ID: 949518239

View in Genome Browser
Species Human (GRCh38)
Location 3:4826421-4826443
Sequence CCGTGGTGCCAGCTAACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949518239_949518245 5 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518245 3:4826449-4826471 TCAAGAATATCGGAGCAGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
949518239_949518244 2 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518244 3:4826446-4826468 GAGTCAAGAATATCGGAGCAGGG 0: 1
1: 0
2: 1
3: 1
4: 79
949518239_949518246 15 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518246 3:4826459-4826481 CGGAGCAGGGAGGAGTGAAGAGG 0: 1
1: 0
2: 2
3: 93
4: 824
949518239_949518249 28 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518249 3:4826472-4826494 AGTGAAGAGGGATTTGGCACTGG 0: 1
1: 0
2: 1
3: 19
4: 182
949518239_949518247 16 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518247 3:4826460-4826482 GGAGCAGGGAGGAGTGAAGAGGG 0: 1
1: 1
2: 21
3: 212
4: 1689
949518239_949518248 22 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518248 3:4826466-4826488 GGGAGGAGTGAAGAGGGATTTGG 0: 1
1: 0
2: 9
3: 78
4: 772
949518239_949518243 1 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518243 3:4826445-4826467 AGAGTCAAGAATATCGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 129
949518239_949518242 -5 Left 949518239 3:4826421-4826443 CCTGAAGTTAGCTGGCACCACGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 949518242 3:4826439-4826461 CACGGCAGAGTCAAGAATATCGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949518239 Original CRISPR CCGTGGTGCCAGCTAACTTC AGG (reversed) Intronic
902412506 1:16219607-16219629 CCATGGTCCCAGCAGACTTCTGG - Intergenic
902593365 1:17490915-17490937 CCGTGGGCCAAGCTAACTTTGGG + Intergenic
910393104 1:86764325-86764347 CTGAGGTGACACCTAACTTCAGG + Intergenic
911398364 1:97340549-97340571 CTGTGGTCCCAGCTACTTTCGGG + Intronic
921383758 1:214550664-214550686 CAGTGGTGCCACCGAACTCCTGG - Intronic
923390907 1:233514121-233514143 CCATGGGGCCAGCTATTTTCTGG + Intergenic
1065712471 10:28532050-28532072 CCGTGGTGCCAGCTACTTAGAGG + Intergenic
1068659779 10:59612076-59612098 CTGTGGTCCCAGCTAGCTCCAGG - Intergenic
1070621697 10:78017322-78017344 CCGTGGTCCCAGCTACTTTGGGG + Intronic
1076795645 10:132796969-132796991 CCGTGGTGACAGTTAATTCCTGG + Intergenic
1084316980 11:68351300-68351322 CCGGGGAGCCAGCTGACCTCCGG + Intronic
1084409885 11:69000665-69000687 CAGTGGTGCCAGGGAACTTTGGG + Intergenic
1085631005 11:78116594-78116616 CTGTGGTCCCAGCTAACTGGAGG + Intronic
1089828143 11:121298120-121298142 CTGTGGTCCCAGCTACCCTCAGG - Intronic
1090866316 11:130703920-130703942 CTTTGGTGTCAGCTGACTTCTGG + Intronic
1095554248 12:43482278-43482300 CCGTGGTGACAACACACTTCAGG - Intronic
1103826723 12:123745010-123745032 CTGTGGTGCCACCTAGCTTCGGG + Intronic
1107372992 13:39772598-39772620 CCATGGTGCCAGGGAACTTTAGG - Intronic
1110068423 13:71140664-71140686 CAGTGATGCCAGATAACTTTTGG - Intergenic
1110322492 13:74175842-74175864 CCTTGATGCCAGCTAATTCCAGG + Intergenic
1122454939 14:101842677-101842699 CCGTGGTGCCTGCTCACACCTGG + Intronic
1127475722 15:59330890-59330912 CTGTGGTCCCAGCTACCTGCAGG - Intronic
1128126013 15:65193493-65193515 CAGGGGTGCCAGGTAACCTCAGG - Intergenic
1129162031 15:73752595-73752617 CGGCGGTGCCAGCTCACTCCGGG - Exonic
1134979494 16:18595637-18595659 CTGTGGTCCCAGCTAGCTACTGG - Intergenic
1138432742 16:56979635-56979657 CTGTAGTGCCAGCTAGCTACTGG - Intronic
1139972794 16:70786581-70786603 CAGTGGTGCTATCTCACTTCTGG + Intronic
1141073008 16:80975209-80975231 TCGAGGTGCCAGTTAACTCCTGG - Exonic
1141560808 16:84866627-84866649 GCGTGGGGCCTGCTAACCTCTGG + Intronic
1143774090 17:9186436-9186458 GCATGGAGCCAGCCAACTTCTGG + Intronic
1146264105 17:31439731-31439753 CTGTGGTACCAGCTAATTGCGGG - Intronic
