAGGAAGACCATAGGGGAGGGGG - Intergenic
1118322145 14:64759474-64759496 AAGGCTAATAAGAGGGGATGAGG + Intronic
1120146029 14:80979354-80979376 AAGGCTGTGCAGAGGGTAGGGGG + Intronic
1120296307 14:82646447-82646469 AAGGCAAGGTATAGGGCAGGAGG + Intergenic
1121559118 14:94861444-94861466 AATGCTCAGGCTAGGGGAGGTGG + Intergenic
1122793460 14:104194091-104194113 AGGGCTGGGCAGAGGGGAGGGGG + Intergenic
1122896672 14:104761007-104761029 AAGCCTTGGGATAGGGGAGGAGG - Intronic
1122905383 14:104799354-104799376 AAGGCCAAGCAGTGGGGTGGGGG - Intergenic
1123926569 15:25118345-25118367 TAGGCAATGCATAGGTGAGGAGG - Intergenic
1127830894 15:62750198-62750220 AATGCTCATTATAGGGGAGGGGG - Intronic
1129061470 15:72863796-72863818 AAGGGCACGCAGAGGGGAGGAGG + Intergenic
1129109161 15:73327738-73327760 GAGGATGAGCATAGGGGTGGTGG - Intronic
1129917768 15:79289458-79289480 AGACCTGAGCATAGGGGAGGAGG + Intergenic
1132067531 15:98744489-98744511 ATGGCTGTGCACAGGGGAGGTGG + Intronic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1133060425 16:3171191-3171213 AAGCCCAACCAGAGGGGAGGAGG + Intergenic
1134648975 16:15893279-15893301 AGGGCAAAGTATAGGGGAAGGGG - Intergenic
1137444637 16:48524142-48524164 AAGCCTTAGCATGGGGAAGGGGG + Intergenic
1137526035 16:49237098-49237120 AAGGGCAAGCATTTGGGAGGAGG + Intergenic
1139256724 16:65549749-65549771 AAGGCTGAAAATAGGGGTGGGGG - Intergenic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1144048029 17:11470825-11470847 AAGGGTGAGCATAGGTTAGGGGG + Intronic
1145921207 17:28611525-28611547 ATGGGTAAGCATTGGGCAGGAGG - Intronic
1146429076 17:32773585-32773607 AAGGTTGACCATAGTGGAGGAGG - Intronic
1148201793 17:45754120-45754142 GAGGCTGGGCTTAGGGGAGGTGG - Intergenic
1149225093 17:54460791-54460813 AAGGTTAAGTATAGGGGGTGCGG + Intergenic
1150675344 17:67241484-67241506 AAGGCTAAGAATAGTGCAGAGGG - Intronic
1152292043 17:79445569-79445591 AAGGGAAATCACAGGGGAGGAGG - Intronic
1152482623 17:80565373-80565395 AAGGCAAAGGGAAGGGGAGGTGG + Intronic
1152698638 17:81808281-81808303 GGGGCTAAGAATAGGTGAGGAGG + Intronic
1153074188 18:1143937-1143959 AAGGATTAGAAAAGGGGAGGGGG + Intergenic
1153321550 18:3778799-3778821 ATGGATAAGCAGAGGGGATGAGG + Intronic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1156962600 18:43050862-43050884 AGGGCAAAGTATAGGGGAAGGGG - Intronic
1157075958 18:44467804-44467826 AGGGCAGAGCAGAGGGGAGGAGG - Intergenic
1157642805 18:49234501-49234523 AAGCCACAGGATAGGGGAGGAGG - Intronic
1160839653 19:1140458-1140480 AAGGCTGAGCAGAAGTGAGGGGG + Intronic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
1162144575 19:8605769-8605791 AAGGCTGTGAACAGGGGAGGCGG - Exonic
1162575845 19:11498266-11498288 GAGGCTCAGCCTGGGGGAGGTGG - Intronic
1162598377 19:11647210-11647232 AAGGGTATTCCTAGGGGAGGGGG + Intergenic
1166774372 19:45303360-45303382 TAGGGTCAGCATTGGGGAGGGGG - Exonic
1166775267 19:45308316-45308338 AGGGCTTAGTATAGGGGAAGGGG + Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925616085 2:5745661-5745683 AAGGCTAGCCTTAGGTGAGGTGG - Intergenic
