ID: 949516877

View in Genome Browser
Species Human (GRCh38)
Location 3:4815306-4815328
Sequence TGCCTGCCCAGTTATGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949516865_949516877 26 Left 949516865 3:4815257-4815279 CCCAGCGTGGCAGAGGCATGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 949516877 3:4815306-4815328 TGCCTGCCCAGTTATGCGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137
949516867_949516877 25 Left 949516867 3:4815258-4815280 CCAGCGTGGCAGAGGCATGTGGA 0: 1
1: 0
2: 0
3: 10
4: 258
Right 949516877 3:4815306-4815328 TGCCTGCCCAGTTATGCGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949516877 Original CRISPR TGCCTGCCCAGTTATGCGGG AGG Intronic
900222824 1:1518478-1518500 TGCGTGCCCATGTGTGCGGGGGG - Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
906140934 1:43532917-43532939 TGCGGGCCCAGGTATGCGAGAGG - Intronic
911636911 1:100246134-100246156 TGCCTGCCCAGTTACTTGGGAGG + Intronic
917281425 1:173380917-173380939 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
917627645 1:176862336-176862358 TTCCTTCCCAGTCATGAGGGTGG + Exonic
918154388 1:181831402-181831424 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1063321241 10:5054482-5054504 TGCCTGTCCAGTTAGTGGGGAGG + Intronic
1066613781 10:37276692-37276714 TGCCTGTCCAGTTAGTGGGGAGG + Intronic
1068404698 10:56574082-56574104 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1068501118 10:57840724-57840746 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1076189591 10:128473597-128473619 TGACTGCCCAGTGCTGCGAGTGG + Intergenic
1076438603 10:130463536-130463558 TGACTGCCCAGTTGTGTGGGAGG - Intergenic
1079356326 11:19732947-19732969 TGCCTGCACAATTATGCAGTTGG + Intronic
1083230770 11:61317233-61317255 TGCCTTCCCAGCTACTCGGGAGG - Intronic
1085569563 11:77547472-77547494 TGCGTGCCCAGTTACTCAGGAGG - Intronic
1091235445 11:134019335-134019357 TGCGGTCCCAGCTATGCGGGAGG - Intergenic
1102967594 12:117140253-117140275 TGCATTCCCAGCTATTCGGGAGG + Intergenic
1104337589 12:127914313-127914335 TGCTTGCCAAGTTGTGAGGGAGG + Intergenic
1107533725 13:41308563-41308585 TGCTTGCTCAGTTCTCCGGGTGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1122508466 14:102247367-102247389 TGCCTGTCCAGTTAGAGGGGAGG - Intronic
1122916914 14:104863722-104863744 TGGCTGCCCAATTGTGTGGGTGG - Intergenic
1123026116 14:105425068-105425090 TGCCTGGCCAGGTACCCGGGAGG + Intronic
1125277514 15:38008844-38008866 TGCCTGCACAGGTGTGCAGGTGG - Intergenic
1125920410 15:43522115-43522137 TGCCTGCCCACTTTTGCATGAGG - Exonic
1130707149 15:86243896-86243918 TGGAATCCCAGTTATGCGGGAGG + Intronic
1131411777 15:92213517-92213539 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1132147081 15:99435408-99435430 AGCCTGCCCAGGTGTGCAGGCGG + Intergenic
1132977940 16:2719866-2719888 GTGCTGCCCAGTTATGCCGGTGG + Intronic
1133033082 16:3020923-3020945 TCAGTGCCCAGCTATGCGGGGGG + Intronic
1138161877 16:54762254-54762276 TTCCTGGCCAGTTCTGCTGGAGG - Intergenic
1138839857 16:60487385-60487407 TGCCTCCCCAGTTTTTGGGGTGG - Intergenic
1139528053 16:67528684-67528706 GGCCTGCCCCGTTATCCGAGAGG + Intronic
1140038385 16:71388874-71388896 TCCCAGCCCAGCTATTCGGGAGG + Intronic
1145973465 17:28970527-28970549 TGACTGACCAGGTATGAGGGAGG - Intronic
1146311312 17:31770502-31770524 TGCCTGTCCAGTTAGTCGGGAGG - Intergenic
1148662839 17:49349275-49349297 TGCCAGGCCAGCTATTCGGGAGG + Intronic
1157857098 18:51113179-51113201 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1158143685 18:54285990-54286012 TGCCTTCCCAGCTATTCTGGCGG - Intronic
1158412220 18:57217442-57217464 TGCATTCCCAGCTACGCGGGAGG - Intergenic
1158715493 18:59875632-59875654 TGTATTCCCAGTTACGCGGGAGG - Intergenic
1159107106 18:64015175-64015197 GGCCTGCCCAGTTGTGGGGGTGG + Intergenic
1160891627 19:1381679-1381701 TGCCTGCACAGTTCTGAGGCAGG - Intergenic
