ID: 949520595

View in Genome Browser
Species Human (GRCh38)
Location 3:4849963-4849985
Sequence ACTGATATCCCCACTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949520595 Original CRISPR ACTGATATCCCCACTCTGGA AGG (reversed) Intronic
902630712 1:17702808-17702830 CCTGCTATCCCCACCCTGGGGGG + Intergenic
903641835 1:24865470-24865492 CCAGATCTTCCCACTCTGGATGG - Intergenic
911333732 1:96556038-96556060 AGTGATCTCTCCACTCTGGCAGG + Intergenic
911976375 1:104502143-104502165 ACTCTTAACCCCACTCTGGTGGG - Intergenic
914234224 1:145793643-145793665 ACTGATATGCCACCTCTCGAGGG - Intronic
919609397 1:199726509-199726531 ACTGATTTCCCCACCATTGAAGG - Intergenic
922563281 1:226584612-226584634 ACTGAGAGCCCCACTCTGCCTGG + Intronic
924396920 1:243630441-243630463 ACAGATATTCCCACTCAGAAAGG + Intronic
924519041 1:244789803-244789825 GCTGATATCCTCACTCTGGTAGG + Intergenic
1062853905 10:769731-769753 ACTGAAATCCTCACCCCGGAGGG + Intergenic
1071579355 10:86756142-86756164 CCGGATATCCCCACTCTCGCGGG - Intergenic
1071985729 10:91048361-91048383 ACTGATCTCCACACCATGGAAGG + Intergenic
1077846892 11:6034762-6034784 ACTATTATCCCCACTGTGTAGGG + Intergenic
1081876058 11:46409172-46409194 ACTGAGAACTCCACTTTGGAAGG + Intronic
1081919905 11:46764634-46764656 ACTAATATCCTCCCTGTGGAGGG + Intronic
1085664331 11:78400144-78400166 ACAGATTCCTCCACTCTGGATGG + Intronic
1086364852 11:86098580-86098602 ACTGTTATACCAACTCTGGATGG + Intergenic
1089519170 11:119052298-119052320 ACTCATTTCGGCACTCTGGAGGG + Exonic
1091388093 12:107856-107878 ACTGATATCCATACTCTGTAAGG - Intronic
1091622465 12:2099738-2099760 ACGGACAGTCCCACTCTGGAAGG + Intronic
1093456761 12:19372433-19372455 ACTAATATCCAGAATCTGGAAGG - Intronic
1095276169 12:40285179-40285201 AGTGCTATCACCAGTCTGGAAGG + Intronic
1104248100 12:127062165-127062187 GCTGACATCCCCACTGTGTAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107761553 13:43684712-43684734 ACTGATATGACCTCTTTGGAGGG + Intronic
1108514550 13:51188163-51188185 ATTGCTCTCCCCACTCTGAATGG + Intergenic
1109365159 13:61345172-61345194 ACTGTGCCCCCCACTCTGGATGG + Intergenic
1110027548 13:70560305-70560327 ACTTATTCACCCACTCTGGAAGG - Intergenic
1110099059 13:71572847-71572869 ACTGATGTCTCAACTCTGGATGG + Exonic
1111880703 13:93953357-93953379 ACTGAAAACCCCAGTCTGAAGGG - Intronic
1112330894 13:98476253-98476275 ACTGACTGCCCCACTCTGCAGGG - Intronic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113757844 13:112826198-112826220 AGAGATAGCCCCGCTCTGGACGG - Intronic
1116865401 14:50027698-50027720 ACTGAAATCCCCCCGCTGAAAGG - Intergenic
1119324289 14:73750469-73750491 ACAGATACCCCCAGTCTGGAGGG - Intronic
1120780682 14:88482954-88482976 CCTGTAATCCCCACTTTGGAAGG + Intronic
1124210666 15:27762521-27762543 ACTGAAATCCCCACCCAGGGAGG + Intronic
1124374778 15:29123159-29123181 ACTGTTACCCCCTCTCTCGAGGG - Exonic
1128247482 15:66143098-66143120 ATTGATATCCGCACTGTGGCAGG - Intronic
1128651774 15:69420874-69420896 ACTTATAATCCCACTTTGGAAGG - Intronic
1129009373 15:72401286-72401308 TCTGATATCAGCACTTTGGAAGG + Intronic
1130237979 15:82155950-82155972 ACTTATATCCCCAATATGGAAGG - Intronic
1130685203 15:86031165-86031187 CCTGACATCCCCACTCTGCTGGG - Intergenic
1130961298 15:88660161-88660183 ACTGACATTTCCATTCTGGAGGG - Intergenic
1131072726 15:89476324-89476346 ACTGTAATTCCCACACTGGAAGG - Intronic
1135297762 16:21297667-21297689 GCACATATCCCCACTCTGGTTGG - Intronic
1135915279 16:26600082-26600104 TCTCATATCCCAACTCAGGAGGG - Intergenic
1140566319 16:76046928-76046950 ATTGAAATCCCCACTTTTGAAGG - Intergenic