926224244 2:10955951-10955973 AAGACTATGCATAGGGGTAGGGG - Intergenic
926435776 2:12836095-12836117 TAGGGGAAGCATGGGGGAGGAGG - Intergenic
926939749 2:18122728-18122750 AAGGCTAAGATGAAGGGAGGAGG + Intronic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
932443374 2:71753493-71753515 GAGGCCAAGCATAGAGGAAGTGG + Intergenic
935681025 2:105637038-105637060 AAGGCGCAGCAGAGGGGAGCAGG + Intergenic
935921246 2:108017883-108017905 AAGGCTCAACATAGAGTAGGAGG - Intergenic
939169353 2:138676467-138676489 ATGGGTAAGCAGTGGGGAGGTGG - Intronic
940333411 2:152500377-152500399 GGGGCTAAGCAGAGAGGAGGAGG - Intronic
941273210 2:163456758-163456780 AAGGAGAAGCAAAGAGGAGGGGG + Intergenic
941692323 2:168513904-168513926 AAGGCAAAGCTGAGGGGAGGTGG - Intronic
942616677 2:177798242-177798264 TAGGGGAAGCATAGAGGAGGGGG - Intronic
942799344 2:179858924-179858946 AAGTCTAAGGGCAGGGGAGGCGG + Intronic
943325545 2:186493317-186493339 AACACTAAGCACAGAGGAGGTGG + Intronic
943339163 2:186656789-186656811 AAGCCTAAGGAGAGGGCAGGTGG + Intronic
945056931 2:205877583-205877605 AAGGCTGAGCATGGGGGAGAAGG - Intergenic
945794771 2:214348629-214348651 AAGGCTAAGCCTAGCTGAGATGG - Intronic
945820926 2:214664431-214664453 AAGGCTAGAGATAGGGGAGGGGG - Intergenic
947447980 2:230179310-230179332 AAGGCTAGGCATGGGGGTGGAGG + Intronic
947579672 2:231307228-231307250 AGGGGTAAGTATAGGTGAGGTGG + Intronic
947689712 2:232123495-232123517 GGGGGTAAGAATAGGGGAGGGGG - Intronic
949070089 2:242019264-242019286 AAGGCTAAGTCCAAGGGAGGGGG + Intergenic
1170218412 20:13916351-13916373 ATGCCTAAGCATAGGGCAGGTGG - Intronic
1170443166 20:16398878-16398900 AGGGCTTAGCACAGAGGAGGAGG + Intronic
1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG + Intergenic
1172946599 20:38693969-38693991 CAGCCTAAGCATAGAAGAGGAGG - Intergenic
1174007221 20:47420290-47420312 AAGGGCAAGCAGAGAGGAGGAGG + Intergenic
1174330161 20:49811772-49811794 AAGGCCAAACGTAGGAGAGGTGG + Intergenic
1174508695 20:51034696-51034718 TAGGAGAAGCATGGGGGAGGGGG - Intergenic
1174571549 20:51505669-51505691 AAGGCCAAGCATCTGGGATGTGG - Intronic
1175138740 20:56843899-56843921 AAGGCTAATTGTAGGGGATGGGG + Intergenic
1177527094 21:22308148-22308170 AGGGGAAAGCATAGAGGAGGAGG + Intergenic
1178102979 21:29290333-29290355 CAGGCTAAGCATAGCAGAGCAGG - Intronic
1181283259 22:21735059-21735081 AGAGCCAAGCATGGGGGAGGCGG + Intronic
1183624292 22:38992199-38992221 AAGGCAAGGCACAGGGGAGCGGG - Intronic
1185024275 22:48398726-48398748 AAGGCTGAGCAGTGGGCAGGAGG - Intergenic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950004875 3:9685226-9685248 TCGGCTCAGCAAAGGGGAGGAGG + Exonic
952945723 3:38477024-38477046 AGGCCTAAGCAAAAGGGAGGAGG - Intronic
953448113 3:42984690-42984712 AAAGCTTAGCTTAGGGGAAGAGG + Intronic
954233650 3:49238803-49238825 AAGGATTATCAAAGGGGAGGGGG + Intronic
955151834 3:56375217-56375239 AGGGCTAAGCATGGGAGAGCGGG + Intronic
957615408 3:82519877-82519899 CAGGCTAAGTATAGTGGAGAAGG - Intergenic
