ID: 949516908

View in Genome Browser
Species Human (GRCh38)
Location 3:4815591-4815613
Sequence TCCCGTGCCTATAGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949516908_949516911 8 Left 949516908 3:4815591-4815613 CCTGGCACACTATAGGCACGGGA 0: 1
1: 0
2: 3
3: 8
4: 127
Right 949516911 3:4815622-4815644 AGTGAACGGCTACGTAAAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 34
949516908_949516910 -6 Left 949516908 3:4815591-4815613 CCTGGCACACTATAGGCACGGGA 0: 1
1: 0
2: 3
3: 8
4: 127
Right 949516910 3:4815608-4815630 ACGGGAGGAGAAGTAGTGAACGG 0: 1
1: 0
2: 1
3: 19
4: 247
949516908_949516912 15 Left 949516908 3:4815591-4815613 CCTGGCACACTATAGGCACGGGA 0: 1
1: 0
2: 3
3: 8
4: 127
Right 949516912 3:4815629-4815651 GGCTACGTAAAAGAGGTGCATGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949516908 Original CRISPR TCCCGTGCCTATAGTGTGCC AGG (reversed) Intronic
901132737 1:6972494-6972516 TCCCTTGCCTGCCGTGTGCCAGG + Intronic
902535073 1:17114949-17114971 TCCCCTCCCCATAGTGTGCCAGG - Intronic
903322486 1:22551371-22551393 CCCCGTGCCTGCTGTGTGCCAGG + Intergenic
904304925 1:29582447-29582469 TACAGGGCCTATTGTGTGCCAGG + Intergenic
908651135 1:66334450-66334472 ACCCGTGTCTACAGAGTGCCTGG - Intronic
913099119 1:115546690-115546712 TCAAGTGCCTACTGTGTGCCAGG + Intergenic
914352668 1:146853943-146853965 TATCGTGCTTATTGTGTGCCAGG - Intergenic
914712322 1:150225922-150225944 TTGAGTGCCTATAATGTGCCAGG + Intronic
915383855 1:155470842-155470864 TTTTGTGCCTATTGTGTGCCAGG - Intronic
916997223 1:170314009-170314031 TCAAGTGCCTAAAATGTGCCAGG - Intergenic
921200442 1:212800181-212800203 CCCAGTGCCTAAACTGTGCCTGG - Intronic
924355802 1:243174188-243174210 TCCAGGGCCTATTATGTGCCAGG - Intronic
1063020712 10:2124874-2124896 TCCAGTGCCTACCGTGTGCCAGG + Intergenic
1063892605 10:10645740-10645762 TCCTGTGCCTACAAAGTGCCTGG + Intergenic
1064444895 10:15384386-15384408 TCCCATGCCTAAAATGTGCCTGG - Intergenic
1067089777 10:43260624-43260646 TCCCGTGCCCATAGGAGGCCTGG + Intronic
1072542340 10:96407541-96407563 TCGAGTGCCTATGGTGTGCCAGG - Intronic
1073527058 10:104193546-104193568 TCATGTGTGTATAGTGTGCCAGG - Intronic
1075559328 10:123456992-123457014 TCACGTGCCAGGAGTGTGCCAGG + Intergenic
1076850369 10:133089396-133089418 TCCCGTGCCTGCCGTGTGCGCGG - Intronic
1085317422 11:75554050-75554072 CCCAGTGCCTGTGGTGTGCCAGG - Intergenic
1085763977 11:79266313-79266335 CCCTGTGCCTAGAGTGTGCTTGG - Intronic
1092291281 12:7160692-7160714 TCCCTTACCCATTGTGTGCCTGG + Intergenic
1094067730 12:26379108-26379130 TGCCATGCCCATAATGTGCCAGG - Intronic
1098452814 12:70639485-70639507 TCACGTGCCTAGTGTGTGCTGGG - Intronic
