ID: 949517930

View in Genome Browser
Species Human (GRCh38)
Location 3:4824168-4824190
Sequence TGCACCAGCGCTGCCGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949517928_949517930 2 Left 949517928 3:4824143-4824165 CCATGGTAGCTAGAGTGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 386
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517927_949517930 3 Left 949517927 3:4824142-4824164 CCCATGGTAGCTAGAGTGTTCTG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517924_949517930 6 Left 949517924 3:4824139-4824161 CCCCCCATGGTAGCTAGAGTGTT 0: 1
1: 1
2: 0
3: 7
4: 67
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517925_949517930 5 Left 949517925 3:4824140-4824162 CCCCCATGGTAGCTAGAGTGTTC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517922_949517930 11 Left 949517922 3:4824134-4824156 CCTGCCCCCCCATGGTAGCTAGA 0: 1
1: 0
2: 1
3: 7
4: 139
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517926_949517930 4 Left 949517926 3:4824141-4824163 CCCCATGGTAGCTAGAGTGTTCT 0: 1
1: 0
2: 2
3: 20
4: 246
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60
949517923_949517930 7 Left 949517923 3:4824138-4824160 CCCCCCCATGGTAGCTAGAGTGT 0: 1
1: 0
2: 1
3: 8
4: 78
Right 949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949517930 Original CRISPR TGCACCAGCGCTGCCGTTTC TGG Intronic
900777670 1:4596702-4596724 TGCACCAGAGCTGACTTGTCTGG - Intergenic
901058448 1:6460531-6460553 TGCGCCAGCGACGCCGGTTCCGG - Exonic
907319388 1:53593226-53593248 AGGTCCAGCTCTGCCGTTTCTGG + Intronic
914923346 1:151862419-151862441 TGCTCCAGCCATGCCCTTTCAGG - Intergenic
917591371 1:176480277-176480299 TTATCCAGCGCTGCCCTTTCGGG - Intronic
1065442126 10:25763437-25763459 TGCATCAGGGCTGCACTTTCTGG + Intergenic
1071250561 10:83814863-83814885 TGCACCAAGGCAGCAGTTTCTGG - Intergenic
1076813349 10:132900353-132900375 TGCTCCAGGGCTGCCGTGGCTGG + Intronic
1079871922 11:25808618-25808640 TGCCCCAGCTCTTCCATTTCTGG + Intergenic
1090067999 11:123519644-123519666 TGCAGCAGCGCTGCAGTACCGGG - Intergenic
1096372969 12:51083761-51083783 TGCAGCAGAGCTGCCGCCTCGGG - Intergenic
1103909050 12:124341969-124341991 TTCTCCAGCGCCGCCGTGTCGGG + Exonic
1104924747 12:132308412-132308434 GGCCCCAGCGCTGCCCTTGCTGG + Intronic
1105294877 13:19079117-19079139 TGCACCATCCCTGCCATCTCTGG - Intergenic
1114577629 14:23728427-23728449 TGCACCAGGGCTGTCCTCTCTGG + Intergenic
1117733687 14:58749071-58749093 TGCACCAGATCTGTCATTTCTGG + Intergenic
1128081793 15:64861364-64861386 TGCCCCACCGCTGCCCTCTCTGG - Intronic
1129055362 15:72815956-72815978 TGCACCCCTGCTGCTGTTTCTGG - Intergenic
1131096829 15:89660914-89660936 TGCACCAGGGGTGCTATTTCAGG - Intergenic
1132107130 15:99071122-99071144 TGCTCCAGGGCTGCAGCTTCGGG + Intergenic
1132206934 15:99992836-99992858 TGCACCAGCACTGCCCCTTGGGG - Intronic
1132462808 16:63733-63755 TGCTCTTGCGCTGCCATTTCTGG + Exonic
1135995613 16:27245490-27245512 TGCTCCACCGCAGCCCTTTCAGG - Intronic
1136418891 16:30120233-30120255 TGGACCAGCCCTGCTGTTTTAGG + Intronic
1142408257 16:89903085-89903107 TCCACCAGTGCAGCCGTGTCTGG + Intronic
1147424770 17:40341346-40341368 AGCACCCGCGCTGCCGCGTCGGG + Intronic