1163246777 19:16100694-16100716 TGCAGTCCCAGCTATGCGGGAGG + Intronic
1163834944 19:19567553-19567575 TGCCTGCCCAGGTGGGAGGGCGG + Intronic
925742498 2:7018323-7018345 TGTCTGCCCAGCCCTGCGGGAGG - Intronic
926149281 2:10415697-10415719 TGCCATCCCTGTTATTCGGGGGG + Intronic
927923917 2:26996274-26996296 TGTATTCCCAGTTATTCGGGAGG - Intronic
929159246 2:38815186-38815208 TGTCTTCCCAGCTATGTGGGAGG - Intronic
929775219 2:44926637-44926659 TCCCTGCCCAGTTGGGTGGGGGG + Intergenic
930039003 2:47106257-47106279 TGCCTGTCCAGTTAGTGGGGAGG - Intronic
934763213 2:96867563-96867585 TGCCTGCCCAGGTGTGGGAGGGG - Intronic
938053454 2:128195898-128195920 TGCCTGCCAAGTTCTGCCTGGGG - Intergenic
938153338 2:128904864-128904886 TGCCTGTCCAGTTAGTGGGGCGG + Intergenic
939852444 2:147317874-147317896 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
942995907 2:182259797-182259819 TGCCTGCCCTGCTATGCATGAGG + Intronic
946206127 2:218110084-218110106 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
946214509 2:218173722-218173744 TGTCATCCCAGCTATGCGGGAGG + Intergenic
947213174 2:227726287-227726309 TGCCGTCCCAGCTATGCGGAAGG + Intergenic
947425755 2:229981578-229981600 TGCCTGCCCAGTTACTCAGGAGG + Intronic
947849112 2:233270598-233270620 TGCCTGCCATGTAATGCGGTGGG + Intronic
948247755 2:236500822-236500844 TGCCTGCCCAGCTACTCGGGAGG - Intronic
948502561 2:238406103-238406125 CCCCTGCCCAGTTTTGTGGGTGG + Intergenic
948575583 2:238947376-238947398 TGCCTGCTCAGTGGAGCGGGAGG + Intergenic
948575605 2:238947458-238947480 TGCCTGCTCAGTGGAGCGGGAGG + Intergenic
1172144311 20:32745465-32745487 TGCATTCCCAGCTATTCGGGAGG - Intergenic
1177481453 21:21695148-21695170 TGCCTGTCCGGTAATGAGGGAGG - Intergenic
1183452679 22:37905662-37905684 TCCCTGCCAAGCTATGGGGGAGG + Intronic
1183505048 22:38203990-38204012 TTCCTGCCCAGCTTTGAGGGTGG - Intronic
1184627639 22:45749681-45749703 TGCAGTCCCAGTTATGTGGGAGG - Intronic
949516877 3:4815306-4815328 TGCCTGCCCAGTTATGCGGGAGG + Intronic
951313928 3:21164952-21164974 TGCCTTCACAGTAATGGGGGAGG - Intergenic
951425611 3:22541944-22541966 TGGCTGCCCAGATCTGTGGGAGG - Intergenic
954041578 3:47891834-47891856 TGGCTGCCCAGTGATTGGGGTGG - Intronic
954653010 3:52176662-52176684 TGCATGCACAGGTATGCGAGTGG + Intergenic
957501176 3:81058475-81058497 TGCATGCCCAGCTACGCAGGAGG - Intergenic
963620661 3:147601432-147601454 TGCCTGCCCAGCTACTCAGGAGG - Intergenic
964596825 3:158442146-158442168 TGGCTGCCCATTGATGAGGGTGG + Intronic
964815691 3:160715561-160715583 TGTAATCCCAGTTATGCGGGAGG + Intergenic
968624550 4:1621223-1621245 TGTAGTCCCAGTTATGCGGGAGG - Intronic
977884971 4:102244036-102244058 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
980176453 4:129351596-129351618 TGTCTGCCCATTTATGGGGCCGG + Intergenic
984939127 4:184916305-184916327 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
990164995 5:52985027-52985049 TGCCTGCCCAGCTACTCGGGAGG + Intergenic
990484755 5:56247207-56247229 TGTCTGCCCAGTTATGGGGAGGG - Intergenic
994078095 5:95675941-95675963 TGTATGCCCAGTTACTCGGGAGG - Intronic
994230953 5:97310254-97310276 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
995707209 5:114998334-114998356 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
996681002 5:126228115-126228137 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
997534757 5:134610614-134610636 TGCCTGCCCAGCTACTTGGGAGG + Intronic
997604900 5:135167818-135167840 TGACAGCCCAGGTATGGGGGAGG + Intronic
998019090 5:138754351-138754373 TGGCTTCCCAGTAATGCAGGCGG + Intronic
998112129 5:139510431-139510453 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
998713071 5:144848845-144848867 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
998863182 5:146465896-146465918 TGCATGCCCAGCTACTCGGGAGG + Intronic