1101750415 12:107578922-107578944 TTAAGTGCCTACAGTGTGCCAGG + Intronic
1101925843 12:108970698-108970720 TCCTGTGCCTAGCATGTGCCTGG + Intronic
1103968079 12:124652778-124652800 TTGTGTGCCTAGAGTGTGCCAGG + Intergenic
1104010399 12:124926100-124926122 TCCCATGCCTCTGGTTTGCCTGG + Intergenic
1104420215 12:128628650-128628672 TTACGTGCCTACTGTGTGCCAGG - Intronic
1105843851 13:24278393-24278415 TCAGGTGCCTATAATGTGCTAGG - Intronic
1108363740 13:49690787-49690809 ACCCGTGTCTAATGTGTGCCAGG - Intronic
1108973997 13:56413342-56413364 TCCTGTGACTATAGTGTCACTGG - Intergenic
1112496252 13:99907358-99907380 TCCAGTGCCTACAGTGTGCCAGG - Intergenic
1113456885 13:110455632-110455654 TCCCGTGCCTATGCTGTGCCAGG - Intronic
1114946479 14:27688157-27688179 TCCCCTGCTTTTAGTGTGTCAGG + Intergenic
1117980149 14:61334808-61334830 TCCAGTGCCTATCTTGTGCTGGG - Intronic
1119345769 14:73922718-73922740 TTCAGTGCCTACTGTGTGCCTGG + Intronic
1121082770 14:91121745-91121767 TAAAATGCCTATAGTGTGCCAGG + Intronic
1121219956 14:92277843-92277865 TCCAGTGCCCACTGTGTGCCAGG + Intergenic
1122337844 14:101005598-101005620 TATCATGCCTATTGTGTGCCAGG + Intergenic
1122695045 14:103548356-103548378 TCCAGGGCCTCCAGTGTGCCCGG + Intergenic
1133894751 16:9915895-9915917 TCAAGTGCCTAGAGTGTGTCTGG - Intronic
1134805987 16:17125848-17125870 CCAAGTGCCTACAGTGTGCCAGG - Intronic
1136490411 16:30604375-30604397 TCCCCTGCCTCGAGTGTGGCCGG - Exonic
1137492764 16:48946519-48946541 TCCAGTGCCTACACAGTGCCTGG + Intergenic
1138912276 16:61415519-61415541 TCCAGGGCTTATATTGTGCCAGG - Intergenic
1139981361 16:70861575-70861597 TATCGTGCTTATTGTGTGCCAGG + Intronic
1140813261 16:78598720-78598742 GCCAGTGACTACAGTGTGCCTGG + Intronic
1140855750 16:78976146-78976168 TCCAGTGCCTACTCTGTGCCAGG - Intronic
1141027157 16:80559469-80559491 TCACGGGCATAAAGTGTGCCTGG - Intergenic
1142106454 16:88306190-88306212 TCAGGAGCCTACAGTGTGCCAGG + Intergenic
1143855583 17:9845531-9845553 TCAAATGCCTATTGTGTGCCAGG - Intronic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1145020447 17:19426384-19426406 TCCGATGCCTATATTGTGCTTGG - Intergenic
1146972868 17:37086799-37086821 TCCAGTGCCTACTGTGTGCTGGG + Exonic
1151261753 17:72921097-72921119 TGCAGTGCCTAGAATGTGCCAGG + Intronic
1152263409 17:79279281-79279303 TCGAGTGCCTACTGTGTGCCAGG - Intronic
1154369229 18:13743521-13743543 TCCTGTGTCTACAGTTTGCCAGG - Intronic
1155050532 18:22143512-22143534 TCCAGTGCCTACTTTGTGCCAGG - Intergenic
1159063639 18:63543446-63543468 TCAAGTGCCTATAATGTGTCAGG - Intergenic
1162342577 19:10100632-10100654 TTGAGTGCCTATTGTGTGCCAGG + Intronic
1162437641 19:10671759-10671781 CCCCGTGCCTATTGTGTGCCAGG + Intronic