1153971232 18:10229058-10229080 CTGTGGTCCCAGCTAACTGGGGG - Intergenic
1155498240 18:26463331-26463353 CTGTGGTCCCAGCTAAGTTGAGG + Intronic
1157021892 18:43793049-43793071 CCGTGGTGTAAGATAACTTTAGG - Intergenic
1158679262 18:59552076-59552098 CCTTGGTGCCAGCTACCGTCTGG + Intronic
1160019361 18:75168178-75168200 CCGTGTTGCCAGGAAACTGCGGG + Intergenic
1162605085 19:11700595-11700617 CCGTGGTCCCAGCTAACTGGAGG - Intergenic
1163008805 19:14412173-14412195 CAGTGGTGACAGCTATATTCGGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166592698 19:44014984-44015006 GCGTGGGCCCAGCTAACTTGGGG - Intergenic
1167509704 19:49889564-49889586 GCGTGGCGCCTGCTAACTGCAGG + Intergenic
1168599139 19:57704211-57704233 CAGTGGTCACAGCTCACTTCCGG - Intronic
925148826 2:1600894-1600916 CCGTGGTGCCAGCTCCCTTCAGG + Intergenic
925148843 2:1600965-1600987 CTGTGGTGCCAGCTCCCTCCAGG + Intergenic
925148861 2:1601036-1601058 CCGTGGTGCCAGCTCCCTCCAGG + Intergenic
925148880 2:1601107-1601129 CCGTGGTGCCAGCTCCCTCCAGG + Intergenic
925148897 2:1601177-1601199 CCATGGTGCCAGCTCCCTTCAGG + Intergenic
927153420 2:20208578-20208600 CCAAGGTGCCAGCTGACTCCCGG + Intronic
932633790 2:73370270-73370292 CCGTGGCAGCAGCAAACTTCAGG - Intergenic
938908587 2:135863606-135863628 CTGTAGTCCCAGCTAATTTCGGG + Intronic
942373957 2:175316587-175316609 CCTTGGGGCCAGCTAACATGTGG - Intergenic
946372918 2:219291373-219291395 CCTTGGTGCTAGCAAACTGCAGG - Intronic
1172364015 20:34335010-34335032 CAATGGTGCCAGCCAGCTTCGGG + Intergenic
1172727886 20:37060657-37060679 CTGTAGTTCCAGCTAACTTGGGG + Intronic
1173693336 20:44983485-44983507 CTGTAGTCCCAGCTAACTTTTGG + Intronic
1175041819 20:56059264-56059286 CCAGGGTGCCTGCTGACTTCTGG + Intergenic
1182064977 22:27424468-27424490 CCCTGGTGACAGCTATGTTCTGG + Intergenic
1182691452 22:32166512-32166534 CTGTGGTCCCAGCTAACACCGGG + Intergenic
949518239 3:4826421-4826443 CCGTGGTGCCAGCTAACTTCAGG - Intronic
955806935 3:62746457-62746479 CTGTGGTCCCAGCTTACTTGAGG - Intronic
958902644 3:99906068-99906090 CTGTGGTCCCAGCTACCTGCGGG + Intronic
971963945 4:33527101-33527123 CCATGTTGCTAGCTATCTTCAGG + Intergenic
976286758 4:83378128-83378150 CCATGGTGGAAGCCAACTTCTGG - Intergenic
982398029 4:154934500-154934522 CCGTAGTCCCAGCTACCTGCAGG - Intergenic
992470655 5:77049670-77049692 CTGTAGTCCCAGCTACCTTCGGG - Intronic
998044078 5:138972228-138972250 CAGTGGTGCTAGCCAACATCTGG + Intronic
1000122483 5:158210384-158210406 CAGTGGTTCCAGCAAATTTCTGG + Intergenic
1001303592 5:170555524-170555546 CCGTGGGGCCAGCTAGCTCTTGG - Intronic
1013505891 6:110799718-110799740 CTGTGGTCCTAGCTAACTTGGGG - Intronic
1015667019 6:135642951-135642973 ACATGGTGGCTGCTAACTTCTGG - Intergenic
1021598037 7:22337603-22337625 CCGTGGGCCAAGCTAACTTTGGG - Intronic
1035028127 7:155839960-155839982 CGGTGGTGGTTGCTAACTTCTGG - Intergenic
1038732298 8:30138475-30138497 CCGTGGTGCAAGCAAACTGTAGG + Intronic
1040700880 8:50064064-50064086 TCGTGGTACCAGCTAACTCTGGG + Intronic
1042951146 8:74201988-74202010 TCATGATGCCAGCTAGCTTCTGG - Intergenic
1046829170 8:118725172-118725194 ACATGGTGCCATCTAACTTCAGG + Intergenic
1049029388 8:140023178-140023200 CCGTAGTGCCAGCAGCCTTCGGG - Intronic
1050019167 9:1266208-1266230 CTGTGGTTCCAGCTACCTTAGGG + Intergenic
1056667914 9:88596729-88596751 CTGTGGGGTCAGCTAACTCCAGG - Intergenic
1057800129 9:98185879-98185901 CTCTGGTGCCAGCAAACTCCTGG - Intronic
1059259899 9:112965791-112965813 CTGTGGTCCCAGCTACTTTCAGG - Intergenic
1061004857 9:127922969-127922991 CCTTGGTGCCACATGACTTCAGG + Intronic
1061117635 9:128624673-128624695 CCCTGGTGCCAGCCCAGTTCCGG - Intronic
1186201023 X:7154991-7155013 GCTTGGTGCAAGCTAACATCTGG + Intergenic
1196184467 X:112731195-112731217 CCTTGGGCCAAGCTAACTTCGGG + Intergenic
1201576054 Y:15462352-15462374 TCCTGGTGCAAGCTAACATCTGG + Intergenic