ID: 949519568

View in Genome Browser
Species Human (GRCh38)
Location 3:4837489-4837511
Sequence GACATACTCCCTGATCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949519567_949519568 10 Left 949519567 3:4837456-4837478 CCAGGTGTTGGGGATAAAACAGT 0: 1
1: 0
2: 5
3: 49
4: 274
Right 949519568 3:4837489-4837511 GACATACTCCCTGATCTCACAGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949519568 Original CRISPR GACATACTCCCTGATCTCAC AGG Intronic
901892572 1:12280156-12280178 GTCATTTTCCCTGATTTCACAGG + Intronic
902758767 1:18567121-18567143 GACATCCTTCCTGTTCTTACCGG - Intergenic
903947370 1:26972231-26972253 GAGATACTCCATGCTCTCCCTGG - Intergenic
904937396 1:34141322-34141344 GACAAGCTCCTTGATCTCATGGG + Intronic
905162872 1:36052319-36052341 TATATACTGCATGATCTCACTGG + Intronic
908826019 1:68133453-68133475 GACATAGTCCTTGCTCTCAAGGG - Intronic
910532913 1:88261025-88261047 CAAATACTCCCGGATCTCAGTGG + Intergenic
912587364 1:110779268-110779290 GAAGTGCTCCCTGATCTCAAGGG + Intergenic
912717570 1:111992594-111992616 GAAATACACCCTGAGCTCGCGGG - Intergenic
915030099 1:152871810-152871832 GACCTACTCCCAGATCCCAAAGG + Intergenic
915611158 1:156994178-156994200 GACATGGTCCCTGTTCTCAGGGG - Intronic
916820004 1:168388910-168388932 GACATAGTCCCTGTTCACAGGGG + Intergenic
919497648 1:198295368-198295390 GACTTACTCCCTGACCTCCAGGG - Intronic
922975165 1:229778114-229778136 AACAGACTCCCAGATGTCACTGG + Intergenic
1062810329 10:458641-458663 GACATCCTCCTTGCTGTCACGGG - Intronic
1064504811 10:16017140-16017162 GAAATTCTCCCTGATCTTACTGG - Intergenic
1067164417 10:43853823-43853845 GGCCTCCTCCCTGACCTCACTGG - Intergenic
1067898161 10:50208884-50208906 GACATACTTTCTGATCTTAAAGG + Intronic
1069360005 10:67631638-67631660 GATATAGTCTCTGATTTCACTGG - Intronic
1072309891 10:94144720-94144742 GGCATACTCCCTGCTGCCACTGG - Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073808214 10:107123453-107123475 GACATATTCCCTGCTTTCAAAGG - Intronic
1074434477 10:113422238-113422260 GAAGTAATCCCTGTTCTCACTGG + Intergenic
1075015692 10:118908660-118908682 GACACACCCTCTGATCTCAGGGG - Intergenic
1075207176 10:120457587-120457609 GACCTGCTCCCGGGTCTCACCGG + Intronic
1075451590 10:122555570-122555592 GACATGCTCCCTGTCCTCACAGG - Intergenic
1077708659 11:4513961-4513983 GAAATGCTTCCAGATCTCACTGG - Intergenic
1079567045 11:21895739-21895761 GATATAATCACTGATCTCAAAGG - Intergenic
1084611372 11:70205259-70205281 GACCAGCTCCCTGATCTCAGTGG + Intronic
1087266020 11:96062291-96062313 GAAATACTACATCATCTCACTGG - Intronic
1098643235 12:72864194-72864216 TACATACTCCACGATCTCAATGG - Intergenic
1099165403 12:79300449-79300471 GACGTTCTCTCTGATCTCCCTGG - Intronic
1100035473 12:90245823-90245845 GACTCACTCACTGATCCCACTGG - Intergenic
1100765036 12:97854571-97854593 GAAGTAGTCCCTGATCTCACTGG - Intergenic
1101568678 12:105933648-105933670 GACATAATCCCTGCTTTCAAAGG + Intergenic
1103525946 12:121568594-121568616 GACATCCTCCACGATTTCACTGG + Intronic