1000085672 5:157885852-157885874 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1000309529 5:160028770-160028792 GGCCTGCCCAGTTTTGTGGTTGG + Intronic
1003326511 6:5095856-5095878 TGCCGTCCCAGCTATTCGGGAGG + Intergenic
1003889952 6:10555401-10555423 TGCCTGCCCAGTTAAGCTTATGG - Intronic
1004532117 6:16463269-16463291 TGCCTGTCCAGTTAGTGGGGAGG - Intronic
1006589269 6:35142069-35142091 TGCATTCCCAGCTATTCGGGAGG + Intronic
1006867729 6:37222555-37222577 TGCCTGCTCAGTGAAGTGGGAGG + Intronic
1010175931 6:73028063-73028085 TGCCTGCCAAGATATGGGGCTGG + Intronic
1013907063 6:115233138-115233160 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1014799230 6:125759328-125759350 CGGCGGCCCAGTGATGCGGGTGG - Exonic
1016355288 6:143211769-143211791 TGTAAGCCCAGTTATTCGGGAGG + Intronic
1017101741 6:150855062-150855084 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1028494459 7:91448322-91448344 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1032722723 7:134563997-134564019 TGCCTGTCCAGTTGGTCGGGAGG - Intronic
1032800330 7:135312657-135312679 TGACTGCCCAGTTCTTCTGGTGG - Intergenic
1033758800 7:144419280-144419302 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1035297265 7:157874208-157874230 AGCCTGCCCAGTTGTGGAGGGGG - Intronic
1035356100 7:158276809-158276831 TGCCTCCCCAGGTGTGCGGGCGG + Intronic
1038287640 8:26219834-26219856 TGCATGCCAAGTTGTGCTGGAGG - Intergenic
1039999029 8:42561051-42561073 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1040649707 8:49434165-49434187 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1040999681 8:53438258-53438280 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1041670060 8:60482960-60482982 TGCCTCCCCAGGTATGTGAGAGG + Intergenic
1042075339 8:64987789-64987811 TGTCGTCCCAGCTATGCGGGAGG - Intergenic
1044171641 8:89060167-89060189 TGTATTCCCAGCTATGCGGGAGG + Intergenic
1045858770 8:106792774-106792796 TGCCTGTCCAGTTAGTAGGGAGG - Intergenic
1051805695 9:20990388-20990410 TGCCTGCCCTGCTAAGCAGGTGG - Intronic
1052057019 9:23917828-23917850 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1052331451 9:27273769-27273791 TGCCTGCCCAGCTACTCAGGAGG + Intergenic
1055064487 9:72104895-72104917 TGCAGTCCCAGCTATGCGGGAGG + Intergenic
1056010194 9:82321100-82321122 TGCATGCCCAGTCATGGAGGTGG - Intergenic
1056392001 9:86149262-86149284 TGCCTGTCCAGTTAGAGGGGAGG + Intergenic
1056837406 9:89967783-89967805 TGCCAGCCCAGCTATACTGGGGG - Intergenic
1059250504 9:112883817-112883839 TGCAGTCCCAGTTATTCGGGAGG - Intronic
1061267789 9:129517783-129517805 TGCATTCCCAGCTATTCGGGAGG - Intergenic
1186438768 X:9567024-9567046 TGTGTGCCCAGTAATGCTGGAGG + Intronic
1186888025 X:13934306-13934328 TTCCTGCCCAGTTATTCAGCAGG + Intronic
1187644199 X:21328709-21328731 TGGCTGCTCAGTTCTGTGGGTGG - Intergenic
1191162140 X:57341296-57341318 TGCCTGCTCAGTTATTGGTGTGG + Exonic
1193699449 X:84743878-84743900 TGCCTGTCCAGTTAGAGGGGAGG - Intergenic
1195072888 X:101297959-101297981 TGCCTGCCGAGATAATCGGGAGG + Intergenic
1195552082 X:106182426-106182448 TGCCTGTCCAGTTAGTGGGGAGG + Intronic
1195554116 X:106201706-106201728 TGCCTGGCCAGTCTTGGGGGAGG + Intronic
1196489501 X:116249720-116249742 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1197144346 X:123154787-123154809 TGCAATCCCAGTTACGCGGGAGG + Intergenic
1199831975 X:151556489-151556511 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic
1201430329 Y:13896217-13896239 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1201495892 Y:14591166-14591188 TGCCTGTCCAGTTAGTGGGGAGG + Intronic
1201572832 Y:15432822-15432844 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1202258302 Y:22943009-22943031 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1202411292 Y:24576767-24576789 TGCCTGTCCAGTTAGTGGGGAGG - Intergenic
1202459489 Y:25093305-25093327 TGCCTGTCCAGTTAGTGGGGAGG + Intergenic