1147626660 17:41904698-41904720 TGCAACAGTGGTGCAGTTTCTGG - Intronic
1153466864 18:5397626-5397648 TGAACCTGCGCTGCTGCTTCAGG + Intronic
1160450745 18:78964902-78964924 TGCACCAGCGCCGCCTTCTCCGG + Intergenic
1160450765 18:78964963-78964985 TGCACCAGCACTGCCTTCTCTGG + Intergenic
1160450783 18:78965025-78965047 TGCACCAGCGCCGCCTTCTCCGG + Intergenic
1160450802 18:78965086-78965108 TGCACCAGCGCCGCCTTCTCCGG + Intergenic
1160450820 18:78965147-78965169 TGCACCAGCGCCGCCTTCTCCGG + Intergenic
1160450839 18:78965208-78965230 TGCACCAGCACTGCCTTCTCCGG + Intergenic
1160450860 18:78965269-78965291 TGCACCAGCGCCGCCTTCTCTGG + Intergenic
1160558345 18:79740229-79740251 TGCACCACGCCTGCCGTTTGCGG + Intronic
925360597 2:3277973-3277995 TGCACCAGCACTCCCATTTCAGG + Intronic
933160992 2:79025194-79025216 TGAACCAGTGCTGCTGCTTCTGG + Intergenic
946178724 2:217937505-217937527 TCAACCAGCTCTGCCATTTCTGG + Intronic
947819919 2:233062400-233062422 TGCAACAGCCCTGGCTTTTCAGG + Intronic
948973457 2:241447656-241447678 TGCAACAGCTCTGCAGGTTCTGG + Intronic
1170795953 20:19546794-19546816 TGCACCAGAGCTGCCCCTCCTGG - Intronic
1172837021 20:37879487-37879509 TGCCCCAGCTCTGCTGTTCCAGG - Intergenic
1178049688 21:28733881-28733903 AGCAATAGCGCTGCCGTTGCTGG - Intergenic
1179984802 21:44914297-44914319 TGCACCAGCACTTCCTTCTCGGG - Intronic
949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG + Intronic
950675222 3:14550508-14550530 GGCACCAGCGGTGCCGCTGCGGG - Intergenic
954126709 3:48535457-48535479 TGCAGCAGCCCTGCGGTATCTGG + Intronic
954430821 3:50470116-50470138 TGCCCCAGCGCTGCCCTGCCAGG + Intronic
956405056 3:68919516-68919538 TGCACCAGCGCTGTCCGATCGGG + Intronic
961782249 3:129327091-129327113 TGGACCAGCTCTGCAGTTTCTGG - Intergenic
962304100 3:134270573-134270595 TGGACCAGCACTGCCATTCCAGG - Intergenic
962573471 3:136734966-136734988 TCCACCAGGCCTGCAGTTTCTGG + Intronic
964901949 3:161670744-161670766 TGCCCCACCACTGCCATTTCTGG - Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980184433 4:129444582-129444604 TTCACCAGTGCTGCAATTTCTGG + Intergenic
985145848 4:186893799-186893821 TGCACCAGTGCTGCTGCTGCAGG + Intergenic
1003179527 6:3780085-3780107 AGCACCAGCCCTGCCATGTCAGG - Intergenic
1009881654 6:69573995-69574017 TTCACCACTGCTGCCTTTTCTGG - Intergenic
1011282164 6:85688036-85688058 TGCAGCATCGCTGCCACTTCAGG + Intergenic
1013168117 6:107611900-107611922 TGCTCCAGAGCTCACGTTTCTGG - Intronic
1016917738 6:149260342-149260364 TGCTCCAGCGCAGCCTTCTCAGG + Intronic
1024971521 7:55075709-55075731 TGCACCACAGCTGCCTTCTCTGG + Intronic
1027361676 7:77416208-77416230 CGCACCTGCGCCGCCGCTTCCGG + Exonic
1031738299 7:125395628-125395650 TGCCCCAGCAATGCCGTTACTGG + Intergenic
1042480901 8:69301473-69301495 TTCACCAGGGCTGCCCTTACAGG - Intergenic
1049818200 8:144618281-144618303 AGCACCAGCCCTGCCCTTTCAGG - Intergenic
1052836657 9:33255157-33255179 GCCACCAGCTCTGCCGTCTCTGG - Exonic
1192160290 X:68781301-68781323 TGCCCCAGCGATCCCATTTCTGG + Intergenic
1195942611 X:110178310-110178332 TTCACCTGGGCTGCTGTTTCTGG + Intronic
1197551741 X:127900492-127900514 TGCCCCAGGGCTGCATTTTCTGG + Intergenic
1200164296 X:154025497-154025519 TGCCCCAGCGCTGACGTGTCAGG - Intronic