1141983652 16:87565630-87565652 GCTGGAATCCCCACTCTGCATGG + Intergenic
1143243928 17:5467598-5467620 AGGGATAACCCCACTCTGGCCGG + Intronic
1144583300 17:16472419-16472441 ACTGAGACCCCCCCACTGGAGGG + Intronic
1144767376 17:17740051-17740073 CCAGCTATCCCCACTTTGGAAGG - Intronic
1146404704 17:32527219-32527241 TCTGAAGTCCCCTCTCTGGATGG - Intronic
1146806793 17:35871300-35871322 AGTGACTTACCCACTCTGGAGGG - Intergenic
1147751360 17:42736222-42736244 AGTGATATAGCCACTGTGGAAGG + Intronic
1148120171 17:45204406-45204428 ACTAATATCCCAAATCTGCAAGG - Intergenic
1155144269 18:23070467-23070489 ACTAAAATCCCCACCCGGGAAGG + Intergenic
1158738884 18:60116310-60116332 ACTAATATCCAGACTCTAGAAGG + Intergenic
1159127726 18:64244709-64244731 CCTGCTATCCCCACTGTAGACGG - Intergenic
1161144747 19:2670931-2670953 ATTGATATCCCCACCCTGAGTGG + Intronic
1162713536 19:12613771-12613793 ACTCATATGCCCACCATGGAAGG + Intronic
1166442980 19:42832316-42832338 AAATATCTCCCCACTCTGGATGG - Intronic
1166450766 19:42898731-42898753 AAATATCTCCCCACTCTGGATGG - Intronic
1166582010 19:43909338-43909360 ACTGATTTCCACACTCTTGGAGG + Intergenic
1168606304 19:57762787-57762809 GCTGAAGTCTCCACTCTGGAAGG + Intergenic
925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG + Intronic
929454384 2:42055621-42055643 ACTGATACCCCTACTCTGGATGG + Intronic
929536426 2:42787113-42787135 ACAGGTGTCCTCACTCTGGAGGG - Intronic
931776906 2:65548774-65548796 GCTCATCTCCCCACTCTGGGTGG - Intergenic
933398316 2:81760035-81760057 ACTAATATCCACAATCTGCAAGG + Intergenic
935815790 2:106844552-106844574 CCTGTTCTCCCCATTCTGGAAGG + Intronic
940942347 2:159576582-159576604 ATTGATACCACCACTCTGAAAGG + Intronic
941731608 2:168923730-168923752 AATGATATCCGCGTTCTGGATGG + Exonic
943598481 2:189886154-189886176 ACTGGTATCCCCAATCTCCAAGG - Intronic
1170824869 20:19784820-19784842 TCTGGTATTCCCACTCAGGATGG - Intergenic
1173376800 20:42492269-42492291 AATGATATAGCCGCTCTGGAAGG - Intronic
1176264807 20:64203601-64203623 ACTGAAAACCCCACCCTGGAAGG + Intronic
1177946672 21:27479280-27479302 ACTGATATTTCCATTCTGAAAGG + Intergenic
1178614537 21:34119852-34119874 AATAAAATCCCCACTCAGGAAGG - Intronic
1180785758 22:18546790-18546812 TCTGATTCCCCAACTCTGGATGG + Intergenic
1181242683 22:21486344-21486366 TCTGATTCCCCAACTCTGGATGG + Intergenic
1183016638 22:34993800-34993822 ACTGATATCCCCATTAGAGAGGG - Intergenic
1185170788 22:49292705-49292727 ATGGCTATCCCCACTCTGCAGGG + Intergenic
949520595 3:4849963-4849985 ACTGATATCCCCACTCTGGAAGG - Intronic
954622794 3:52005416-52005438 TCTCTTATCCCCACTCTGGGCGG - Intergenic
956341027 3:68224347-68224369 ACTGATCTGTCCACTCTGTAGGG + Intronic
958072482 3:88632234-88632256 ACCCATGTCCCCACTCTGTATGG - Intergenic
960061660 3:113329303-113329325 AATGATAACTCAACTCTGGAAGG + Intronic
960352320 3:116608245-116608267 ACTGATATCCTCAATCTAGAGGG - Intronic
961357891 3:126350401-126350423 AGTGATGTCCTCACTCAGGAGGG + Intronic
961407897 3:126695341-126695363 ACTGATATCCAGAATCTGTAAGG - Intergenic
962455152 3:135558252-135558274 ATTGCTATCCCCAGTGTGGATGG - Intergenic
964088092 3:152842584-152842606 ACTGACATCCCCAGTCAGCATGG + Intergenic
966873660 3:184308828-184308850 CCTGTTACCCCCATTCTGGAAGG + Exonic
975684321 4:76904685-76904707 AGTGATATCACCACTCAGGAAGG + Intergenic
975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG + Intronic
977368394 4:96102180-96102202 CCTGTAATCCCCACTGTGGAGGG + Intergenic
977704310 4:100053992-100054014 ACTCATTCTCCCACTCTGGAGGG + Intergenic