1162576659 19:11503259-11503281 GACCCTGCCTATTGTGTGCCAGG - Intronic
925823789 2:7826315-7826337 TCACGTGCTTATTGTGTGCTGGG + Intergenic
927709305 2:25315048-25315070 GCCCCTGCCTTGAGTGTGCCAGG + Intronic
928902417 2:36334013-36334035 TGCCCTGCCTATTGTGTGTCAGG - Intergenic
930016027 2:46971107-46971129 TCCAGTACCTACTGTGTGCCAGG + Intronic
931139910 2:59445993-59446015 CCCCGTGCCTAGATTTTGCCTGG + Intergenic
931201532 2:60102106-60102128 TCCAATGCCTCTAGTGTGCCTGG - Intergenic
931630580 2:64295027-64295049 TTAAGTGCCTATTGTGTGCCAGG - Intergenic
934537956 2:95152036-95152058 TCACGTGCCTCCAGTGTGCTTGG + Intronic
935404923 2:102698948-102698970 ACACGTGCTTACAGTGTGCCAGG + Intronic
935706957 2:105865213-105865235 TCGAGTGCCTAAAGTGTGCTAGG + Intronic
938746417 2:134282602-134282624 TCCAGTGCCTAGACAGTGCCTGG - Intronic
939426613 2:142046624-142046646 TTTAGTGCCTATAATGTGCCAGG - Intronic
946725240 2:222655751-222655773 TCGAGTGCCTACAGCGTGCCTGG - Intronic
1170553704 20:17498745-17498767 TTGAGTGCCTATTGTGTGCCAGG - Intronic
1173693558 20:44986059-44986081 TTCAGTGCCTACTGTGTGCCAGG + Intronic
1173820252 20:46014759-46014781 TCAAGTGCCGATAATGTGCCAGG + Intronic
1174771734 20:53306788-53306810 TCGTGTGCCTACTGTGTGCCAGG + Intronic
1181485322 22:23227229-23227251 TTCCGTACCTACTGTGTGCCAGG + Intronic
1182163154 22:28144077-28144099 TCCTGAGCCTGTACTGTGCCAGG + Intronic
1182237973 22:28891486-28891508 TCAAGTGCTTATTGTGTGCCAGG + Intronic
1182828799 22:33288040-33288062 CCCCGTGCTTAATGTGTGCCAGG - Intronic
1183701609 22:39454310-39454332 CTCCGTGCCTACTGTGTGCCAGG + Intergenic
1185246257 22:49774901-49774923 CCACCTGCCTATGGTGTGCCTGG - Intronic
949516908 3:4815591-4815613 TCCCGTGCCTATAGTGTGCCAGG - Intronic
953659645 3:44882849-44882871 TCGAGTGCCTACTGTGTGCCAGG + Intronic
953842086 3:46397151-46397173 TCCCCTGCCTCTCGTGAGCCAGG + Intergenic
954917295 3:54159559-54159581 TCCGGTGCCTCCCGTGTGCCAGG + Intronic
955829774 3:62988664-62988686 TCAAATGCCTATTGTGTGCCAGG - Intergenic
956754734 3:72373498-72373520 TCCCATGGCTAGAGTGTGACAGG - Exonic
961464424 3:127072702-127072724 TCCAGTGCCAGTAGTGTGCATGG - Intergenic
961676939 3:128573427-128573449 TCCAGTGCCCACAATGTGCCAGG - Exonic
962875108 3:139529965-139529987 TCTCGTGCTTACTGTGTGCCAGG - Intronic
963630693 3:147726503-147726525 TCCCGTGCCTATGTTGTGAATGG - Intergenic
964711937 3:159680156-159680178 TTGCGTGCCTATTGTGTTCCAGG - Intronic
967528947 3:190527230-190527252 TCCTGTGCCTCTTGTGTACCAGG + Intronic
969371658 4:6735217-6735239 TCCGGAGTCTACAGTGTGCCGGG - Intergenic
973757576 4:54091026-54091048 TGGTGTGCCTATAGTATGCCAGG - Intronic