1107703240 13:43071263-43071285 GACCTGCTCCCTCATCTCAGAGG + Intronic
1108473991 13:50795284-50795306 GCTATAATCCCTGATCTCACAGG - Intronic
1110396814 13:75039729-75039751 GGCATAGTCCCTGTTCTCATGGG - Intergenic
1113875487 13:113592019-113592041 GCCATAGTCCCTGTCCTCACAGG - Intronic
1116693526 14:48142322-48142344 GATATACCCCCTTATTTCACTGG - Intergenic
1117665494 14:58052185-58052207 GACACAGTCCCTGGTCTCACTGG - Intronic
1118873005 14:69759005-69759027 CAAATACTTCCTGATGTCACTGG - Intronic
1120244267 14:81987903-81987925 GATTTTCTCACTGATCTCACAGG + Intergenic
1121629318 14:95411015-95411037 AACTAACTCCCTGAGCTCACTGG + Intronic
1122496959 14:102164061-102164083 GAGATACTCTCTGAGCTCCCTGG - Intronic
1124912680 15:33937741-33937763 TACATTCTCCCTGTGCTCACAGG - Intronic
1125470334 15:39996092-39996114 CAAATACTACATGATCTCACTGG - Intronic
1128652498 15:69428848-69428870 GACAGAGTCCCTGCTCTCAGGGG + Intronic
1130208454 15:81900649-81900671 GACTTCCTCCCAGGTCTCACAGG + Intergenic
1130679767 15:85986225-85986247 GACATCTTCCCTGATGTCCCAGG - Intergenic
1133420336 16:5641307-5641329 GACAAAGTCTCTGATCTCATGGG + Intergenic
1134066514 16:11232038-11232060 GACACATTCCCTGACTTCACAGG + Intergenic
1134802470 16:17098293-17098315 GACAAATTCCCTAATCTCTCTGG - Intergenic
1137781081 16:51098374-51098396 GACATCTGCCCTGAGCTCACAGG - Intergenic
1138205591 16:55122200-55122222 GACAAGATCCCTGATCTCAGAGG + Intergenic
1139325268 16:66147837-66147859 GACACACTCCCTGCTCTCATGGG + Intergenic
1144467917 17:15511367-15511389 GACAGAGTCCCTGATCTTAAAGG + Intronic
1146469863 17:33115455-33115477 CACTTTCTCCCTGCTCTCACAGG + Intronic
1147279363 17:39345889-39345911 GGCATGCTCCCTGCCCTCACAGG - Intronic
1150092492 17:62340271-62340293 GACATGGTCCCTGTTCTCTCAGG - Intergenic
1150143694 17:62750794-62750816 GACATTCTCCGGGATCTTACGGG - Intronic
1151453196 17:74211830-74211852 GCCTTAGTCCCTGATCTCACAGG + Intergenic
1153165898 18:2261932-2261954 GACAAATTCCCTGCTCTCAAAGG - Intergenic
1156392640 18:36665319-36665341 GACACAGTCCCTGACTTCACAGG + Intronic
1158686950 18:59623230-59623252 GACAAGCTCCCTGATTTCACTGG + Intronic
1158737706 18:60102867-60102889 GACATAAGCCCTGTTCTCAGAGG + Intergenic
1158897874 18:61932186-61932208 AAAATACTCCCAGACCTCACTGG + Intergenic
1161442317 19:4299075-4299097 TAGATGCTCCCTGACCTCACTGG - Intronic
1162948014 19:14055138-14055160 GACATCCTCCCTGGGCTCAGAGG + Exonic
1163221580 19:15925269-15925291 GGCAAACTCCCTAATCTCTCTGG + Intronic
1165266647 19:34667105-34667127 AACAGAGTCCCTGATCTCAAAGG - Intronic
1165935120 19:39384377-39384399 AACAGACTTCCTGACCTCACTGG - Exonic
1166313014 19:41973725-41973747 GACACCATCCCTGTTCTCACAGG - Intronic
926579886 2:14623419-14623441 GACACATTCCCTGTTCTCAGTGG - Intergenic
927589635 2:24342522-24342544 GACAGACTCCTTGATCTCGTAGG + Intronic
928458014 2:31441314-31441336 GATATGGTCCCTGATCTCATGGG - Intergenic
932738263 2:74271168-74271190 GACATTCTACATGATCTCAGAGG - Intronic