958028464 3:88077172-88077194 AAGAATCAGAATAGGGGAGGAGG + Intronic
959595481 3:108124600-108124622 AAGGCTTAGCATGGGTGTGGAGG + Intergenic
961023946 3:123535699-123535721 AAGGCTCAGCATGGATGAGGTGG - Intronic
962693465 3:137924887-137924909 AAGGGAAACCATAGGGCAGGTGG - Intergenic
965387282 3:168059998-168060020 AAGTCAAAGCATAAGGGAAGGGG + Intronic
966755355 3:183365384-183365406 AAGGCAAAGCTTAAGGGATGGGG + Intronic
967125192 3:186416919-186416941 CAAGCTTAGCATAGGTGAGGAGG - Intergenic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
976225054 4:82789323-82789345 GAGGGGAAGCAAAGGGGAGGAGG + Intronic
977250247 4:94681368-94681390 CAGGCAAAGCATAGTGCAGGTGG + Intergenic
978111129 4:104964787-104964809 AAGTTTAAAAATAGGGGAGGAGG - Intergenic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
980625046 4:135364336-135364358 AATGCTATGTTTAGGGGAGGGGG + Intergenic
982073280 4:151714366-151714388 AAGGATGAGCAAAGGAGAGGGGG + Intronic
983413335 4:167424929-167424951 AAGGCAAAGCAGAGGAGGGGTGG - Intergenic
984528901 4:180890937-180890959 AAGGCTAATCATAGCAGAAGGGG - Intergenic
985380966 4:189394276-189394298 TAGGCTTAGCATCTGGGAGGAGG + Intergenic
985479165 5:96771-96793 AAAGAAAAGCATAGGGAAGGGGG + Intergenic
985689358 5:1298570-1298592 GAGACTAACCATAGGGGAGTGGG - Intergenic
987508373 5:18801527-18801549 AAGACTCAGAAGAGGGGAGGGGG - Intergenic
988876819 5:35456250-35456272 AAGGCAAGACTTAGGGGAGGTGG - Intergenic
991692385 5:69237505-69237527 ATAGCAAAGCATAGGGAAGGAGG - Intronic
992368387 5:76116495-76116517 AAGGCGAGGCTTAGGGAAGGCGG - Intronic
992644324 5:78797900-78797922 AAGGCAAAGCATAGGGGAAGGGG + Intronic
992673063 5:79078829-79078851 AAGAGTAAGGATAAGGGAGGAGG + Intronic
995199218 5:109409071-109409093 AAGTTGAAGCAAAGGGGAGGTGG - Intronic
997585977 5:135043753-135043775 AAGGCAGGGCATAGGGGAAGAGG + Intronic
997801951 5:136872468-136872490 AAGGCAAGGGATAGGGGAAGAGG + Intergenic
997818111 5:137037311-137037333 TAGGCTAGGCACAGGGGATGAGG - Intronic
999360027 5:150976327-150976349 AAGGCTAAGTTTGGGGGAGATGG - Intergenic
1001600160 5:172923343-172923365 TAGTCTAAGCATCTGGGAGGAGG + Intronic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002179633 5:177424393-177424415 AAGGATAAGCTGAGGGGAGGGGG - Intronic
1009890944 6:69681136-69681158 AACACTAAACATGGGGGAGGGGG + Intronic
1009947304 6:70354713-70354735 ATGGCTAAGAACAGGGAAGGAGG - Intergenic
1010401655 6:75453170-75453192 AAAGCAAAGCAAAGGGGAGAAGG - Intronic
1012526218 6:100181273-100181295 AAGGCTATGCATGTGGGAGGAGG - Intergenic
1012641142 6:101616026-101616048 TAGGCTAAGCCTAGGGGAGGAGG - Intronic
1013610237 6:111787965-111787987 AAGGCAAGGCATGAGGGAGGAGG - Intronic
1015331240 6:131981777-131981799 AAGGCAAAGCAAAGGAGTGGAGG - Intergenic
1016305606 6:142680512-142680534 AAAGCCAAGCTGAGGGGAGGTGG + Intergenic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1016938469 6:149465882-149465904 CAGCCCAACCATAGGGGAGGGGG + Intronic
1017519732 6:155191405-155191427 ATGGCTAAGAACAGGGTAGGAGG - Intronic
