ID: 949518853

View in Genome Browser
Species Human (GRCh38)
Location 3:4831424-4831446
Sequence TCTCACATACCGATGTCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949518853_949518854 -9 Left 949518853 3:4831424-4831446 CCTAATGACATCGGTATGTGAGA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 949518854 3:4831438-4831460 TATGTGAGATGCCAGCAGCAAGG 0: 1
1: 0
2: 3
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949518853 Original CRISPR TCTCACATACCGATGTCATT AGG (reversed) Intronic
915048664 1:153042942-153042964 TCTCACACAGTGATCTCATTTGG - Intergenic
915053038 1:153096361-153096383 TCTCACACAGTGATCTCATTTGG - Intronic
917285611 1:173418936-173418958 ATTCACATATCGATGACATTTGG + Intergenic
920930344 1:210382206-210382228 TCTCACACCCCTATGTCACTAGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923385556 1:233462253-233462275 ACTCACATGCCGATCTCCTTTGG + Intergenic
1062797894 10:358383-358405 TTTCACATACAGATGTCGTGGGG + Intronic
1072150853 10:92681888-92681910 CCTCACATACCACTGTCATGTGG - Intergenic
1080358583 11:31484395-31484417 TTTCACATACCATTGTTATTTGG - Intronic
1088331657 11:108660464-108660486 TATCACATTCCAAAGTCATTAGG - Intergenic
1088331811 11:108662296-108662318 TATCACATTCCAAAGTCATTAGG - Intergenic
1094633595 12:32202346-32202368 TCTCACCTACCCCTGTAATTTGG - Intronic
1103223485 12:119266694-119266716 TCTCACATACCAAGGTGATATGG + Intergenic
1107281069 13:38735940-38735962 TCTGACATCCCCATGTCTTTAGG + Intronic
1107910704 13:45103020-45103042 ACTCACAAACCGAGCTCATTAGG + Intergenic
1109907600 13:68865449-68865471 TCTCAAATACTGAGGTCAGTTGG - Intergenic
1117394950 14:55299530-55299552 AGACACATACCGATGTAATTAGG - Intronic
1135336327 16:21604562-21604584 TCTCACATAAAGAGGTTATTGGG + Intronic
1138981982 16:62280769-62280791 TCTCACATACCCATGTGTTTTGG - Intergenic
1145884151 17:28371348-28371370 TCCCACGTACCGATGTCACGTGG + Intronic
929653707 2:43708032-43708054 TATAACATACAGATGTCATTTGG - Intronic
937485499 2:122310867-122310889 TCTCCCATCACGATGTCAGTTGG + Intergenic
937485893 2:122314459-122314481 TCTCCCATCACGATGTCAGTTGG - Intergenic
944192442 2:197017952-197017974 ACTCACATGGAGATGTCATTAGG + Intronic
945460262 2:210099817-210099839 TCTCACATACCCGAGTCATATGG + Intronic
948391881 2:237617654-237617676 CCTCAGATACCCATGGCATTCGG - Intergenic
1178667404 21:34560878-34560900 TCTTACAAACTGATGTGATTTGG + Intronic
1179101523 21:38359088-38359110 TCTCCCATCCCCATGTGATTTGG - Intergenic
1181294464 22:21824648-21824670 TCTCATATACAGATGTCTGTAGG + Intronic
949518853 3:4831424-4831446 TCTCACATACCGATGTCATTAGG - Intronic
949647368 3:6111428-6111450 TCTCACAAAATGATATCATTAGG + Intergenic
950874655 3:16260441-16260463 TGTCAGATACCGAAGTAATTTGG + Exonic
951689342 3:25379407-25379429 TCTGACATACCCATGGCACTAGG - Intronic
954414530 3:50386655-50386677 TCTCACCTCCTGGTGTCATTGGG + Intronic
960940477 3:122929829-122929851 TCTCACATGCCCATGGCATTAGG + Intronic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
977111848 4:92966443-92966465 TCTCACATCCAGATTTCAGTGGG + Intronic
979518990 4:121644247-121644269 TCTTACATAACGAAGTCATGGGG + Intergenic
983765339 4:171473953-171473975 TCTGAGATACAGATTTCATTCGG + Intergenic
991319870 5:65360411-65360433 CCTCACATACTGATATGATTTGG - Intronic
1001659692 5:173381924-173381946 TCTCAAATACTGATGTCTTGTGG + Intergenic
1012517116 6:100075006-100075028 TAGCACATACCGATGTCTATGGG - Intergenic
1016578241 6:145596766-145596788 TCTCACATTCTGCTATCATTTGG + Intronic
1020971328 7:14944332-14944354 TCACACATTCCTATTTCATTAGG - Intronic
1027008515 7:74720315-74720337 TGTCACCTACTGATGTCACTTGG + Intronic
1029986813 7:104930271-104930293 TCTCACATACCAATTTCAGGGGG - Intergenic
1036040958 8:5081024-5081046 TCTCAAATAAAGAGGTCATTCGG - Intergenic
1036284511 8:7432007-7432029 TCAGACATAACGATGGCATTGGG + Intergenic
1036336965 8:7879523-7879545 TCAGACATAACGATGGCATTGGG - Intergenic
1037162934 8:15794666-15794688 ACTCACATGCAGGTGTCATTGGG - Intergenic
1038353494 8:26804361-26804383 TTTCACATATCGATGAAATTTGG - Intronic
1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG + Intergenic
1042093827 8:65189928-65189950 GCTCACAAATCAATGTCATTGGG + Intergenic
1045423822 8:102043113-102043135 TCTCACACAAGGAAGTCATTCGG + Intronic
1047650213 8:126912341-126912363 TCTAAAATTCCAATGTCATTCGG + Intergenic
1048406505 8:134127970-134127992 TCTAACAGACCTATGTCATTAGG + Intergenic
1054973759 9:71119201-71119223 TCAAAAATACAGATGTCATTTGG + Intronic
1056090541 9:83201095-83201117 TCTCCCAAACCTATATCATTGGG - Intergenic
1057519036 9:95746384-95746406 TCTAACATACCACTGACATTAGG + Intergenic
1059701725 9:116781470-116781492 TGTCACATGCCTATATCATTTGG + Intronic
1060269626 9:122131505-122131527 TCTCACATTCCTATGTCAGTAGG + Intergenic
1061489526 9:130937600-130937622 TCTTCCAGACAGATGTCATTGGG - Intronic
1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG + Intronic
1187617565 X:21014258-21014280 TCACACATACAGATGACACTTGG - Intergenic