976812812 4:89114847-89114869 TTGAGTGCCTATAGTGTGCATGG - Exonic
979246010 4:118505443-118505465 TCCAGGGCCTATTATGTGCCAGG + Intergenic
982686413 4:158495137-158495159 TCTCATGCCTATAGTTTGCATGG - Intronic
990263552 5:54051054-54051076 TCAAGTGCCTATTCTGTGCCAGG - Intronic
997102678 5:130986473-130986495 TCCAGTACCTATTGTGTGCCAGG - Intergenic
997125457 5:131222464-131222486 TTCAGTGCTTATAATGTGCCAGG - Intergenic
999691293 5:154148108-154148130 TCCCATCCCTAGAGTGTGGCAGG + Intronic
1005215384 6:23521359-23521381 TCCTGTGTCTGGAGTGTGCCTGG + Intergenic
1006451576 6:34108706-34108728 TTCAGTGCCCACAGTGTGCCAGG + Intronic
1008792364 6:55252250-55252272 TCCAGTGCCAATAGTGACCCAGG - Intronic
1011463440 6:87630480-87630502 TCTAGTGCCTATTATGTGCCCGG + Intronic
1014100468 6:117506103-117506125 TTCAGTGCCTATTGTATGCCAGG + Intronic
1020698819 7:11451025-11451047 TCCCGTGCTTTCAGTCTGCCAGG - Intronic
1022523137 7:31020552-31020574 TCCAATGCCTATTCTGTGCCAGG - Intergenic
1026473693 7:70716138-70716160 TTGAGTGCCTACAGTGTGCCAGG + Intronic
1029898441 7:104011867-104011889 TCGAGTGCCTACAATGTGCCAGG + Intergenic
1033139099 7:138809148-138809170 TGCCGTGCATATGATGTGCCTGG - Intronic
1041451029 8:58007022-58007044 TTCAGTGCCTACAATGTGCCAGG + Intronic
1048264252 8:132971512-132971534 TTCTGTGCCTATTATGTGCCAGG - Intronic
1048276768 8:133071978-133072000 CCTCTTGCCTATACTGTGCCAGG - Intronic
1048450456 8:134528894-134528916 TCAAGCGCCTACAGTGTGCCTGG - Intronic
1051409014 9:16769753-16769775 TCCAGTGCTTATTGTGTGCCAGG - Intronic
1051777111 9:20646957-20646979 TGCCGTGGCTATTGTCTGCCCGG - Intergenic
1055558364 9:77498601-77498623 TCCTGTGCCCACTGTGTGCCAGG - Intronic
1056132149 9:83597486-83597508 TAACGTGCCTACTGTGTGCCAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1059472006 9:114512377-114512399 TCAAGTGCCTACTGTGTGCCAGG + Intergenic
1059764335 9:117369683-117369705 TCAAGTGCCTACAGTGTCCCAGG - Intronic
1060560028 9:124535147-124535169 TTTGGTGCCTATAGTGTGCCAGG - Intronic
1060823850 9:126676411-126676433 TGCGGTGCTTATTGTGTGCCAGG - Intronic
1061194615 9:129100931-129100953 TCCTGTGTCTAAAGTGGGCCAGG - Intronic
1062532153 9:137006739-137006761 TCTCCTGCCCACAGTGTGCCAGG + Intergenic
1062629242 9:137456273-137456295 CCACGTGCCTATGCTGTGCCAGG - Intronic
1187966710 X:24619307-24619329 TTCAGTGTCTATAGTATGCCAGG + Intronic
1188574726 X:31633439-31633461 TTCCGTACCTATTGTGTACCAGG + Intronic
1189351894 X:40281711-40281733 TCCTAAGCCTATTGTGTGCCTGG - Intergenic
1189556826 X:42153615-42153637 TTGAGTTCCTATAGTGTGCCAGG + Intergenic
1194932891 X:99910068-99910090 TCCCATCTCTATAGTCTGCCTGG + Intergenic