933755463 2:85634706-85634728 GACCAACTCCCTGAGCTCCCAGG + Intronic
937470712 2:122171853-122171875 GACAAATTCCCTGATTTCAGTGG + Intergenic
938385654 2:130865046-130865068 GTCATACTCCCTGTCCTCAGAGG + Intronic
941025591 2:160452761-160452783 GACGTACTACCTGCTCTCACAGG + Intronic
941984047 2:171491984-171492006 GCCAGACTTCCTCATCTCACTGG - Intergenic
942296247 2:174519817-174519839 GACAGACTCACTAATCTCAGAGG - Intergenic
942332777 2:174845407-174845429 GATATACAACCTGATCTAACAGG - Intronic
943758137 2:191579442-191579464 GACATTGTCCCTGTCCTCACAGG + Intergenic
944012841 2:194994912-194994934 GAAATACTGCATGTTCTCACTGG - Intergenic
945973766 2:216254713-216254735 GCCATACATCCGGATCTCACAGG + Intergenic
1168981679 20:2009397-2009419 GACATATTCCCTGTTCTCCTGGG + Intergenic
1175126848 20:56758859-56758881 GACTAAGTCCCTGATCTCATCGG + Intergenic
1176660581 21:9631409-9631431 CAAATACCCCATGATCTCACTGG - Intergenic
1180204690 21:46251460-46251482 CACTTACTCCCAGATATCACTGG - Intronic
1183562393 22:38585693-38585715 GACACAGTCCCTGTTCTCAAGGG - Intronic
1184258386 22:43300451-43300473 GACACGGTCCCTGTTCTCACGGG + Intronic
1185366806 22:50440581-50440603 GACACATGCCCTGGTCTCACAGG - Intronic
949179463 3:1110984-1111006 GACATACACTTTGATTTCACTGG + Intronic
949519568 3:4837489-4837511 GACATACTCCCTGATCTCACAGG + Intronic
949961274 3:9314509-9314531 GACACATTCCCTGCTCTCATGGG + Intronic
954225375 3:49177727-49177749 GACGTACTGCCTGACCTCCCAGG - Exonic
954589822 3:51773834-51773856 GACAAACTGCCTAATCTCAGTGG - Intergenic
956178756 3:66499516-66499538 GACAAACTCCCAGCACTCACAGG + Intronic
962858471 3:139372900-139372922 GACATACTCCTTGCCCTCAAAGG + Intronic
962890973 3:139672845-139672867 GACTTTCTCCCTGTTCTCAGTGG + Intronic
963074056 3:141330190-141330212 GACACACTCCCTGAGGCCACTGG - Intronic
965167195 3:165210162-165210184 GCCATACTACCTCCTCTCACAGG - Intergenic
965494728 3:169383852-169383874 GAAATACTCACTGAGCTCAGAGG - Intronic
967224454 3:187277292-187277314 GACATAGGCCCTGAACTCATGGG + Intronic
970140694 4:12979020-12979042 GAGATAGTCCCTGGTCTCAGTGG - Intergenic
970368621 4:15386113-15386135 GACATCCTCCCTGCTCTCTGAGG - Intronic
972826354 4:42764183-42764205 CACTTACTCACTGATGTCACTGG - Intergenic
976065689 4:81184689-81184711 AACATGCTCCCTTATCTCAGAGG - Intronic
977124531 4:93148749-93148771 GACAAAATCCCTGTCCTCACAGG - Intronic
982106997 4:152019872-152019894 GCTGTAATCCCTGATCTCACAGG + Intergenic
984870507 4:184320608-184320630 GCCATACTCCCTGGTGTCAATGG + Intergenic
984875292 4:184362471-184362493 GGAATACTCCCTGAGCCCACTGG - Intergenic
985414780 4:189725005-189725027 CAAATACCCCATGATCTCACTGG + Intergenic
987159472 5:15126207-15126229 TACAAAATCCCTGAACTCACAGG - Intergenic
987818832 5:22935541-22935563 GAGATAGTGCCTGATCCCACAGG - Intergenic
993932217 5:93954277-93954299 GACATACTCCCTGGTATCACTGG + Intronic
996277944 5:121691074-121691096 GACAAATTCCCTGACCTCAAGGG - Intergenic
999293110 5:150440599-150440621 GACATACTCCCTTCCCTCTCAGG + Intergenic