978625362 4:110679411-110679433 ACAGAGATCCCTACTCGGGAGGG - Intergenic
981491516 4:145345300-145345322 ACTGAGATCCCCATTGTTGAAGG - Intergenic
983557099 4:169068535-169068557 CCTGATTTCCCCACACAGGAAGG - Intergenic
983756734 4:171347872-171347894 ACTGTTTTCCACATTCTGGAAGG - Intergenic
985970457 5:3374003-3374025 ACTGCTAACACCACTCTGGGAGG + Intergenic
986782978 5:11084261-11084283 ACTGATATCCCCTCCCAGGGAGG + Intronic
989109924 5:37897226-37897248 TCTGTTCACCCCACTCTGGAAGG + Intergenic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
990047816 5:51456465-51456487 AATTATATCCCTTCTCTGGAAGG + Intergenic
994759683 5:103836818-103836840 CCTGGTGTCTCCACTCTGGAGGG + Intergenic
996205268 5:120726745-120726767 ACTGACATGTCCACTCTTGATGG + Intergenic
996843239 5:127871242-127871264 ATTGATCTCCTCACTTTGGATGG - Intergenic
997238238 5:132287924-132287946 ACTGATTGCACCACTCTTGAGGG - Intronic
997465047 5:134081857-134081879 ACTGATTCCACCACTCTTGAGGG - Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
998802589 5:145885389-145885411 AATGAAACGCCCACTCTGGAGGG - Intergenic
1001040019 5:168327776-168327798 GCTGCTGTCTCCACTCTGGAAGG + Intronic
1004024633 6:11806706-11806728 ACAGAGATCAACACTCTGGACGG + Intronic
1004267447 6:14161206-14161228 ACTGATGTCTCCCCTCTGCAGGG - Intergenic
1007067198 6:39002794-39002816 GCTAATATTCCAACTCTGGATGG + Intronic
1016761733 6:147745588-147745610 CCTGGTTTACCCACTCTGGATGG - Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1017744075 6:157431317-157431339 ACTGAACTCCCCACTCTGTATGG - Intronic
1018488476 6:164267699-164267721 AATGATAGAGCCACTCTGGAAGG + Intergenic
1020109530 7:5440212-5440234 ACTGCCATCCCCACCCTGCATGG + Intronic
1024119931 7:46226377-46226399 ACTAATTTTCCCACTCTGTAAGG + Intergenic
1026883533 7:73922273-73922295 TCTGTTTTCACCACTCTGGATGG - Intergenic
1031754310 7:125618594-125618616 ACTGATATCCTGCCGCTGGAGGG + Intergenic
1032443739 7:131962273-131962295 AGTGATATCCCCACCTTGGGGGG + Intergenic
1033223061 7:139541572-139541594 TATGATATCCCCAGTCTGCAGGG + Intronic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1036948186 8:13115081-13115103 ATTCATATCCACACTCTGGTTGG - Intronic
1038690741 8:29760840-29760862 ACATCTGTCCCCACTCTGGAGGG - Intergenic
1038717501 8:30005033-30005055 ACTGGTGTCCTAACTCTGGAAGG + Intergenic
1041705244 8:60839975-60839997 ACAGATTTGCCTACTCTGGACGG + Intronic
1045300110 8:100903530-100903552 ACTGATATCCCCAAGCTCTAGGG - Intergenic
1046473751 8:114713543-114713565 ACTGATGTCCATACTCTGCATGG + Intergenic
1046964541 8:120149548-120149570 ACTGAGATAGCAACTCTGGAGGG - Intronic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1047789446 8:128187616-128187638 GCTGATTTCCCCTCCCTGGAAGG - Intergenic
1050029837 9:1374307-1374329 ACTGATATTTCCACTCTTTAGGG + Intergenic
1051774618 9:20621083-20621105 AATGTTATCCCCAGTCGGGAAGG + Intronic
1052107305 9:24535103-24535125 ACTAATATCCACAATCTAGAAGG - Intergenic
1052457765 9:28722693-28722715 ACTGATATCAACCCTCAGGAGGG + Intergenic
1053394827 9:37764012-37764034 CATGATATCCTCAGTCTGGATGG + Intronic
1057919163 9:99082490-99082512 ACTGATACCCTCACTGTGGCAGG + Intergenic
1059016489 9:110522293-110522315 AATGTTATCCCCACCATGGATGG - Intronic
1061296721 9:129680755-129680777 CCTGGGATCCCCTCTCTGGAAGG + Intronic
1062140584 9:134955812-134955834 ACTCCTATCTACACTCTGGAGGG + Intergenic
1062477118 9:136733829-136733851 TCTGATATCCCCAGTTTGCAGGG + Intergenic
1186368904 X:8926522-8926544 ATTGATTTCCACTCTCTGGAGGG - Intergenic
1190456836 X:50635283-50635305 ACTGGTATCCCTCCTGTGGACGG + Exonic