1019812076 7:3172149-3172171 AACGCCAAGCACAGGGGAGAGGG + Intronic
1022427430 7:30282788-30282810 AAGGCTCACCAGAGAGGAGGTGG + Intergenic
1022638154 7:32156539-32156561 AAGGCCCAGCAGAGGCGAGGTGG - Intronic
1022653001 7:32294117-32294139 GAGGCTAAGCTGAAGGGAGGAGG - Intronic
1023626383 7:42119079-42119101 AAGGCTCAGCCAAGGGAAGGAGG + Intronic
1023684175 7:42717925-42717947 AAGGCTAATTATGGAGGAGGAGG - Intergenic
1025627155 7:63232860-63232882 AAGGCTATGCACAAGGGAAGCGG - Intergenic
1027502545 7:78971212-78971234 ATGCCTCAGCATATGGGAGGAGG + Intronic
1028562834 7:92194268-92194290 AAGGTTAAGGATAGGTGTGGGGG - Intergenic
1028638343 7:93016047-93016069 AAGGCCCAGCAAAGGGAAGGGGG - Intergenic
1029292862 7:99515960-99515982 ATGGCTCAGAAGAGGGGAGGAGG - Intronic
1030894220 7:115037599-115037621 AAGGCTAAGGCTAGGGCAGTGGG + Intergenic
1032047091 7:128619794-128619816 AAGGCTGGCCAAAGGGGAGGTGG - Intergenic
1032419921 7:131770304-131770326 AAGGCTAAAGATAGGTGAGGTGG + Intergenic
1032785950 7:135199508-135199530 AAGGCTAAGATCTGGGGAGGTGG + Intronic
1033653985 7:143361615-143361637 AAGGGGAAGAATGGGGGAGGGGG + Intronic
1034244922 7:149636832-149636854 AGGGCTGACCCTAGGGGAGGTGG + Intergenic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1034907947 7:154967104-154967126 ACGGCTAAGCAGAGGTGGGGTGG - Intronic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1041593355 8:59617647-59617669 AATGCCAAGAATAGGGTAGGAGG + Intergenic
1042340245 8:67671298-67671320 AAAGCCTAGGATAGGGGAGGTGG - Intronic
1043313988 8:78897198-78897220 ATTGCTAAGTATAGGGAAGGTGG + Intergenic
1043870819 8:85429768-85429790 AAGGATTAGCAGTGGGGAGGCGG + Intronic
1047781095 8:128111747-128111769 AAGGCTAGGCCTAGAAGAGGAGG + Intergenic
1048835560 8:138515513-138515535 AAGGCTATGCAAGAGGGAGGGGG + Intergenic
1048869993 8:138789417-138789439 CAGGCTAAGAATAGGAGATGGGG + Intronic
1048918849 8:139209639-139209661 CAGGCTAAGAATAGGAGATGGGG + Intergenic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1052816974 9:33109323-33109345 AGGGCAAGGCATGGGGGAGGGGG - Intronic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1057110684 9:92467816-92467838 AAGGGTAAGCCTAGGAGAAGAGG + Intronic
1061384678 9:130282214-130282236 AAGGCTCAGCAAATGGGAAGAGG - Intergenic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1185511526 X:668006-668028 AAGGGGAAGGAGAGGGGAGGAGG - Intergenic
1188352195 X:29145454-29145476 AAGGAGAAGCATAGGAGACGGGG - Intronic
1188514674 X:30972453-30972475 AAGGCAGAGCATATGGGAGAGGG + Intronic
1192424140 X:71060705-71060727 AAGGCTAACCTGGGGGGAGGGGG - Exonic
1194366032 X:93014828-93014850 AAAGCTTAGCAAAGGGGAAGAGG - Intergenic
1196141259 X:112265799-112265821 AAGGTTATGCATGGAGGAGGAGG - Intergenic
1199947990 X:152682727-152682749 AAGGCTGAGGGTAGGGCAGGTGG - Intergenic
1199961689 X:152785727-152785749 AAGGCTGAGGGTAGGGCAGGTGG + Intergenic
1200674256 Y:6131087-6131109 AAAGCTTAGCACAGGGGAAGAGG - Intergenic
1201965902 Y:19735449-19735471 AAGGATGAGCAAAGTGGAGGTGG - Exonic