999693865 5:154171277-154171299 GATATACTCCCTGCCCTCATGGG + Intronic
999929602 5:156416673-156416695 GACAAACTCCTTCATCTCTCTGG + Intronic
1000147274 5:158465807-158465829 GACACTCTCCCTGATTTCAGGGG - Intergenic
1000703757 5:164486020-164486042 CACATGCTCCCAGACCTCACTGG + Intergenic
1000830050 5:166092019-166092041 AACATACTTCCTGATTTTACTGG - Intergenic
1003728429 6:8792531-8792553 GCCAGACACCCTGAACTCACAGG + Intergenic
1007029469 6:38615077-38615099 GACATGCTCCCTTATGCCACAGG + Intronic
1008605996 6:53140160-53140182 GACATTCTCCTTGACCTCAAGGG - Intronic
1008708754 6:54197345-54197367 GACATACCCCCTGTTTTCAGAGG - Intronic
1009544329 6:65005160-65005182 GACATCCTGCCAGATCTCAAGGG - Intronic
1012493140 6:99804974-99804996 GACTTGCTCCCTGATCTCAAAGG - Intergenic
1018195840 6:161355774-161355796 GTCAAGGTCCCTGATCTCACCGG + Intronic
1020665083 7:11031288-11031310 GACATAGTCCTTTATCTCATTGG + Intronic
1022337591 7:29436272-29436294 GACATGCTCCCTAGTCTTACTGG - Intronic
1022960616 7:35422925-35422947 GACATACTCACTGTTCACCCTGG - Intergenic
1025147650 7:56518680-56518702 GCCATAGTCCCTGATCTCTAGGG + Intergenic
1026733045 7:72927874-72927896 GACAAAATCCCTGCTCTCATGGG + Intronic
1027514009 7:79118758-79118780 GACCTCCTCCCTGATTCCACTGG + Intronic
1028294087 7:89105734-89105756 GAAATAGTTTCTGATCTCACAGG + Intronic
1029590026 7:101501266-101501288 CACTTACTCCCTGATTCCACAGG - Intronic
1030153627 7:106429834-106429856 GACATGCTCCCTGCCCTCACAGG - Intergenic
1030965108 7:115982168-115982190 GAAATGCTCCCTGATGTCACAGG + Intronic
1031579938 7:123460786-123460808 GTCAGAATTCCTGATCTCACAGG + Intronic
1034520244 7:151614080-151614102 GACCAACTCTCTGGTCTCACTGG + Intronic
1036117128 8:5970874-5970896 GTCATACACCCTGAACTCAAAGG - Intergenic
1037558834 8:20054294-20054316 GACATAGTGTCAGATCTCACAGG + Intergenic
1038948984 8:32393072-32393094 AACATAGTACCTGATCTCTCAGG - Intronic
1042814834 8:72866991-72867013 GACATAGTCCCTGTCCTCAAGGG - Intronic
1043235178 8:77855865-77855887 GACATATCCTCTGATCTCAGAGG - Intergenic
1047085074 8:121507001-121507023 GACATACTCAATTATCTTACGGG - Intergenic
1047630093 8:126697391-126697413 GACATAATCCCTGTCCTCAAGGG - Intergenic
1050201563 9:3150435-3150457 GGAATAATGCCTGATCTCACTGG + Intergenic
1054154463 9:61630335-61630357 GGCATAATCCCTGAACTCAAGGG + Intergenic
1060028792 9:120196158-120196180 CACATACTGCCCGATCTCACGGG + Intergenic
1203638150 Un_KI270750v1:133253-133275 CAAATACCCCATGATCTCACTGG - Intergenic
1188363054 X:29280686-29280708 GACAAAGTCCCTGCTCTCAAGGG + Intronic
1192177702 X:68896070-68896092 GACATAGTCTCTGCTCTCAGGGG + Intergenic
1192343109 X:70280409-70280431 GACTTGCTCACTGAGCTCACAGG - Intronic
1194092679 X:89598838-89598860 GATATACTATTTGATCTCACTGG - Intergenic
1195361808 X:104089494-104089516 AACACATTCTCTGATCTCACTGG + Intergenic
1198343045 X:135733273-135733295 GAGATACTACCTCACCTCACTGG + Intergenic
1198344944 X:135750022-135750044 GAGATACTACCTCACCTCACTGG - Intergenic